AvHel31B target gene for preventing and treating tetranychus crataegus and application thereof
By screening the AvHel31B target gene of the hawthorn spider mite and synthesizing dsRNA, and then using RNAi technology to interfere with this gene, the environmental pollution and pesticide resistance problems of chemical pesticide control of hawthorn spider mites were solved, achieving a highly efficient and environmentally friendly pest control effect.
Patent Information
- Application Number
- CN202411747319.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-02
- Publication Date
- 2026-02-06
AI Technical Summary
In existing technologies, chemical pesticides pose problems such as environmental pollution and increased pesticide resistance in the control of hawthorn spider mites, and there is a lack of effective target genes for RNAi technology to control hawthorn spider mites.
The AvHel31B target gene of the hawthorn spider mite was screened out, and the corresponding dsRNA was synthesized. The gene was interfered with by soaking the eggs, which led to abnormal growth and development of the hawthorn spider mite and reduced the number of eggs laid by adult mites. The AvHel31B gene was silenced by targeting with dsRNA to achieve efficient control.
It achieves highly efficient and specific control of hawthorn spider mites, reduces the reproductive capacity and mortality of pests, and is easy to operate and environmentally friendly.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of agricultural biotechnology, and relates to prevention and treatment of agricultural mite based on RNAi technology, in particular, a target gene for preventing and treating hawthorn spider mite AvHel31B and application thereof. BACKGROUND
[0002] Hawthorn spider mite, belonging to the family of Tetranychidae and the genus of Tetranychus, is widely distributed in China and other countries in Asia and Europe, and is a worldwide mite that mainly harms crops such as fruit trees and protected vegetables. It has small body size, strong reproductive capacity and fast spreading speed. Long-term use of chemical pesticides for prevention and control leads to strong resistance.
[0003] RNA interference (RNAi) is also known as RNA silencing, which is a biological phenomenon in eukaryotes that induces homologous mRNA to be efficiently and specifically degraded or inhibited in expression, so as to prevent the translation of target gene protein, by double-stranded RNA (dsRNA) or siRNA (small interfering RNA) or miRNA (microRNA). By using RNAi, the normal growth of target pests can be interfered, the damage to host plants is reduced, and the purpose of controlling harmful organisms and protecting plants is ultimately achieved.
[0004] RNAi technology has great potential in the management of agricultural pests. Currently, Bayer, Syngenta and other companies have developed multiple products for preventing and controlling pests based on RNAi, and MON87411 also obtained the safety certificate of genetically modified organisms (for import and food / feed use) issued by the Ministry of Agriculture and Rural Affairs of China in 2021. In particular, in October 2022, the first RNA insecticide in the world obtained the provisional approval of the English generic name Ledprona by the Technical Committee on Pesticide Generic Names of the International Organization for Standardization, which is a milestone for the production and application of sprayable RNAi biological insecticides. RNAi technology has great potential for preventing and controlling spider mites, but there are few reports on the research of hawthorn spider mite gene function and insecticidal activity target genes.
[0005] The pre-experiment shows that the toxicity of hawthorn spider mite can be achieved by using a suitable exogenous dsRNA solution to soak the eggs, so that an exogenous dsRNA product suitable for preventing and treating hawthorn spider mite is developed from the gene level, which is convenient to use, low in cost, and can achieve precise and excellent prevention and treatment effect due to the specificity of the gene, and is environmentally friendly, and has great application prospect in the prevention and treatment of hawthorn spider mite. However, the screening of related target genes and the design of dsRNA with good, specific and stable prevention and treatment effect are the biggest difficulties and key problems. SUMMARY
[0006] The present application overcomes the defects and deficiencies of the prior art hawthorn leaf mite control technology, and provides a hawthorn leaf mite control method AvHel31B Target gene and application thereof, dsRNA synthesized therefrom and application of the dsRNA.
[0007] In order to achieve the above-mentioned purpose, the present application is realized by the following technical scheme.
[0008] A hawthorn leaf mite control method AvHel31B Target gene, after interfering with the target gene, leading to abnormal growth and development and death, and leading to a significant reduction in the number of adult mites laying eggs, the nucleotide sequence of the target gene is shown in SEQ ID NO. 1. AvHel31B Target gene, after interfering with the target gene, leading to abnormal growth and development and death, and leading to a significant reduction in the number of adult mites laying eggs, the nucleotide sequence of the target gene is shown in SEQ ID NO. 1.
[0009] A hawthorn leaf mite control method AvHel31B Target gene, after interfering with the target gene, leading to abnormal growth and development and death, and leading to a significant reduction in the number of adult mites laying eggs, the nucleotide sequence of the target gene is shown in SEQ ID NO. 1. AvHel31B Target gene is used as a template to synthesize dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO: 2.
[0010] The preparation of the dsRNA includes the following steps: S1, using the cDNA sequence of the hawthorn leaf mite as a template, synthesizing AvHel31B Gene fragment; S2, using AvHel31B Gene fragment as a template, designing a primer sequence pair containing a T7 promoter sequence; S3, obtaining a dsRNA synthesis template by PCR amplification; S4, synthesizing dsRNA in vitro.
[0011] The S1 is specifically: according to the DNA sequence of the AvHel31B Gene, designing a primer pair, using the cDNA sequence of the hawthorn leaf mite as a template, and performing PCR amplification to obtain AvHel31B Gene fragment.
[0012] The present application also discloses AvHel31B Application of the target gene or the dsRNA, the application includes any of the following: 1) the AvHel31B Application of the target gene or the dsRNA in the prevention and control of hawthorn leaf mites; 2) the AvHel31B Application of the target gene or the dsRNA in preventing hawthorn leaf mite pests and / or preparing products for controlling hawthorn leaf mites; 3) the AvHel31BThe application of the target gene or the dsRNA in promoting the death of *Tetranychus syringae* and / or in the preparation of products that promote the death of *Tetranychus syringae*. The application refers to a significant reduction in the expression level of the AvHel31B gene, leading to the death of *Tetranychus syringae* or inhibition of reproduction.
[0013] Experimental results showed that immersion in dsAvHel31B solution induced a strong RNAi effect in the hawthorn spider mite, leading to... AvHel31B The gene expression level is significantly reduced, which leads to the death of hawthorn spider mites and inhibits their reproductive capacity, thereby achieving the purpose of preventing and controlling hawthorn spider mites.
[0014] This invention primarily addresses the problems of environmental pollution, increased pesticide resistance in pests, and the impact on non-target organisms encountered when using traditional chemical pesticides to control hawthorn spider mites. It achieves this by utilizing gene silencing technology, specifically targeting genes within the pest's body. AvHel31B The design and synthesis of dsRNA in this study provides a more environmentally friendly, efficient, and specific method for pest control. The efficacy of dsRNA (double-stranded RNA) in controlling the hawthorn spider mite was investigated. Changes in the pest's phenotypic response and survival / reproductive capacity after targeted silencing of the gene with dsRNA were observed. The main challenge lies in the effect of the dsRNA fragment on the hawthorn spider mite's internal structure. AvHel31B High efficiency and specificity of targeted gene silencing.
[0015] The present invention discloses a method for controlling hawthorn spider mites. AvHel31B The beneficial effects of target genes and their applications compared to existing technologies are as follows: This invention utilizes AvHel31B Gene-based control of hawthorn spider mite, through AvHel31B Genetic synthesis of dsRNA for the control of hawthorn spider mite, which can target and silence the above-mentioned... AvHel31B Gene. Eggs were soaked in a dsRNA solution, allowing dsAvHel31B to enter the body of the hawthorn spider mite. This dsRNA can silence / inhibit the hawthorn spider mite's genes. AvHel31B Gene expression promotes the death of hawthorn spider mites, thereby achieving the goal of controlling hawthorn spider mites.
[0016] This invention screened and obtained a lethal gene of hawthorn spider mite ( Figure 1 They developed a highly efficient silencing dsRNA that can effectively control hawthorn spider mites, utilizing the lethal effect of dsRNA on the mites to achieve control. This method is convenient to operate, effective and sensitive, highly efficient in killing insects, and environmentally friendly, showing great promise for application. Attached Figure Description
[0017] Figure 2The effect of soaking eggs in dsAvHel31B solution on the phenotype of hawthorn spider mite in Example 2 is shown. H2O is the blank control, dsGUS is the negative control, and dsAvHel31B is the hawthorn spider mite treatment group. Figure 3 The effect of soaking eggs in dsAvHel31B solution on the mortality rate of hawthorn spider mites in Example 2; lowercase letters indicate significant differences. AvHel31B In Example 2, after soaking eggs in dsAvHel31B and dsGUS solutions, the hawthorn spider mite... AvHel31B Changes in gene expression levels, with lowercase letters indicating significant differences. Detailed Implementation
[0018] To make the technical problems to be solved, the technical solutions, and the beneficial effects of this invention clearer, the invention will be further described in detail with reference to the embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. The technical solutions of this invention are described in detail below with reference to the embodiments and accompanying drawings, but the scope of protection is not limited thereto.
[0019] Unless otherwise specified, the reagents, methods, and equipment used in the following examples are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.
[0020] The hawthorn spider mites used in the following examples were bred by the College of Plant Protection, Shanxi Agricultural University. The hawthorn spider mites were inoculated onto peach seedlings and placed in an artificial climate chamber (temperature 25±1℃, humidity 50%-60%, photoperiod L:D=16:8) for reproduction (these mites can be provided free of charge for scientific experiments).
[0021] RNA extraction was performed using the TRIzol extraction method (Invitrogen, USA). The reverse transcription reagent (PrimeScript™ RTreagent Kit with gDNA Eraser) was purchased from TAKARA Biotechnology Co., Ltd., the dsRNA synthesis kit (T7RiboMAX™ Express RNAi System) was purchased from Promega, Inc., USA, the PCR reaction system kit (GoTaq® Green Master Mix) was purchased from Promega, Inc., USA, and the DNA purification and recovery kit (Universal DNAPurification Kit) was purchased from Tiangen Biotech (Beijing) Co., Ltd.
[0022] The data processing methods in the following examples are as follows: The results of bioassays on *Tetranychus syringae* were analyzed using the egg soaking method. Starting from day 0 of the egg stage, the mortality rate of *Tetranychus syringae* was statistically analyzed on day 12 (day 2 of adulthood), and the data were analyzed using a T-test with SPSS 19.0 software. On day 8 (from prenymphal to molting), the expression levels of target genes were analyzed. The qPCR data were calculated using the 2-ΔΔCt method (Ct represents the cycle number), and the data were analyzed using a T-test with SPSS 19.0 software. Example
[0023] Hawthorn spider mite growth and development related genes AvHel31B The acquisition and utilization AvHel31B Gene-synthesized dsRNA (dsAvHel31B) Based on the transcriptome library of hawthorn spider mite, the following were screened: AvHel31B Gene fragment, as shown in SEQ ID NO.1.
[0024] SEQ ID NO.1 1. Total RNA extraction and first-strand cDNA synthesis of A. haworthiae.
[0025] 100 adult A. haworthiae were taken in a 1 mL centrifuge tube, and total RNA was extracted using the TRIzol method. The concentration and quality of the RNA were determined using a NanoDrop OneC. Reverse transcription was performed using a reverse transcription kit (PrimeScript™ RT reagent Kit with gDNA Eraser, TAKARA) according to the manufacturer's instructions to synthesize the first strand of cDNA.
[0026] 2. Primer design The sequences of the genes obtained by screening the transcriptome data of A. haworthiae obtained by the research group were used to design the dsRNA primers P1 (Table 1) for the genes, β-glucuronidase (GUS) was amplified from the plasmid containing the GUS gene preserved in the laboratory, AvHel31B GUS the dsRNA primer P2 (Table 1) for the gene, the target gene GUS , the qPCR primers P3 and P4 (Table 1) for the internal reference gene AvHel31B H. AvGAPD AvHel31B
[0027]
[0028] 3. Kit synthesis GUS The dsRNAs for the genes and Figure 1 were synthesized using the primer P1 in Table 1. The reaction system for PCR amplification was RNase Free water 9.5 μL, Go Taq® Green Master Mix 12.5 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, and cDNA / GUS plasmid 1 μL. The reaction program for PCR amplification was 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min, a total of 30 cycles; 72°C extension for 5 min. The amplification product was stored at 4°C. After the program reaction was completed, the amplification results were detected by agarose gel electrophoresis.
[0029] The two PCR products obtained above were recovered and purified with a DNA purification recovery kit (Universal DNA Purification Kit, TIANGEN) as templates for in vitro transcription of dsRNA. The in vitro transcription system of dsRNA was Template DNA 1000 ng, Enzyme Mix, T7 Express 2 μL, RiboMAX™ Express T7 2× Buffer 10 μL, supplemented with Nuclease free water to 20 μL. After flicking off, the following reactions were performed in a water bath: 37 °C incubation for 4 h, 70 °C for 10 min, 25 °C for 20 min. After the reaction was completed, 1 μL of DNAase and 1 μL of RNAase were added, and after incubation at 37 °C for 30 min, 2.2 μL of sodium acetate solution and 24.2 μL of isopropanol were added, and the dsRNA was fully precipitated at -20 °C overnight. After centrifugation at 14000 g for 10 min the next day, the supernatant was removed, the precipitate was washed twice with 75% ethanol and centrifuged to obtain dsRNA. The alcohol in the tube was removed by blowing with an ultra-clean bench, and the dsRNA was dissolved in Nuclease free water. The integrity of the dsRNA was detected by 1.5% agarose gel electrophoresis, and the concentration was quantified using NanoDrop 2000. The final concentration was diluted to 250 ng / μL, and dsAvHel31B and dsGUS were obtained, respectively. The band of dsRNA was verified by 1.5% agarose gel electrophoresis, and stored at -80 °C.
[0030] SEQ ID NO. 2 GTTGGACGAGGCTGACAAGCTACTCTCTCAAGACTTTAACGCCATGTTAGACTCTCTTATATCCTACCTTCCCAAAGACAGGCAAATTTTGATGTTTTCCGCCACATTTCCTCTTACAGTTGAAAATTTCATGAAAAAACATCTTCACGATCCTTATGAGCTAAATCTGATGGAAGAGTTAACTCTTAAAGGAGTTACTCAATACTACGCATTTGTCCAGGAACGTCAAAAAGTGCATTGTCTAAACACTTTATTTTCAAAGTTGCAGATCAACCAATCCATCATTTTCTGTAATTCAACTCAAAGAGTTGAACTTTTGGCAAAAAAGATTGCTGAACTTGGGTATTCTTGTTACTACATTCACGCTAAAATGTCTCAACCTCATCGTAATAGAGTATTTCATGACTTTAGAAGTGGTCTTTGCCGTAATCTTGTCTGC Examples
[0031] Lethal effect of dsRNA (dsAvHel31B) on Comybia globosa 1. Test method The peach leaves were cut into 17 mm diameter leaf discs with a puncher and washed with nuclease-free water for 5 times. 30-50 female adult mites were moved to the leaf discs, and the female adult mites laid eggs for 30-50 eggs. Then the female adult mites were removed, and 20 μL of dsRNA (250 ng / μL) Tween solution (the dsRNA was uniformly mixed in the Tween solution to make the final concentration of the Tween solution 0.005%) was uniformly sprayed on all the eggs of the spider mites to make the eggs of the spider mites completely soaked in the dsRNA Tween solution. After the eggs of the spider mites hatched, the spider mites were continuously bred on the peach leaf discs, and dsGUS was used as a negative control. The leaf discs were placed on 0.25% agar gel to keep them moist and prevent the escape of the spider mites. The spider mites on the 4th day after hatching (at this time, they were in the pre-nymphal to post-nymphal molting stage) were collected for detecting the expression amount of the target gene. The spider mites on the 8th day after hatching (at this time, they were in the 2nd day of adult stage) were used for counting the biological changes of the spider mites. Each group had 3 repeats, and after the dsRNA treatment, the groups were placed in an artificial climate chamber (temperature 25±1℃, humidity 50%-60%, light cycle L:D=16:8). The number of dead spider mites in each repeat of each group was counted, and the mortality of the spider mites treated with the dsRNA and the control was calculated. On the 2nd day of the female adult stage, 10 female adult mites were randomly selected from each repeat of each treatment group and bred on a 17 mm leaf disc to lay eggs, and the final number of eggs was recorded to count the average number of eggs laid by each female adult mite.
[0032] 2. Test results According to the statistical results, after the treatment of the dsAvHel31B, the spider mites showed a blackening phenotype compared with the control group Figure 2 , the mortality of the spider mites was significantly increased to 89.88% AvHel31B , and the reproductive capacity was significantly reduced. The average number of eggs laid by each female adult mite in the dsAvHel31B treatment group was 0, and that in the dsGUS control group was 39.30, indicating that the dsAvHel31B could induce a strong RNAi effect in the spider mites, leading to the death and the decrease of the reproductive capacity of the spider mites. Example
[0033] Inhibition of the expression of the gene in the spider mites by dsRNA (dsAvHel31B) AvHel31B 1. Experimental method Two hundred spider mites were collected on day 4 after hatching (at this stage, they are in the molting phase from pronymph to demymph) to detect the expression level of the target gene. Three biological replicates were collected for each treatment. RNA was extracted from the collected hawthorn spider mites, and 1 μg of total RNA was reverse transcribed into cDNA, which was then diluted 10-fold as a template for qPCR. Relative quantitative qPCR analysis was performed using P3 and P4 primers. The qPCR system contained 7.76 μL of RNase-free water, 10 μL of 2×SYBR Green (SYBR® Green RealtimePCR Master Mix), 0.32 μL of 10 μM forward primer, 0.32 μL of 10 μM reverse primer, and 1.6 μL of cDNA template. The qPCR reaction was performed using a Bio-Rad C1000 Real-Time PCR system (BIO-RAD, USA). The reaction conditions were 95℃ for 30 s; 40 cycles: 95℃ for 5 s, 60℃ for 30 s, with 3 technical replicates for each biological replicate analysis.
[0034] 2. Experimental Results After egg treatment with dsAvHel31B solution, hawthorn spider mite was found to be infected. Figure 3 The relative expression level of the gene decreased by 55.58%. AvHel31B This indicates that soaking in dsAvHel31B solution can induce a strong RNAi effect in the hawthorn spider mite, leading to a significant decrease in the expression level of the AvHel31B gene, which in turn leads to the death of the hawthorn spider mite or inhibits its reproduction.
[0035] The above embodiments, based on the transcriptome library of the hawthorn spider mite, screened and obtained a gene that is highly lethal and affects reproduction— AvHel31B Genes, and developed the use of AvHel31B This study describes a technique for controlling hawthorn spider mite by immersing eggs containing the gene's dsRNA (dsAvHel31B). In this example, hawthorn spider mite eggs were immersed in 20 μL of a solution synthesized in a kit containing dsAvHel31B and dsGUS until the solution was absorbed and dried. The eggs were left on peach tree leaves until hatching, and the mortality rate of the hawthorn spider mite was observed and recorded. Finally, quantitative real-time PCR (qPCR) was used to detect and analyze the mite's activity. Changes in gene expression levels in *Tetranychus syringae* after treatment with dsAvHel31B and dsGUS. The results showed that soaking eggs in exogenous dsAvHel31B solution had a significant lethal effect on *Tetranychus syringae*.
[0036] The above is further detailed description of the present application in combination with specific preferred embodiments, and cannot be deemed as limitation of the specific embodiments of the present application. For those skilled in the art of the present application, without departing from the present application, a number of simple deductions or substitutions can be made, which shall be deemed to belong to the present application, and the patent protection scope is determined by the submitted claims.
Claims
1. A method for controlling hawthorn spider mites AvHel31B target genes, the AvHel31B The nucleotide sequence of the target gene is shown in SEQ ID NO.
1.
2. A dsRNA for controlling hawthorn spider mites, using the aforementioned... AvHel31B The target gene is used to synthesize dsRNA, the nucleotide sequence of which is shown in SEQ ID NO.2; the preparation of the dsRNA includes the following steps: S1. Using the cDNA sequence of *Tetranychus scabra* as a template, primer pairs were designed, and PCR amplification was performed to synthesize... AvHel31B Gene fragments; S2, with AvHel31B Using gene fragments as templates, primer sequence pairs containing T7 promoter sequences were designed; S3. Obtain the dsRNA synthesis template by PCR amplification; S4. In vitro synthesis of dsRNA.
3. One of the aforementioned AvHel31B The application of dsRNA of a target gene, wherein the application includes any of the following: 1) The above AvHel31B Application of the target gene or the dsRNA in the control of hawthorn spider mite; 2) The above AvHel31B The application of the target gene or the dsRNA in the prevention of hawthorn spider mite infestation and / or the preparation of products for the control of hawthorn spider mites; 3) The above AvHel31B The application of the target gene or the dsRNA in promoting the death of hawthorn spider mites and / or in the preparation of products that promote the death of hawthorn spider mites; the application refers to a significant reduction in the expression level of the AvHel31B gene, which leads to the death of hawthorn spider mites or inhibits reproduction.