Receptor-like kinase MaHPCA1 and application thereof in relieving banana chilling injury

By overexpressing MaHPCA1-1 or MaHPCA1-3 receptor kinase genes in banana peel, the problem of chilling injury in bananas was solved, and the active cold resistance of the fruit was improved and the storage period was extended.

CN121472267BActive Publication Date: 2026-04-21HAINAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610018343.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-08
Publication Date
2026-04-21
Estimated Expiration
2046-01-08

AI Technical Summary

Technical Problem

Existing technologies for alleviating banana chilling injury suffer from problems such as treating the symptoms but not the root cause, time-sensitive and unstable effects, high costs, and potential side effects. Moreover, most methods involve passive intervention rather than actively enhancing the fruit's cold resistance.

Method used

Overexpression of MaHPCA1-1 or MaHPCA1-3 receptor kinase genes in banana peels can improve the cold resistance of banana fruits, inhibit the production of hydrogen peroxide, superoxide anion and malondialdehyde, and alleviate chilling injury symptoms.

Benefits of technology

It significantly improved the cold resistance of banana fruits under low-temperature storage conditions, extended the storage period, and reduced the occurrence of chilling injury symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472267B_ABST
    Figure CN121472267B_ABST
Patent Text Reader

Abstract

The application discloses a receptor-like kinase MaHPCA1 and application thereof in relieving banana chilling injury, and relates to the field of plant genetic engineering. Two homologous genes MaHPCA1-1 and MaHPCA1-3 in a leucine-rich repeat receptor-like kinase gene family are found from banana, and overexpression of MaHPCA1-1 and MaHPCA1-3 in banana peel can inhibit the generation of hydrogen peroxide, superoxide anion and malondialdehyde, and further relieve banana fruit chilling injury symptoms, improve the cold resistance of banana fruit under postharvest low-temperature storage conditions, and prolong the storage period of banana fruit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, and in particular to a receptor-like kinase MaHPCA1 and its application in alleviating chilling injury in bananas. Background Technology

[0002] Bananas are climacteric fruits, and to achieve a longer shelf life, they are typically harvested before ripening. However, immature bananas are highly sensitive to low temperatures, and exposure to unsuitable low temperatures (<13℃) during storage and transportation can easily cause chilling injury, manifesting as spots and browning on the peel, lignification of the flesh and loss of some aroma, and even failure to ripen, resulting in significant economic losses. Currently, technologies to improve the postharvest chilling tolerance of bananas are mainly divided into three categories: physical methods, chemical methods, and genetic improvement. Firstly, physical methods primarily achieve preservation by controlling the physical parameters of the storage environment or applying external physical fields. Examples include temperature control, intermittent heating treatment, and controlled atmosphere storage. Secondly, chemical methods involve the exogenous application of chemical substances to induce or directly enhance the fruit's chilling resistance. Examples include calcium treatment, plant growth regulator treatment, and coating treatment. Finally, genetic improvement uses transgenic or gene-editing technologies to directly alter the genetic background of bananas, enabling them to express chilling-resistant genes.

[0003] The shortcomings of existing technologies are summarized as follows: (1) Treating the symptoms but not the root cause: Most physical and chemical methods work from the external environment or through external stimuli, failing to fundamentally change the inherent low-temperature sensitivity of banana fruits. (2) Temporary and unstable: The effects of chemical induction and physical regulation are usually temporary and reversible, and are easily affected by the environment and management level, resulting in unstable effects. (3) High cost and complexity: Precise temperature control, controlled atmosphere, intermittent heating and other methods require high equipment investment and meticulous management, making operation complex and promotion difficult. (4) Potential side effects: Problems such as chemical residues, flavor changes, and pesticide damage risks always exist. (5) Passive response: Most existing technologies are passive interventions rather than actively endowing fruits with strong cold resistance. Therefore, it is essential to discover a new receptor kinase-like gene, MaHPCA1, and apply it to alleviate the symptoms of banana chilling injury. Summary of the Invention

[0004] To address the aforementioned deficiencies in the prior art, this invention proposes a receptor-like kinase MaHPCA1 and its application in alleviating banana chilling injury, thereby resolving the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] The application of a receptor kinase MaHPCA1 in alleviating chilling injury in bananas, wherein the receptor kinase MaHPCA1 is either MaHPCA1-1 or MaHPCA1-3, the nucleotide sequence of MaHPCA1-1 is shown in SEQ ID NO.1, and the nucleotide sequence of MaHPCA1-3 is shown in SEQ ID NO.2.

[0007] Preferably, overexpressing MaHPCA1-1 or MaHPCA1-3 in banana peel can alleviate chilling injury symptoms in bananas and improve the cold resistance of banana fruits.

[0008] Preferably, a primer pair for cloning MaHPCA1-1 has the forward primer sequence shown in SEQ ID NO.3 and the reverse primer sequence shown in SEQ ID NO.4.

[0009] Preferably, a primer pair for cloning MaHPCA1-3 has the forward primer sequence shown in SEQ ID NO.5 and the reverse primer sequence shown in SEQ ID NO.6.

[0010] Preferably, a method for cultivating chilling-resistant bananas includes the following steps:

[0011] (1) The MaHPCA1-1 or MaHPCA1-3 is ligated into a vector to obtain an overexpression vector;

[0012] (2) The overexpression vector was transformed into Agrobacterium, cultured by shaking and centrifugation, and resuspended in the infection solution to obtain an infection solution containing recombinant bacteria;

[0013] (3) The banana peel was infected with the recombinant bacteria infection solution obtained in step (2) to obtain cold-resistant bananas.

[0014] Preferably, the carrier in step (1) is pGreenII 62-SK carrier, and the pH of the infection solution in step (2) is 5.2~5.8.

[0015] Preferably, the pH of the infiltration solution is 5.6.

[0016] Preferably, the inoculation solution in step (2) is prepared by mixing the following components: 98 mL of water, 1 mL of 1.0 M morpholine ethanesulfonic acid aqueous solution, 1 mL of 1.0 M magnesium chloride hexahydrate aqueous solution and 200 μL of 100 mM acetylsuccine aqueous solution.

[0017] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention discloses a receptor-like kinase MaHPCA1 and applies it to alleviate chilling injury symptoms in bananas, solving the problem of chilling injury easily occurring in postharvest bananas during low-temperature storage. This invention discovered two homologous genes, MaHPCA1-1 and MaHPCA1-3, from a family of leucine-rich repeat receptor-like kinase genes in bananas. Silencing MaHPCA1-1 and MaHPCA1-3 leads to the production of hydrogen peroxide, superoxide anions, and malondialdehyde, significantly exacerbating chilling injury symptoms in bananas. Overexpression of MaHPCA1-1 and MaHPCA1-3 inhibits the production of hydrogen peroxide, superoxide anions, and malondialdehyde, alleviating chilling injury symptoms in bananas, improving the cold resistance of bananas under postharvest low-temperature storage conditions, and extending the storage period of bananas. Attached Figure Description

[0018] Figure 1 This is a bioinformatics analysis diagram of the target receptor kinase; where A is the phylogenetic tree, B is the motif analysis, and C is the multiple sequence alignment of characteristic cysteine ​​pairs in the hydrogen peroxide domain (HP domain) (LRR: leucine-rich repeat receptor domain; HP: hydrogen peroxide domain; TM: transmembrane domain; Kinase: kinase domain).

[0019] Figure 2 Sequence alignment of the complete LRR domain and protein kinase domain of the AtHPCA1 and MaHPCA1-1~9 genes;

[0020] Figure 3 The relative gene expression levels of MaHPCA1-1 and MaHPCA1-3 at different storage times at low temperature;

[0021] Figure 4 Electrophoretic band diagrams of MaHPCA1-1 and MaHPCA1-3;

[0022] Figure 5 To transiently overexpress the MaHPCA1-1 and MaHPCA1-3 genes on the banana fruit peel, the fruit was stored at 6±1℃ for 5 days. A shows the appearance of the banana fruit peel (left side) as a blank control and the banana fruit peel overexpressing MaHPCA1-1 or MaHPCA1-3 (right side); B shows the relative gene expression levels of MaHPCA1-1 and MaHPCA1-3 after transient overexpression in the fruit peel; C shows the H2O2 content in the MaHPCA1-1 and MaHPCA1-3 transient overexpression vectors; D shows the O2 content in the MaHPCA1-1 and MaHPCA1-3 transient overexpression vectors. -The production rate; E is the MDA content in the transient overexpression vectors of MaHPCA1-1 and MaHPCA1-3; each data represents the mean ± standard error of three replicates, and an asterisk (**) indicates a significant difference (P<0.01).

[0023] Figure 6 To silence the MaHPCA1-1 and MaHPCA1-3 genes on the banana fruit peel, the fruits were stored at 6±1℃ for 5 days. A shows the appearance of the banana fruit peel (left side) as a blank control and the banana fruit peel (right side) after silencing MaHPCA1-1 or MaHPCA1-3; B shows the relative expression levels of the genes after silencing MaHPCA1-1 and MaHPCA1-3 in the fruit; C shows the H2O2 content in the transient silencing vectors for MaHPCA1-1 and MaHPCA1-3; D shows the O2 content in the transient silencing vectors for MaHPCA1-1 and MaHPCA1-3. - The production rate; E is the MDA content in the transient silencing vectors of MaHPCA1-1 and MaHPCA1-3; each data point represents the mean ± standard error of three replicates, and an asterisk (**) indicates a significant difference (P<0.01). Detailed Implementation

[0024] To enable those skilled in the art to better understand the technical content of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0025] The names, catalog numbers, and purchase channels of the commercial reagents, vectors, and strains involved in this application are as follows: (1) Hydrogen peroxide content (H2O2) reagent kit (purchased from Suzhou Greens Biotechnology Co., Ltd., catalog number G0112W); (2) FastKing RT reagent kit (purchased from Tiangen Biotech Co., Ltd., catalog number: KR118); (3) SuperReal Premix Plus kit (purchased from Tiangen Biotech Co., Ltd., catalog number: FP205); (4) CTAB (purchased from Shanghai Maclean Biotechnology Co., Ltd., catalog number: H811117); (5) β-mercaptoethanol (purchased from Shanghai Maclean Biotechnology Co., Ltd., catalog number: M6230); (6) chloroform (trichloromethane) (purchased from Guangdong Guangshi Technology Co., Ltd., catalog number: GD10); (7) isoamyl alcohol (purchased from Shanghai Maclean Biotechnology Co., Ltd., catalog number: M813908); (8) LiCl (purchased from Shanghai Maclean Biotechnology Co., Ltd., catalog number: 767397); (9) SSTE buffer (purchased from Shanghai Zeye Biotechnology Co., Ltd., catalog number: ZY6ZT1008); (10) anhydrous ethanol (purchased from Xilong Scientific Co., Ltd., catalog number: 1280340101602); (11) reverse transcription kit Takara PrimeScript™ II 1st Strand cDNASynthesis Kit (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 6210A); (12) DNA polymerase Takara PrimeSTAR Max DNA Polymerase Ver.2 (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: R047S); (13) Agarose (catalog number: 1110GR100, BioFROXX); (14) 50×TAE buffer (purchased from Beijing Solarbio Technology Co., Ltd., catalog number: T1060); (15) Green fluorescent nucleic acid dye (purchased from Beijing Solarbio Technology Co., Ltd., catalog number: G8140); (16) 5000 DNA marker (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 3428Q); (17) 6×DNA loading buffer (purchased from Biosharp, catalog number: BL532A); (18) pGreenII 62-SK vector (purchased from Shanghai Kelei Biotechnology Co., Ltd., catalog number: KL-ZL-0668); (19) Agrobacterium GV3101 (pSoup-p19) competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd., catalog number: AC1003); (20) Morpholine ethanesulfonic acid (purchased from Shanghai Maclean Biotechnology, catalog number: M813436); (21) Magnesium chloride hexahydrate (purchased from Shanghai Maclean Biotechnology, catalog number: M766361);(22) Acetyleugenone (purchased from Shanghai Maclean Biotechnology, item number: A800901) (23) Acetone (purchased from Guangdong Guangshi Technology Co., Ltd., item number: HB02); (24) KNO2 (purchased from Shanghai Maclean Biotechnology, item number: P815362); (25) Disodium hydrogen phosphate (purchased from Shanghai Maclean Biotechnology, item number: S818103); (26) Sodium dihydrogen phosphate (purchased from Shanghai Maclean Biotechnology, item number: S817780); (27) α-Naphthylamine (1-naphthylamine) (purchased from Shanghai Maclean Biotechnology, item number: N814568); (28) EDTA solution (purchased from Shanghai Maclean Biotechnology, item number: E762090); (29) Triton X-100 (purchased from Shanghai Maclean Biotechnology, item number: T824275); (30) PVP (purchased from Shanghai Maclean Biotechnology, item number: 767425); (31) Hydroxylamine hydrochloride (purchased from Shanghai Maclean Biotechnology, item number: H811239); (32) p-Aminobenzenesulfonic acid (purchased from Shanghai Maclean Biotechnology, item number: S817819); (33) Trichloroacetic acid (TCA) (purchased from Shanghai Maclean Biotechnology, item number: T824275); (34) Thiobarbituric acid (TBA) (purchased from Shanghai Maclean Biotechnology, catalog number: T768874); (35) pTRV1 (purchased from Youbao Biotechnology, catalog number: VT1437); (36) pTRV2 (purchased from Youbao Biotechnology, catalog number: VT1438); (37) Novizan gel recovery kit (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: DC301-01); (38) Dpn I. Reagent kit (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 1235S); (38) In-Fusion reagent kit (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 102518); (39) Kanamycin (purchased from Guangzhou Saiguosheng Co., Ltd., catalog number: 1162GR001); (40) Rifampin (purchased from Beijing Solarbio Technology Co., Ltd., catalog number: R8011).

[0026] The following embodiments in this application all use Brazilian bananas ( Musa (AAA Group) 'Brazil' was used as the experimental material, and the bananas were picked in a banana plantation in Chengmai.

[0027] Example 1: Screening for target receptor kinases

[0028] Using AtHPCA1 (AT5G49760) from Arabidopsis thaliana as a template, nine candidate genes (MaHPCA1-1~9) for banana hydrogen peroxide receptors were identified based on sequence conservation. These nine candidate genes were then used in conjunction with Arabidopsis AtHPCA1 to construct a phylogenetic tree for evolutionary relationship analysis. The specific steps were as follows: the AtHPCA1 and MaHPCA1-1~9 sequences were imported into the MEGA program; the Statistical Method was set to Neighbor-joining; the Bootstrap method was set to 1000; the generated phylogenetic tree was then simply formatted and saved. The results showed (…). Figure 1 In the A group, there are two main branches. One branch consists of AtHPCA1, MaHPCA1-4, MaHPCA1-8, and MaHPCA1-9, while other MaHPCA1 candidate genes cluster into the other branch. Motif analysis is then performed. The specific steps are as follows: using the online website MEME, first upload the sequences of MaHPCA1-1~9, set the number of motifs to 6, run the analysis, and save the results file in XML format; then open TBtools, select Graphics, upload the above results file and the corresponding gene ID names, click Start, and obtain the visualization results. The obtained visualization results are then beautified in terms of shape and color to obtain the final result. The results show (…). Figure 1 In the B group, MaHPCA1-1~9 and AtHPCA1 all contain the same conserved motif at the C-terminus. Amino acid sequence alignment analysis shows that ( Figure 1 In the C group, MaHPCA1-1~9, similar to AtHPCA1, contains two conserved cysteine ​​residue pairs in the hydrogen peroxide domain. Furthermore, conserved domain analysis ( Figure 2 The results also showed that they all contain LRR domains and protein kinase domains, thus suggesting that MaHPCA1-1~9, like AtHPCA1, are leucine-rich repeat receptor kinases belonging to the HPCA gene subfamily.

[0029] To determine whether the MaHPCA1s genes are involved in the response to low temperature, we performed transcriptome sequencing on banana samples (the middle section of the banana peel after the ends were removed) stored at 6±1℃ for days 0, 1, and 5. We analyzed the expression of candidate hydrogen peroxide receptor genes MaHPCA1-1~9 using FPKM and performed a one-way ANOVA analysis to assess the significance of relative expression levels of the sequenced genes. We found that among the MaHPCA1-1~9 genes, only MaHPCA1-1 and MaHPCA1-3 showed significantly upregulated relative expression levels on days 1 and 5 compared to day 0. Specifically, the average relative expression level of MaHPCA1-1 on days 1 and 5 was 2.83 times that on day 0, and the average relative expression level of MaHPCA1-3 on days 1 and 5 was 3.27 times that on day 0. The results of the relative expression level data for the sequenced genes are shown in Table 1.

[0030] Table 1. Relative gene expression levels from transcriptome sequencing

[0031]

[0032] To verify the authenticity of the transcriptome data, we selected the upregulated genes MaHPCA1-1 and MaHPCA1-3 for RT-qPCR validation. The specific steps for testing the relative gene expression levels included: RNA extraction, cDNA acquisition, RT-qPCR primer design, and RT-qPCR testing.

[0033] 1.1 RNA extraction: Take banana samples stored at 6±1℃ for 0, 1, 3, 5 and 7 days (the middle section of the banana peel after the ends are cut off); the specific operation is as follows: (1) Sample addition: Take 0.3-0.4g of banana sample in a 10 mL EP tube, add 4mL of CTAB preheated at 65℃ and 80μL β-Mercaptoethanol, quickly vortex to mix; (2) Cleavage: 65℃, 2min (water bath); (3) Impurity removal: add 4mL chloroform / isoamyl alcohol mixed solution (24:1, v / v), vortex for 30s, centrifuge, 15℃, 10min, 10000×g, take the supernatant (supernatant is the extract); (4) Further impurity removal: repeat step (3); (5) Adsorption: add 1mL (1 / 4 volume) LiCl and gently invert to mix, 4℃, overnight; (6) Centrifugation: first centrifuge at 4℃ and 10000×g for 30min to remove the supernatant, put SSTE in a 65℃ water bath during centrifugation, then centrifuge at 15℃ and 10000×g for 1min to remove the residual liquid, and then aspirate the supernatant to obtain a white precipitate; (7) Dissolution: add 400μL of SSTE preheated at 65℃ to the white precipitate, use a pipette to blow and aspirate to dissolve the precipitate, and then transfer it to a 1.5mL enzyme-free tube. (8) Impurity removal: Add 400 μL of chloroform / isoamyl alcohol mixed solution (24:1, v / v), vortex for 30 s, centrifuge at 15℃ for 10 min, and collect the supernatant at 10000×g; (9) Further impurity removal: Repeat step (8) and determine whether the amount of supernatant obtained by adding 2 times the amount of anhydrous ethanol is less than 1.5 mL. If not, it needs to be aliquoted; (10) Alcohol precipitation: Add 2 times the volume of anhydrous ethanol in an ice bath, place in a -80℃ freezer, and precipitate for 30 min (then operate in an ice bath); (11) Centrifugation: Centrifuge at 4℃ for 20 min and aspirate the supernatant at 10000×g; (12) Dissolution: Add 20-30 μL of N-ase-Free ddH2O. The precipitate can be dissolved by pipetting to obtain RNA. Three biological replicates were made for each group of samples.

[0034] 1.2 Acquisition of cDNA for RT-qPCR: RT-qPCR was performed using the FastKing RT kit, where the RNA obtained from each group of samples was reverse transcribed into cDNA. The reaction system was as follows: 4 μL 5×FastKing-RT SuperMix, 1 μg total RNA, and RNase-free ddH2O to a final volume of 20 μL. The reaction conditions were: 42℃ for 15 min; 95℃ for 3 min. Ultimately, three biological replicates of cDNA were obtained from each group of samples.

[0035] 1.3 RT-qPCR Primer Design: Primers were designed using Primer Premier 6.0 software. The internal reference gene was MaActin1 (Gene ID: AF246288.1). All real-time quantitative PCR primers are shown in Table 2.

[0036] Table 2 Primers for RT-qPCR

[0037]

[0038] 1.4 RT-qPCR Assay: The SuperReal Premix Plus kit was used to prepare the qPCR reaction system. The 20 μL qPCR reaction system was as follows: 10 μL 2×SuperReal PreMix Plus, 0.6 μL 10 µM forward primer, 0.6 μL 10 µM reverse primer, 1 μL cDNA, and 7.8 μL RNase-free ddH2O. qPCR was performed on a Bio-Rad CFX96 Real-Time PCR system (Hercules, CA, USA) under the following conditions: pre-denaturation: 95 °C, 15 min; PCR reaction: 95 °C, 10 s; 55 °C, 20 s; 72 °C, 30 s; 40 cycles. Three cDNA samples (biological replicates) were used for each group of samples, and three technical replicates were performed for each cDNA sample. The obtained CT value was used as 2^( The relative expression level of the corresponding gene at the corresponding site is finally obtained by calculating using the ΔΔCT method.

[0039] Figure 3 The results indicate that the trends of RT-qPCR and transcriptome data are basically consistent, suggesting that the transcriptome data are highly reliable. These data demonstrate that MaHPCA1-1 and MaHPCA1-3 respond to low temperature and are upregulated during low-temperature storage, thus playing a positive regulatory role in chilling injury to bananas.

[0040] The nucleotide sequence of MaHPCA1-1 is shown in SEQ ID NO.1, the nucleotide sequence of MaHPCA1-2 is shown in SEQ ID NO.7, the nucleotide sequence of MaHPCA1-3 is shown in SEQ ID NO.2, and the nucleotide sequences of MaHPCA1-4, MaHPCA1-5, MaHPCA1-6, MaHPCA1-7, MaHPCA1-8 and MaHPCA1-9 are shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.13, respectively.

[0041] Example 2: Obtaining MaHPCA1-1 and MaHPCA1-3

[0042] 1.1 Acquisition of cDNA

[0043] Fresh banana peels were ground into powder using liquid nitrogen, and RNA was extracted. Using the Takara PrimeScript™ II 1st Strand cDNA Synthesis Kit (6210A), 8 μL of RNA was added, along with 1 μL of Oligo dt primer and 1 μL of dNTP mixture. The reaction conditions were 65°C for 5 min. The following reagents were then added to the system: 4 μL of 5×PS II buffer, 0.5 μL of RNase inhibitor, 1 μL of PS II RTase, and RNase-Free ddH2O, bringing the total volume to 20 μL. PCR reaction conditions were 42°C for 45 min; then 95°C for 5 min. The obtained cDNA was stored at -20°C.

[0044] 1.2 Acquisition of the full-length target fragments MaHPCA1-1 and MaHPCA1-3

[0045] The DNA polymerase used was Takara PrimeSTAR Max DNA Polymerase Ver.2 (R047S). The MaHPCA1-1 forward primer sequence was: ATGATTGGAGTCTTTCTTATCTTTTATGGGGC (SEQ ID NO.3); the MaHPCA1-1 reverse primer sequence was: TCATCGGGCCGCAACAGC (SEQ ID NO.4); the MaHPCA1-3 forward primer sequence was: ATGGGAACCCTCATCTTCACCC (SEQ ID NO.5); the MaHPCA1-3 reverse primer sequence was: TTATTTGGGCTCGGGTTTTGCTG (SEQ ID NO.6); the total PCR reaction volume of 20 μL was prepared as follows: PrimeSTAR Max DNA Polymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; cDNA template: 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10s; 55℃, 5s; 68℃, 30s; for a total of 30 cycles.

[0046] Agarose gel electrophoresis was used to verify the band positions: the gel running time was 25 minutes; the results were obtained. Figure 4 The bands were excised and purified using the Novizan Gel Recovery Kit to obtain fragments of MaHPCA1-1 (2805bp) and MaHPCA1-3 (2877bp).

[0047] Example 3: Transient overexpression of MaHPCA1-1 and MaHPCA1-3 in banana peel

[0048] 1.1 Experimental Methods

[0049] First, the full-length target fragments of MaHPCA1-1 and MaHPCA1-3 obtained in Example 2 were homologously recombinated with the pGreenII 62-SK vector to construct OE-MaHPCA1-1 and OE-MaHPCA1-3 overexpression vectors. The specific steps are as follows:

[0050] (1) Linearization of pGreenII 62-SK vector: The pGreenII 62-SK empty vector plasmid was linearized using forward primer: CGGGCTGCAGGAATTCGATATCAAG (SEQ ID NO.24) and reverse primer: GGGGATCCACTAGTTCTAGAGCG (SEQ ID NO.25) according to the PCR amplification program. The total PCR reaction system of 20 μL was prepared as follows: PrimeSTAR Max DNAPolymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; pGreenII 62-SK (concentration of 500 ng / μL): 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10 s; 55℃, 5 s; 68℃, 30 s; for a total of 30 cycles. The incompletely linearized circular vector was removed using a Dpn I kit. The total reaction volume of 20 μL consisted of: 5 μL linearized vector, 1 μL DpnI, 2 μL 10×T buffer, and 12 μL sterile water. The reaction conditions were: 37℃ for 4 h, followed by incubation at 70℃ for 15 min. Agarose gel electrophoresis was performed for validation: the gel ran for 25 min; the target band was recovered, and after gel extraction, the fully linearized pGreenII 62-SK vector was purified using a Novizan gel extraction kit.

[0051] (2) Amplification of the homologous arm fragments of MaHPCA1-1 and MaHPCA1-3: The forward primer for the homologous arm fragment of MaHPCA1-1 is: AACTAGTGGATCCCCATGATTGGAGTCTTTCTTATCTTTTATGGGGC (SEQ ID NO.26), and the reverse primer is: AATTCCTGCCAGCCCGTCATCGGGCCGCAACAGC (SEQ ID NO.27); The forward primer for the homologous arm fragment of MaHPCA1-3 is: AACTAGTGGATCCCCATGGGAACCCTCATCTTCACCC (SEQ ID NO.28), and the reverse primer is: GAATTCCTGCAGCCCGTTATTTGGGCTCGGGTTTTGCTG (SEQ ID NO.29). PCR amplification was performed. The total PCR reaction volume of 20 μL was prepared as follows: PrimeSTAR Max DNA Polymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; cDNA template: 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10 s; 55℃, 5 s; 68℃, 30 s; for a total of 30 cycles. Agarose gel electrophoresis was performed for verification: the gel running time was 25 min; after gel excision, the fragments MaHPCA1-1 and MaHPCA1-3 with homologous arms were purified using the Novizan gel extraction kit.

[0052] (3) Ligation: Homologous recombination was performed using the In-Fusion kit. The recombination system consisted of 5 μL (1 μL of linearized pGreenII62-SK vector, 1 μL of In-Fusion enzyme premix, 1 μL of MaHPCA1-1 or MaHPCA1-3 fragment with homologous arms, and 2 μL of sterile water). After reacting at 50 °C for 15 min, the homologous recombination products MaHPCA1-1-SK or MaHPCA1-3-SK were obtained.

[0053] (4) Transformation plating and colony identification: 1 μL of the homologous recombinant product of MaHPCA1-1-SK or MaHPCA1-3-SK was transformed into DH5α competent cells and plated (Kan resistant). After incubation at 37℃ for 12 h, colony identification was performed. Colonies containing the target fragment were screened and shaken. Positive colonies were picked up with a pipette tip and placed together with the pipette tip into 10 mL of liquid LB medium (Kan resistant). After incubation at 37℃ for 12 h, the plasmid was extracted to obtain the MaHPCA1-1-SK or MaHPCA1-3-SK recombinant plasmid.

[0054] The cells were then transformed into Agrobacterium GV3101 (pSoup-p19). The specific steps were as follows: Take two 100 μL tubes of Agrobacterium GV3101 (pSoup-p19) competent cells and allow them to partially thaw at room temperature. Add 1 μL of MaHPCA1-1-SK or MaHPCA1-3-SK recombinant plasmid to each cell. First, incubate on ice for 5 min, then transfer to liquid nitrogen for 5 min, then place in a 37℃ water bath for 5 min, and finally in an ice bath for 5 min. Add 700 μL of antibiotic-free LB liquid medium and incubate at 28℃ with shaking for 2-3 h. Harvest the bacteria at 6000×g for 1 min, and resuspend 100 μL of the supernatant by gentle pipetting. Spread the bacterial culture onto Rif-Kan double-antibiotic plates and incubate upside down at 28℃ for 48 h. Identify the grown colonies, and perform shaking culture on positive colonies.

[0055] Finally, the Agrobacterium tumefaciens bacterial solution containing the target gene was shaken at 28°C to OD. 600 =0.8-1.0, centrifuged, and resuspended to OD using a pH 5.6 incubation buffer (components: 98 mL water, 1 mL 1.0 M morpholine ethanesulfonic acid (MES) aqueous solution, 1 mL 1.0 M magnesium chloride hexahydrate (MgCl2·6H2O) aqueous solution, and 200 μL 100 mM acetylsyl syringone (AS) aqueous solution). 600 =0.8. Using a disposable sterile syringe, 1 mL of Agrobacterium infection solution containing the target gene was injected into the banana peel. A blank control was prepared by injecting 1 mL of Agrobacterium infection solution containing the pGreenII 62-SK empty vector plasmid into the same fruit. The OE-MaHPCA1-1 and OE-MaHPCA1-3 overexpression vectors and the blank control underwent the same low-temperature treatment time. The fruit was then stored in a cold storage at 6±1℃ and 85% relative humidity, protected from light.

[0056] 1.2 Test Methods

[0057] The banana samples used in the following experiments were all banana peel powders ground using liquid nitrogen.

[0058] (1) H2O2 content determination: The hydrogen peroxide content (H2O2) kit was used for detection. The specific test method is as follows: The kit contains four components: reagent 1, reagent 2, reagent 3 and standard. Weigh 0.5g of banana sample, add 1.0 mL of acetone, homogenize on ice, transfer to EP tube, centrifuge at 12000 rpm and 4℃ for 10 min, take the supernatant and place on ice for testing. Preheat the microplate reader for more than 30 min and adjust the wavelength to 415 nm. Add 500 μL of supernatant, 50 μL of reagent 1 and 100 μL of reagent 2 to the sample tube, and add 500 μL of acetone, 50 μL of reagent 1 and 100 μL of reagent 2 to the blank tube. Vortex thoroughly to mix, centrifuge at 25℃ for 10 min, discard the supernatant and keep the precipitate. Add 460 μL of reagent III to both sample and blank tubes to dissolve the precipitate. Mix well and centrifuge at 12000 rpm for 2 min. Transfer 200 μL of the supernatant to a 96-well plate and read the absorbance (A) at 415 nm. The standard curve is prepared as follows: Dissolve 10 μL of the standard in 4.99 mL of acetone, mix thoroughly, and then dilute with acetone to prepare the following concentration gradients: 0 μM, 0.2 μM, 0.4 μM, 0.6 μM, 0.8 μM, 1.0 μM, and 1.2 μM. Follow the same procedure as for the blank tubes. The standard curve is then prepared using the equation: y = 2.4544x - 0.0329; where x is the molar mass of the standard (μmol); and y is ΔA.

[0059] The calculation formula is: ΔA = Adetermined - Ablank. H2O2 content (μmol g) -1 = [(ΔA+0.0329)÷2.4544]÷(W×V1÷V)=1.63×(ΔA+0.0329)÷W, where V is the volume of acetone added (1.0 mL); V1 is the volume of sample liquid added to the reaction system (0.5 mL); and W is the sample mass (0.5 g). Three technical replicates were performed for each sample group, and the average value was taken.

[0060] (2) O2 -Production rate determination: Take 1.0 g of banana sample and add 1.0 mL of extraction buffer (prepared by weighing 29.2 mg EDTA, 2 g PVP, and 0.3 mL Triton X-100, and adding them to 50 mM, pH 7.8 phosphate buffer). Grind thoroughly in an ice bath. Centrifuge the mixture at 12000 rpm for 20 min at 4 °C. The supernatant obtained is the sample extract and should be stored at 4 °C. Take 1.0 mL of the sample extract, add 1.0 mL of 50 mM, pH 7.8 phosphate buffer and 1.0 mL of 1.0 mM hydroxylamine hydrochloride solution, shake well, and incubate at 25 °C for 1 h. Then add 1.0 mL of 17.0 mM p-aminobenzenesulfonic acid solution and 1.0 mL of 7.0 mM α-naphthylamine solution, mix well, and incubate at 25 °C for 20 min for a colorimetric reaction, ensuring that the color change in the reaction system is stable and obvious. Preheat the microplate reader for at least 30 minutes, take 200 μL of supernatant (make three technical replicates for each sample group) into a 96-well plate, and measure the absorbance at 530 nm.

[0061] The standard curve was prepared by taking seven test tubes and numbering them 0-6. For tubes 0-6, add 0 mL, 0.1 mL, 0.2 mL, 0.3 mL, 0.4 mL, 0.5 mL, and 0.6 mL of 100 µM KNO2 standard solution, respectively. Add 1.0 mL, 0.9 mL, 0.8 mL, 0.7 mL, 0.6 mL, 0.5 mL, and 0.4 mL of distilled water, respectively. Add 1.0 mL of 50 mM phosphate buffer (pH 7.8) and 1.0 mL of 1.0 mM hydroxylamine hydrochloride solution to each tube. Shake well and incubate at 25°C for 1 hour. Afterward, add 1.0 mL of 17.0 mM p-aminobenzenesulfonic acid solution and 1.0 mL of 7.0 mM α-naphthylamine solution, respectively. Mix well and incubate at 25°C for 20 minutes for color development. At this point, solutions 0 through 6 contain equivalent amounts of superoxide anions of 0 μmol, 20 μmol, 40 μmol, 60 μmol, 80 μmol, 100 μmol, and 120 μmol, respectively. The microplate reader is preheated for at least 30 minutes. 200 μL of supernatant (three technical replicates per sample group) is transferred to a 96-well plate, and the absorbance is measured at 530 nm. A standard curve is constructed with absorbance on the ordinate and the amount of superoxide anion (μmol) on the abscissa.

[0062] The calculation formula is: O2 - Production rate = (n × V × 1000) ÷ (Vs × t × m), unit: nmol g -1 min -1Where n is the amount of superoxide anion calculated from the standard curve, in μmol; V is the total volume of the sample extract, i.e., 1.0 mL; Vs is the volume of the test sample, i.e., 0.2 mL; t is the reaction time of the sample with hydroxylamine, i.e., 60 min; and m is the sample mass, i.e., 1.0 g. Three technical replicates were made for each group of samples, and the average value was taken.

[0063] (3) MDA content determination: Weigh 0.5g of banana sample and grind it thoroughly in 5.0mL of 100 g / L trichloroacetic acid (TCA) solution to obtain a homogenate. Centrifuge at 4℃ and 10000 rpm for 20min and separate the supernatant as the sample extract. Mix 1.0mL of sample extract with 1.0mL of 0.67% thiobarbituric acid solution (TBA) evenly. Place the mixture in a boiling water bath and heat to boiling for 20min. Then, quickly transfer the mixture to an ice bath for rapid cooling to terminate the reaction. After cooling, centrifuge once more under the same conditions. Preheat the microplate reader for at least 30min. Take 200μL of supernatant (three technical replicates for each group of samples) into a 96-well plate and measure the absorbance values ​​at wavelengths of 450nm, 532nm, and 600nm, respectively. Measure three times for each group.

[0064] The calculation formula is: c = 6.45 × (OD) 532 -OD 600 -0.56×OD 450 The unit is μmol L -1 In the formula: OD 450 OD 532 OD 600 These represent the absorbance values ​​at wavelengths of 450 nm, 530 nm, and 600 nm, respectively. MDA content = (c × V) ÷ (Vs × m), unit: nmol g -1 In the formula: c is the concentration of MDA in the reaction mixture, in μmol / L. -1 V represents the total volume of the sample extract, i.e., 1.0 mL; Vs represents the volume of the sample liquid taken during the determination, i.e., 0.2 mL; m represents the sample mass, i.e., 0.5 g. Three technical replicates were performed for each group of samples, and the average value was taken.

[0065] (4) The test method for relative gene expression level refers to the test steps 1.1 to 1.4 in Example 1 above. The test sample is a banana sample stored at 6±1℃ for 5 days (the middle section of the banana peel after the head and tail are cut off).

[0066] 1.3 Experimental Results

[0067] Depend on Figure 5As shown in A, compared with the blank control, overexpression of MaHPCA1-1 and MaHPCA1-3 genes reduced the browning symptoms of banana peel, and the relative expression levels of MaHPCA1-1 and MaHPCA1-3 were found to be 15.70 times and 44.33 times higher than those in the blank control, respectively. Figure 5 (B in the text). Further measurements were taken of H2O2 content and O2 content at the transient overexpression site and the blank control site. - The production rate and MDA content were compared; the H2O2 content in the blank control was 5.08 μmol g. -1 The H2O2 content at the overexpression site of MaHPCA1-1 was 2.56 μmol g. -1 The H2O2 content of the overexpressing MaHPCA1-3 site was 2.39 μmol g. -1 The H2O2 content in the overexpressed MaHPCA1-1 and MaHPCA1-3 fractions was reduced by 49.61% and 52.95% respectively compared to the control fraction. Figure 5 C in the blank control region O2 - The production rate is 0.2545 nmol g. -1 min -1 Overexpression of O2 at the MaHPCA1-1 site - The production rate is 0.1472 nmol g. -1 min -1 Overexpression of O2 at the MaHPCA1-3 site - The production rate is 0.1643 nmol g. -1 min -1 O2 - The production rate decreased by 42.16% and 35.44% ( Figure 5 The MDA content in the blank control region (D) was 1.45 nmol g. -1 The MDA content of the overexpressing MaHPCA1-1 site was 1.02 nmol g. -1 The MDA content of the overexpressing MaHPCA1-3 site was 0.95 nmol g. -1 The MDA content decreased by 29.66% and 34.48% ( Figure 5 (E in the text).

[0068] Example 4: Banana peel silencing MaHPCA1-1 and MaHPCA1-3

[0069] 1.1 Experimental Methods

[0070] First, the MaHPCA1-1 and MaHPCA1-3 fragments obtained in Example 2 were homologously recombinated with the pTRV2 vector to construct MaHPCA1-1-silenced and MaHPCA1-3-silenced silencing vectors. The specific steps are as follows:

[0071] (1) Linearization of pTRV2 vector: The pTRV2 empty vector plasmid was linearized using forward primer: tgtttgagggaaaagtagagaacgt (SEQ ID NO.30) and reverse primer: ttaccgatcaatcaagatcagtcga (SEQ ID NO.31) according to the PCR amplification program. The total PCR reaction system of 20 μL was prepared as follows: PrimeSTAR MaxDNA Polymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; pTRV2 vector (concentration of 500 ng / μL): 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10 s; 55℃, 5 s; 68℃, 90 s; for a total of 30 cycles. The incompletely linearized circular vector was removed using a Dpn I kit. The total reaction volume of 20 μL consisted of: 5 μL linearized vector, 1 μL DpnI, 2 μL 10×T buffer, and 12 μL sterile water. The reaction conditions were: 37°C for 4 h, followed by incubation at 70°C for 15 min. Agarose gel electrophoresis was performed for validation: the gel ran for 25 min; the target band was recovered, and after gel extraction, the fully linearized pTRV2 vector was purified using a Novizan gel extraction kit.

[0072] (2) Amplification of homologous arm fragments of MaHPCA1-1 and MaHPCA1-3: The forward primer used to amplify the specific fragment (270bp) used for silencing in MaHPCA1-1 is: gggacatgcccgggcctcgagAGCCGCATGAATGCTTACCC (SEQ ID NO.14), and the reverse primer is: tggggatccggtaccgagctcTCATCGGGCCGCAACAGC (SEQ ID NO.15). The forward primer used to amplify the specific fragment (270bp) used for silencing in MaHPCA1-3 is: gggacatgcccgggcctcgagAAGTTCACAGAGTTGGCCTTGAG (SEQ ID NO.16), and the reverse primer is: tggggatccggtaccgagctcTTATTTGGGCTCGGGTTTTG (SEQ ID NO.17). PCR amplification was performed. The total PCR reaction volume of 20 μL was prepared as follows: PrimeSTARMax DNA Polymerase Ver.2: 10 μL; 10 µM forward and reverse primers: 0.6 μL each; cDNA template: 1 μL; sterile water: 7.8 μL. The PCR reaction conditions were: 98℃, 10 s; 55℃, 5 s; 68℃, 10 s; for a total of 30 cycles. Finally, agarose gel electrophoresis was performed for verification: the gel running time was 25 min; after gel excision, the fragments MaHPCA1-1 and MaHPCA1-3 with homologous arms were purified using the Novizan gel extraction kit.

[0073] (3) Ligation: Homologous recombination was performed using the In-Fusion kit. The recombination system consisted of 5 μL (1 μL of linearized pTRV2 vector, 1 μL of In-Fusion enzyme premix, 1 μL of MaHPCA1-1 or MaHPCA1-3 fragment with homologous arms, and 2 μL of sterile water). After reacting at 50℃ for 15 min, the homologous recombination products MaHPCA1-1-pTRV2 or MaHPCA1-3-pTRV2 were obtained.

[0074] (4) Transformation plating and colony identification: 1 μL of the homologous recombination product of MaHPCA1-1-pTRV2 or MaHPCA1-3-pTRV2 was transformed into DH5α competent cells and plated (Kan resistant). After incubation at 37℃ for 12 h, colony identification was performed. Colonies containing the target fragment were screened and shaken. Positive colonies were picked up with a pipette tip and placed together with the pipette tip into 10 mL of liquid LB medium (Kan resistant). After incubation at 37℃ for 12 h, the plasmid was extracted to obtain the recombinant plasmids MaHPCA1-1-pTRV2 or MaHPCA1-3-pTRV2.

[0075] The cells were then transformed into Agrobacterium competent cells GV3101 (pSoup-p19), following the experimental method described in Example 3, Section 1.1. A mixed Agrobacterium infection solution containing equal volumes of empty pTRV1 and pTRV2 vectors was injected into the same fruit as a blank control. The low-temperature treatment time for pTRV2-MaHPCA1-1, pTRV2-MaHPCA1-3, and the blank control was the same. The fruits were then placed in a cold storage at 6±1℃ and 85% relative humidity, protected from light.

[0076] 1.2 H2O2 content, O2 - The production rate and MDA content were tested using the same method as in Example 3, Section 1.2. The relative gene expression level was tested using the same method as in Example 1, Sections 1.1 to 1.4. The test sample was a banana sample stored at 6±1℃ for 5 days (the middle section of the banana peel after the ends were cut off).

[0077] 1.3 Experimental Results

[0078] Depend on Figure 6 As shown in section A, compared with the blank control, silencing the MaHPCA1-1 and MaHPCA1-3 genes did not reduce the browning symptoms of banana peel, and the relative expression levels of MaHPCA1-1 and MaHPCA1-3 were found to be lower in the blank control area. Figure 6 In section B), it was found that the H2O2 content in the silent MaHPCA1-1 and MaHPCA1-3 sites was higher than that in the blank control site. Figure 6 The H2O2 content in the C portion (the blank control portion) was 5.18 μmol g. -1 The H2O2 content of the silent MaHPCA1-1 site was 7.02 μmol / g. -1 The H2O2 content of the silent MaHPCA1-3 site was 7.24 μmol g. -1 O2 - The production rate increases ( Figure 6 (D in the blank control region) O2 - The production rate is 0.2374 nmol g. -1 min -1 O2 at the silent MaHPCA1-1 site - The production rate is 0.3207 nmol g. -1 min -1 O2 in the silent MaHPCA1-3 region - The production rate is 0.2804 nmol g. -1 min -1 The content of MDA increased ( Figure 6The MDA content in the E region (the blank control region) was 1.38 nmol g. -1 The MDA content of the silent MaHPCA1-1 site was 1.77 nmol g. -1 The MDA content of the silent MaHPCA1-3 site was 1.81 nmol g. -1 .

[0079] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of a receptor-like kinase MaHPCA1 in relieving banana chilling injury, characterized in that, The receptor-like kinase MaHPCA1 is any one of MaHPCA1-1 or MaHPCA1-3, the nucleotide sequence of MaHPCA1-1 is shown as SEQ ID NO. 1, and the nucleotide sequence of MaHPCA1-3 is shown as SEQ ID NO. 2; the cold injury symptoms of banana are alleviated by overexpressing MaHPCA1-1 or MaHPCA1-3 in banana peel, and the cold tolerance of banana fruit is improved.

2. A method of breeding a banana that is resistant to chilling injury, characterized in that, The method comprises the following steps: (1) connecting MaHPCA1-1 or MaHPCA1-3 to a vector to obtain an overexpression vector; wherein the nucleotide sequence of MaHPCA1-1 is shown as SEQ ID NO. 1, and the nucleotide sequence of MaHPCA1-3 is shown as SEQ ID NO. 2; (2) transforming the overexpression vector into Agrobacterium, shock culture, centrifugation, resuspension with an infection solution to obtain a recombinant bacteria-containing infection solution; (3) infecting banana peel with the recombinant bacteria-containing infection solution obtained in step (2) to obtain cold-resistant banana.

3. The method of claim 2, wherein, The vector in step (1) is pGreenII 62-SK vector.

4. The method of claim 2, wherein, The pH of the infection solution in step (2) is 5.2-5.

8.

5. The method of claim 4, wherein, The pH of the infection solution is 5.

6.

6. The method of claim 2, wherein, The infection solution in step (2) is prepared by mixing the following components: 98 mL of water, 1 mL of 1.0 M aqueous morpholine ethanesulfonic acid solution, 1 mL of 1.0 M aqueous magnesium chloride hexahydrate solution, and 200 μL of 100 mM aqueous acetyl-syringone solution.