Nucleic acid aptamer specifically binding to FGF10 protein and screening method and application thereof

Abstract

The invention relates to a nucleic acid aptamer for specifically recognizing fibroblast growth factor 10 (FGF10) protein as well as a screening method and application of the nucleic acid aptamer. The nucleic acid aptamer is at least one of FAS-1, FAS-4, FAS-9, FAS-10 and FAS-12, and is obtained by screening through a magnetic bead-SELEX (systematic evolution of ligands by exponential enrichment) technology. The aptamer can be combined with FGF10 protein with high affinity, the equilibrium dissociation constant (Kd) of the aptamer is within the range of 5-20 nM, and the aptamer has good recognition specificity. By means of the excellent performance, the nucleic acid aptamer has wide application prospects in construction of an efficient detection method of the FGF10 protein and research and development of an FGF10 antagonist.

Description

Technical Field

[0001] This invention belongs to the fields of medicine and pharmacy, specifically involving high-affinity nucleic acid aptamers that specifically bind to FGF10 protein, as well as their screening, characterization, and application. Background Technology

[0002] Fibroblast growth factor 10 (FGF-10), also known as keratinocyte growth factor-2 (KGF-2), is a protein polypeptide composed of 208 amino acid residues with a relative molecular mass of approximately 24 kDa. Studies have shown that FGF-10 has biological functions in promoting the growth, proliferation, and differentiation of epithelial cells. Topical application of recombinant human FGF-10 (rhFGF-10) protein has been shown to significantly accelerate the healing of corneal wounds induced by alkali burns and carbon dioxide laser damage in rabbits. Toxicological studies have also shown that long-term use of rhFGF-10 eye drops did not produce significant toxicity or adverse reactions to the cornea. In recent years, the potential of FGF-10 in the treatment of dry eye has gradually emerged. Related studies show that it can effectively repair damaged corneal epithelial cells, prolong tear film breakup time, maintain the integrity of the ocular surface barrier, and help rebuild the ocular surface immune network. Furthermore, the key regulatory role of FGF-10 in skin wound repair has also attracted attention, as it can not only accelerate the healing of second-degree burns but also significantly reduce scar formation. These findings strongly suggest that the development of KGF-2 protein formulations for the treatment of ocular and skin injuries holds significant promise.

[0003] In the development of topical formulations, systematic research on the pharmacokinetic properties of drugs is crucial. Enzyme-linked immunosorbent assay (ELISA), a commonly used quantitative analysis method for protein drugs, relies on the specific recognition of target molecules by antibodies. However, because antibodies are derived from biological systems, they suffer from poor batch-to-batch consistency, insufficient chemical stability, and high preparation costs. In contrast, nucleic acid aptamers possess numerous advantages, including small molecular weight, strong chemical stability, ease of modification and functionalization, short synthesis cycle, and low cost. Notably, recent studies have shown that FGF-10 is also a potential therapeutic target for recurrent rheumatoid arthritis. Therefore, developing FGF-10 nucleic acid aptamers with high affinity and high specificity can serve as novel recognition elements for the construction of related detection methods and also possesses the potential to become candidate therapeutic drugs, demonstrating broad research and application prospects. However, there are currently no reported studies on nucleic acid aptamers targeting FGF-10. Summary of the Invention

[0004] The present invention aims to provide an FGF10 nucleic acid aptamer with high affinity and high specificity, as well as a corresponding screening method and application approach.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A high-affinity nucleic acid aptamer that specifically binds to the FGF10 protein: the nucleic acid aptamer is at least one of FAS-1, FAS-4, FAS-9, FAS-10, and FAS-12, and their nucleotide sequences are as follows:

[0007] FAS-1:

[0008] CAGCACCGTCAACTGAATGGTGCGGAACAGTACGAGGGTGGATTC

[0009] AAGATTTGTTAGGTGATGCGATGGAGATGT FAS-4:

[0010] CAGCACCGTCAACTGAATAGGTGCGGGCAGTTGTTGAGGGATGATG

[0011] GTTCGGTGGACTGTGATGCGATGGAGATGT FAS-9:

[0012] CAGCACCGTCAACTGAATGGTGCATTGAGGTCGTGTGGGGAGTCTG

[0013] TAGTGTTGGTGGGTGATGCGATGGAGATGT FAS-10:

[0014] CAGCACCGTCAACTGAATGTGGTGCGTCGGAATTAGGGGTGGAGGG

[0015] TGTATGGTGAAGGTGATGCGATGGAGATGT FAS-12:

[0016] CAGCACCGTCAACTGAATAGGTGCGAAGACAGGCGTGATGGAGGGA

[0017] TTTGGTTGTTTGGTGATGCGATGGAGATGT

[0018] Experimental results showed that the binding affinity between the above nucleic acid aptamers FAS-1, FAS-4, FAS-9, FAS-10, and FAS-12 and the FGF10 protein was determined by surface plasmon resonance (SPR) and biomembrane optical interference (BLI) methods, and the resulting dissociation constant (K) was [value missing]. dThe binding affinity of all aptamers was between 5 nM and 20 nM, indicating excellent binding affinity. Meanwhile, aptamers FAS-1, FAS-4, FAS-9, FAS-10, and FAS-12 showed no significant binding activity to proteins other than FGF10, demonstrating good specific recognition ability.

[0019] This invention also provides an application of the aforementioned nucleic acid aptamers in the preparation of diagnostic reagents for detecting FGF10 protein in blood, serum, plasma, tears, animal tissue homogenates, and urine. These aptamers are unaffected by interference in complex biological matrices such as serum, tears, and animal tissue homogenates, exhibiting good biosample compatibility and enabling specific recognition of FGF10 in real-world complex systems.

[0020] The nucleic acid aptamers were all obtained using magnetic bead-based SELEX, and the screening process included the following steps:

[0021] (1) The aptamer random library was incubated with magnetic beads and then screened to remove sequences that did not specifically bind to the magnetic beads.

[0022] (2) The FGF10 protein was coupled with magnetic beads to construct a magnetic bead-FGF10 complex, and then incubated with a library that had been screened by magnetic beads.

[0023] (3) Use screening buffer to wash away unbound free nucleic acids and retain the nucleic acid sequences bound to the magnetic bead-FGF10 complex;

[0024] (4) The above complex was heated in a buffer solution to denature it, releasing the binding sequence, and the supernatant was collected;

[0025] (5) Use the collected nucleic acid sequences for PCR amplification to obtain enriched products;

[0026] (6) The amplification products are treated with exonuclease to generate a single-stranded nucleic acid library required for a new round of screening;

[0027] (7) In the subsequent SELEX cycle, a reverse screening strategy is introduced, that is, other proteins are added for negative screening, so as to further improve the specificity of the obtained aptamers to FGF10.

[0028] Preferably, the present invention also provides the application of the nucleic acid aptamers described above in the preparation of FGF10 protein detection probes and FGF10 protein target probes. The aptamers FAS-1, FAS-4, FAS-9, FAS-10 and FAS-12 can be used as recognition elements of FGF10 protein and applied to the construction of various detection methods or biosensing systems.

[0029] Preferably, aptamers FAS-1, FAS-4, FAS-9, FAS-10, and FAS-12 can also serve as functional antagonists of FGF10, possessing potential application value. Therefore, this invention also provides an application of the aforementioned nucleic acid aptamers in drug preparation, wherein the nucleic acid aptamers serve as…

[0030] FGF10 antagonists are used to treat recurrent rheumatoid arthritis.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] (1) The nucleic acid aptamers provided by the present invention are derived from in vitro screening, with a short screening cycle, simple synthesis, and low cost. They also have good chemical stability and modification flexibility, and are easy to label with various functional groups.

[0033] (2) This aptamer has high affinity and high specificity for FGF10 protein, and exhibits good stability and compatibility in a variety of biological matrices, with broad application potential and transformation value. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of the process for screening FGF10 nucleic acid aptamers based on the magnetic bead-SELEX method.

[0035] Figure 2 K was measured by the SPR method for 5 candidate aptamers. d value.

[0036] Figure 3 K was measured by the BLI method for 5 candidate aptamers. d value.

[0037] Figure 4 Specificity test results for 5 candidate aptamers Detailed Implementation

[0038] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0039] Example 1: Magnetic Bead-SELEX Screening Process

[0040] Figure 1 This diagram illustrates the SELEX procedure for screening nucleic acid aptamers that specifically recognize the FGF10 protein, which includes the following steps:

[0041] (1) Magnetic bead reverse screening: The initial ssDNA library (sequence 5'-CAG CAC CGT CAA CTG AAT-(N40)-GTG ATG CGA TGG AGA TGT-3') is incubated with heparin beads (MHBs), and the supernatant from which the beads do not bind is collected to obtain the ssDNA library after removing the non-specific binding sequence. This step is required in each round of screening.

[0042] (2) Protein immobilization: FGF10 protein was immobilized on the surface of heparin magnetic beads through the specific binding between FGF10 protein and heparin, forming an MHBs-FGF10 complex. Subsequently, the mixture was thoroughly washed with PBS buffer (pH=7.4, containing 2.5mM NaH2PO4, 17.5mM Na2HPO4 and 36mM NaCl) to remove unbound free FGF10 protein.

[0043] (3) Incubation: The ssDNA in the supernatant obtained in step (1) is incubated with the MHBs-FGF10 complex prepared in step (2) at room temperature for 30 minutes. Then, the magnetic beads are washed repeatedly with PBS buffer to remove unbound ssDNA and obtain the MHBs-FGF10-ssDNA complex bound to FGF10.

[0044] (4) ssDNA elution: The complex obtained in step (3) is resuspended in buffer and heated at 95°C to dissociate the ssDNA from the magnetic beads. The supernatant is collected, which is the ssDNA library after this round of screening.

[0045] (5) PCR amplification and purification: Using the ssDNA obtained from dissociation in step (4) as a template, qPCR amplification was performed. The amplification product was confirmed by 3% agarose gel electrophoresis. The PCR product was added to 1 / 10 volume of sodium acetate (NaAc) solution, an appropriate amount of Dr. Gen TLE Precipitation Carrier, and 2.5 volumes of anhydrous ethanol. After mixing, the mixture was placed in a -20℃ refrigerator and allowed to stand for 1 hour. The supernatant was removed by centrifugation. The precipitate was dried at 50℃ to obtain the purified double-stranded DNA product.

[0046] (6) Preparation and purification of ssDNA single strands: The purified PCR product was dissolved in 50 μL of enzyme-free sterile water and mixed well. 16 μL of the product solution was taken, and 5 μL of Lambda Exonuclease buffer and 2 μL of Lambda Exonuclease were added. Water was added to a final volume of 50 μL, and the mixture was incubated at 37 °C for 30 minutes for single-stranding. Subsequently, 1 / 10 volume of NaAc, 4 μL of Dr. Gen TLE Precipitation Carrier, and 2.5 volumes of anhydrous ethanol were added. The mixture was frozen at -20 °C for 30 minutes and then centrifuged. The precipitate was heated at 50 °C for 15 minutes and resuspended in 100 μL of buffer to obtain the ssDNA library for the next round of screening.

[0047] (7) Screening condition regulation: In order to enhance the affinity of screening, as the number of screening rounds increases, the concentration of FGF10 protein is gradually reduced, the incubation time between protein and ssDNA is shortened, and the number of washing cycles is increased, thereby increasing the screening pressure.

[0048] (8) Specificity enhancement strategy: To improve the specificity of aptamers, multiple interfering proteins are introduced for reverse screening. For proteins that can bind to heparin magnetic beads (such as FGF1 and FGF2), they are incubated with magnetic beads to remove the sequences that bind to the magnetic beads; while for proteins that do not bind to magnetic beads (such as bovine serum albumin BSA, thrombin, etc.), they are added to the magnetic bead system together with FGF10, and after incubation, the ssDNA that does not bind to the magnetic beads is removed, thereby excluding sequences that cross-bind with these proteins.

[0049] (9) Sequence screening and verification: A total of 15 rounds of SELEX screening were conducted. PCR products from rounds 7, 9, 11, 13 and 15 were selected for high-throughput sequencing. Sequences that appeared repeatedly in multiple rounds and whose abundance increased with each round were selected as potential high-affinity aptamer candidate sequences.

[0050] Example 2: High-throughput sequencing analysis

[0051] The high-throughput sequencing results from rounds 7, 9, 11, 13, and 15 were analyzed, resulting in 15 candidate aptamer sequences. Subsequently, the secondary structures of these sequences were predicted using NUPACK software, and the corresponding Gibbs free energies were calculated. The binding affinity of each sequence to the target was evaluated using surface plasmon resonance (SPR) technology, and five representative aptamers were selected and named FAS-1, FAS-4, FAS-9, FAS-10, and FAS-12. Their detailed sequence information is shown in Table 1.

[0052] Table 1. Summary of information on five candidate aptamers.

[0053]

[0054]

[0055] Example 3: Performance Analysis of Candidate Aptamers

[0056] This embodiment systematically evaluates the performance of five candidate aptamers, focusing on their binding affinity and specific recognition ability with the FGF10 protein. Affinity was determined using surface plasmon resonance (SPR) and biolayer interference (BLI) techniques, while specificity was verified using enzyme-linked oligonucleotide assay (ELONA).

[0057] 1. SPR Analysis: FGF10 protein was immobilized in a flow cell of a CM5 sensor chip using an EDC / NHS coupling method. The electrophoresis buffer was sodium acetate solution at pH 5.5. The immobilization process was carried out at a flow rate of 30 μL / min for 100 seconds, followed by blocking with ethanolamine buffer at pH 8.5. In the binding assay, aptamer solutions dissolved in PBS buffer (pH 7.4) were injected into the FGF10 immobilization cell and the reference (blank) cell, respectively. The binding phase lasted for 120 seconds, and the dissociation phase lasted for 180 seconds, with a flow rate of 20 μL / min. The experiment was conducted in high-performance cycling mode. Six concentration gradients (0, 31.25, 62.5, 125, 250, and 500 nM) were set for each aptamer, and each concentration was tested three times. The equilibrium dissociation constant (Kd) between the aptamer and FGF10 was calculated by recording the response units (RU). The results showed that the Kd values ​​of the five candidate aptamers were all between 5 nM and 20 nM, indicating that they had high affinity (see...). Figure 2 ).

[0058] 2. BLI Analysis: Biotin-labeled aptamers (concentrations of 0, 9.375, 18.75, 37.5, 75, and 150 nM) were immobilized on streptavidin-modified biosensors. FGF10 protein was dissolved in optimized PBS buffer containing 0.02% Tween-20. After baseline stabilization for 120 seconds, the sensor was immersed in the FGF10 protein solution for 180 seconds, followed by 300 seconds of dissociation monitoring in the detection buffer. Signal changes (in RU) at each stage were recorded, and affinity parameters were calculated. The results showed that the Kd values ​​of the five aptamers were also in the range of 5–15 nM, further confirming their strong binding ability to FGF10 (see [link to study]. Figure 3 ).

[0059] 3. ELONA Analysis: 96-well plates were coated with FGF10 protein or other non-target proteins (100 μL per well, 1 μg concentration) and incubated overnight at 4°C. Control proteins used included: acidic fibroblast growth factor (aFGF), fibroblast growth factor 21 (FGF21), immunoglobulin G, thrombin, human serum albumin, goat antibody, and bovine serum albumin (BSA). After coating, the plates were washed three times with PBS (PBST) buffer containing 0.5% Tween-20, blocked with 1% BSA at 37°C for 1 hour, and then washed three more times.

[0060] Subsequently, 100 μL of 100 nM biotin-labeled aptamers (dissolved in PBST) was added to each well, and the mixture was incubated at 37°C with shaking for 1 hour. After three washes, 100 μL of HRP-labeled streptavidin (1:1000 dilution, 1:1000 per well) was added, and the mixture was incubated at 37°C for 10 minutes. This was followed by seven washes, and then 100 μL of TMB substrate solution (3,3′,5,5′-tetramethylbenzidine) was added, and the mixture was incubated at 37°C for 2.5 minutes. Finally, the absorbance was measured at 650 nm using a microplate reader. All experiments were repeated three times. The results showed that all five candidate aptamers produced significant absorbance signals when interacting with FGF10 protein, while the absorbance values ​​in all non-target protein control groups were extremely low, indicating that these aptamers have good binding specificity for FGF10 (see...). Figure 4 ).

Claims

1. A nucleic acid aptamer that specifically binds to a FGF10 protein, characterized in that: The nucleic acid aptamer comprises at least one of FAS-1, FAS-4, FAS-9, FAS-10, and FAS-12, and the nucleotide sequences thereof are as follows: FAS-1: CAGCACCGTCAACTGAATGGTGCGGAACAGTACGAGGGGTGGA TTCAAGATTTGTTAGGTGATGCGATGGAGATGT FAS-4: CAGCACCGTCAACTGAATAGGTGCGGGCAGTTGTTGAGGGATG ATGGTTCGGTGGACTGTGATGCGATGGAGATGT FAS-9: CAGCACCGTCAACTGAATGGTGCATTGAGGTCGTGTGGGGAGT CTGTAGTGTTGGTGGGTGATGCGATGGAGATGT FAS-10: CAGCACCGTCAACTGAATGTGGTGCGTCGGAATTAGGGGTGGA GGGTGTATGGTGAAGGTGATGCGATGGAGATGT FAS-12: CAGCACCGTCAACTGAATAGGTGCGAAGACAGGCGTGATGGAG GGATTTGGTTGTTTGGTGATGCGATGGAGATGT.

2. The nucleic acid aptamer of claim 1, wherein, The dissociation constant (Kd) of FAS-1, FAS-4, FAS-9, FAS-10, and FAS-12 to FGF10 protein is between 5 nM and 20 nM.

3. The nucleic acid aptamer of claim 1, wherein FAS-1, FAS-4, FAS-9, FAS-10, and FAS-12 have high specific affinity binding ability to FGF10 protein.

4. A method for screening nucleic acid aptamers as described in any one of claims 1 to 3, characterized in that, The method comprises the following steps: (1) Incubate the aptamer random library with magnetic beads and perform counter screening to remove sequences that are non-specifically bound to the magnetic beads; (2) Coupling FGF10 protein with magnetic beads to construct a magnetic bead-FGF10 complex, and incubate the library after magnetic bead counter screening; (3) Wash away the unbound free nucleic acids using a screening buffer, and retain the nucleic acid sequences bound to the magnetic bead-FGF10 complex; (4) Heat denature the above complex in a buffer to release the bound sequences, and collect the supernatant; (5) Use the collected nucleic acid sequences for PCR amplification to obtain an enrichment product; (6) Treat the amplification product with exonuclease to generate a single-stranded nucleic acid library required for the next round of screening; (7) Introduce counter screening strategy in the subsequent SELEX cycle, i.e., add other proteins for negative screening, to further improve the specificity of the obtained aptamer to FGF10.

5. Use of an aptamer according to any one of claims 1 to 3 for the preparation of a detection reagent, characterized in that, The detection reagent is used for detecting FGF10 protein in blood, serum, plasma, tear fluid, tissue homogenate, and urine.

6. Use of the nucleic acid aptamer according to any one of claims 1-3 in the preparation of a detection probe for FGF10 protein.

7. Use according to claim 6, characterized in that, The nucleic acid aptamer is used for preparing a recognition element for FGF10 protein, and the recognition element is used for constructing related detection methods and sensing systems.

8. Use of the aptamer according to any one of claims 1 to 3 for the preparation of a medicament. The aptamer as an antagonist of FGF10.

9. Use of the nucleic acid aptamer according to claim 8 for the manufacture of a medicament, characterized in that, The medicament is used for the treatment of recurrent rheumatoid arthritis.

Images