Molecular marker related to high lysine character of corn as well as primer group and application of molecular marker

Abstract

The invention discloses a molecular marker related to the high lysine character of corn as well as a primer group and application of the molecular marker, and belongs to the technical field of plant molecular breeding. On the basis of whole genome re-sequencing comparison, an InDel molecular marker closely linked with a corn high-lysine key gene is found, and the marker is located in a corn chromosome 7. The invention provides a specific primer group for detecting the marker, PCR (Polymerase Chain Reaction) amplification is carried out by utilizing the primer group, and identification can be carried out through agarose gel electrophoresis according to the length polymorphism of an amplified fragment: an individual amplified with a 835bp band is a high-lysine genotype, an individual amplified with a 610bp band is a common genotype, and an individual amplified with the 610bp band is a high-lysine genotype. And the individual with the 835bp band and the 610bp band simultaneously appearing is a heterozygous genotype. Therefore, the invention provides an efficient and reliable technical tool for molecular marker-assisted selective breeding of high-lysine corn.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant molecular breeding, and particularly relates to a molecular marker related to a high lysine trait of corn, a primer set thereof and application. BACKGROUND

[0002] Corn is an important food, feed and industrial raw material crop in the world. Improving the nutritional value of corn kernels, especially the lysine content, is of great significance for improving human nutrition and animal feed efficiency. The opaque2 (o2) gene is a major gene controlling lysine content in the endosperm of corn kernels, and its recessive mutant can significantly increase lysine and content. Traditional o2 genotype identification relies on determination of the biochemical composition of mature kernels or phenotype segregation based on offspring, which is long in cycle, high in cost and low in efficiency, and cannot be used for large-scale screening in early generations (such as seedling stage). Although there are some PCR-based molecular markers, they either need restriction enzyme digestion (such as CAPS marker), which increases the operation complexity and cost; or have poor polymorphism and stability in different genetic backgrounds. Therefore, it is urgent to develop a simple-to-operate (only PCR and electrophoresis are needed), polymorphic and stable molecular marker in different materials, which can accelerate the breeding process of high lysine corn. SUMMARY

[0003] In order to solve the above-mentioned problems existing in the prior art, the purpose of the present application is to provide a molecular marker related to a high lysine trait of corn, a primer set thereof and application, so as to provide a molecular marker which can be used for detecting the high lysine trait of corn, thereby accelerating the breeding process.

[0004] The technical scheme for solving the above-mentioned technical problems is as follows: a molecular marker related to a high lysine trait of corn is provided, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1.

[0005] The present application provides a primer set for identifying the above-mentioned molecular marker, and the nucleotide sequences of the primer set are shown in SEQ ID NO. 2-3.

[0006] The present application provides application of the above-mentioned primer set in identifying or screening high lysine corn.

[0007] The present application provides a method for identifying or screening high lysine corn varieties, comprising the following steps: using the above-mentioned primer set to amplify the corn to be tested, if an individual with 835bp band is high lysine genotype, an individual with 610bp band is ordinary genotype, and an individual with both 835bp and 610bp bands is heterozygous genotype.

[0008] Furthermore, the nucleotide sequence of the high-lysine genotype is shown in SEQ ID NO.1, and the nucleotide sequence of the normal genotype is shown in SEQ ID NO.4.

[0009] This invention provides an application of the above-mentioned molecular markers in the breeding of high-lysine maize varieties.

[0010] This invention provides a breeding method for high-lysine maize varieties, comprising the following steps: using the high-lysine maize variety obtained by the above method as a parent for breeding.

[0011] The present invention has the following beneficial effects: (1) High accuracy: The molecular marker provided by this invention is closely linked to the o2 gene, and the accuracy rate in the F2 population of the donor parent and the recipient parent reaches 100%, which is highly reliable; (2) Simple operation: Based on InDel length polymorphism, detection can be completed by routine PCR and agarose gel electrophoresis, without the need for complex steps such as enzyme digestion and sequencing, which greatly reduces the technical threshold and detection cost; (3) Early selection: DNA can be taken from leaves during the seedling stage for identification, without waiting for the plant to mature and bear fruit, which shortens the breeding selection cycle by several months and significantly improves breeding efficiency; (4) The results are intuitive: the amplified fragment lengths are significantly different (835bp-610bp), which can be clearly distinguished on ordinary agarose gel. The interpretation is simple and clear and not easy to make mistakes. Attached Figure Description

[0012] Figure 1 This is an image showing the electrophoresis results after PCR amplification of maize materials with known genotypes using the primer set of this invention; Figure 2 The image shows the electrophoretic detection results of the F2 segregating population constructed by hybridization of high-lysine donors and ordinary acceptors after PCR amplification. Detailed Implementation

[0013] The examples given below are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, conditions in the examples are performed under standard conditions or as recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0014] Example 1: Development and Validation of Molecular Markers 1. Primer design: By performing whole-genome resequencing and sequence alignment on high-lysine donor parents and ordinary recipient parents, a region with significant length polymorphism (InDel) was found in the chr7: 11076093-11076818 region on chromosome 7. Specific PCR primers O2_Marker2_F (5'-ATACACTGCTCGCTCTTCTTCC-3', SEQ ID NO.2) and O2_Marker2_R (5'-GTGATTGTTTGAGCCTTGAGAA-3', SEQ ID NO.3) were designed for this region.

[0015] 2. Experimental Materials: Known genotypes of high-lysine homozygous inbred lines (o2 / o2), ordinary homozygous inbred lines (O2 / O2), and their F1 hybrids (O2 / o2). Among them, the high-lysine homozygous inbred line Protein Yellow-1 (o2 / o2) is a high-generation material obtained by the inventors through 8 generations of self-pollination and selection. The ordinary homozygous inbred line is the inbred line YH18-302 bred by the inventors' team. All of the above materials can be obtained by contacting the inventors.

[0016] 3. DNA Extraction: Collect leaves from seedlings of various materials and extract genomic DNA using the CTAB method. The specific steps are as follows: Take 30-50 mg of tender corn leaves, grind them into a fine powder using liquid nitrogen, and transfer the powder into a 2 ml centrifuge tube, filling the tube no more than 1 / 2 full. Then add 750 μL of 2% CTAB extraction buffer preheated at 65℃, mix thoroughly, and incubate at 65℃ for 30-60 minutes, inverting and mixing every 10 minutes. Add an equal volume (750 μL) of chloroform / isoamyl alcohol (24:1), invert and mix for 5 minutes, centrifuge at 12000 rpm for 10 minutes, collect the supernatant, add 1 volume of isopropanol, incubate at -20℃ for 30 minutes to precipitate the DNA, centrifuge at 12000 rpm for 10 minutes, discard the supernatant, wash the precipitate twice with 75% ethanol, air dry at room temperature, and dissolve in 50 μL of TE buffer.

[0017] 4. PCR amplification and detection: Reaction system (20 μL): 10 μL 2×Taq PCR Master Mix, 0.5 μL each of O2_Marker2_F and O2_Marker2_R (10 μM), 1 μL template DNA (10 ng / μL), and double-distilled water to 20 μL.

[0018] Reaction program: 94℃ pre-denaturation for 3 min; 32 cycles (94℃ 30 s, 60℃ 30 s, 72℃ 30 s); 72℃ final extension for 10 min.

[0019] Electrophoresis analysis: Take 5 μL of PCR product and electrophoresis at 150V for 30 minutes in a 3% agarose gel (prepared with 0.5×TBE buffer). Observe the gel using a GoldView staining system after electrophoresis.

[0020] The results are as follows Figure 1 As shown, the electrophoresis results clearly displayed three different band patterns. Individuals amplifying an 835bp band (SEQ ID NO.1) were of the high-lysine genotype, individuals amplifying a 610bp band (SEQ ID NO.4) were of the normal genotype, and individuals exhibiting both 835bp and 610bp bands were of the heterozygous genotype. These results perfectly matched known genotypes, demonstrating that this primer set can effectively distinguish between different genotypes.

[0021] Example 2: Application of molecular markers in breeding populations The molecular markers and primer pairs of this invention were applied to an F2 segregating population (n=120) constructed by crossing a high-lysine donor (high-lysine homozygous inbred line Protein Yellow-1 (o2 / o2)) with a common acceptor (inbred line YH18-302). DNA was extracted from individual leaves during the seedling stage, and genotyping was performed according to the method in Example 1. Simultaneously, after plant maturity, lysine content was measured in seeds from each plant (or based on the seed opaque phenotype) as verification.

[0022] Depend on Figure 2 The results showed that the concordance rate between the molecular marker identification results and the grain phenotypic verification results was 100%. All individuals identified as O2 / O2 (835bp band) at the seedling stage exhibited high lysine characteristics in their mature grains. These results demonstrate that the molecular markers and primer pairs of this invention can successfully achieve accurate and non-destructive screening for high lysine traits in maize seedlings.

[0023] The nucleotide sequence of the molecular marker or high-lysine genotype of this invention is shown below: ATACACTGCTCGCTCTTCTTCCCTATCTTTATTATTCCCTCGCTATATCTTCGGCGGTTTACTCGTCTTTTATCTCTTAATTTACACTTCATTGTTGTATAAATAGTACAAAACAATGTTTTACACGGCCTGTACTGTACTCTCTATGGGCTACAGGGTTTGTAGTAGTACGTGTGTCTTATTAACTGGGGGTGCAATAACTGAAATCGGCCGGTGCCTTTTCTGACGTACTAAGTTTGTATCACCTACATCTAGTGCATCCAAACACACCTTCTAAAAGTGATGAGGGTAGGTAATCCACGATCTAGCTATGGAGATGTGGTGTTCTCGTTGAGCTATATGCCATGTTTGGCTAGACAAACTGCCAAACAAGAATCCCACATCACAAATCTCGTGACACTAGCTAGCGCTATATACATATATACAGAACAAGCTAAGCACAGTGACTTGTGATGTGGCATCCTTGTTTGGCAGTTTGTATAGCCAAACATGGCATATAGCTCAACGAGAACACCACATCTCTATAGCTAGATCGTGGATTACCTACCCTCATCACTTTTAGAAGGTGTGTTTGGATGCACTAGATGTAGGTGATACAAACTTAGTACGTCAGAAAAGGCACCGGCCGATTTCAGTTATTGCACCCCCAGTTAATAAGACACACGTACTACTACAAACCCTGTAGCCCATAGAGAGTACAGTACAGGCCGTGTAAAACATTGTTTTGTACTATTTATACAACAATGAAGTGTAAATTAAGAGATAAAAGACGAGTAAACCGCCGAAGATATAGCGAGGGAATAATAAAGATAGGGAAGAAGAGCGAGCAGTGTAT (SEQ ID NO.1); The nucleotide sequence of the common genotype in the present invention is shown as follows: (SEQ ID NO.4).

[0024] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A molecular marker associated with the high lysine trait in maize, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1.

2. A primer set for identifying the molecular marker of claim 1, characterized in that, The nucleotide sequences of the primer set are shown in SEQ ID NO.2-3.

3. The application of the primer set according to claim 2 in the identification or screening of high-lysine maize.

4. A method for identifying or screening high-lysine maize varieties, characterized in that, The process includes the following steps: amplifying the maize sample using the primer set described in claim 2; individuals that amplify an 835bp band are of the high lysine genotype, individuals that amplify a 610bp band are of the normal genotype, and individuals that show both 835bp and 610bp bands are of the heterozygous genotype.

5. The method according to claim 4, characterized in that, The nucleotide sequence of the high-lysine genotype is shown in SEQ ID NO.1, and the nucleotide sequence of the normal genotype is shown in SEQ ID NO.

4.

6. The application of the molecular marker described in claim 1 in the breeding of high-lysine maize varieties.

7. A breeding method for a high-lysine maize variety, characterized in that, Includes the following steps: The high-lysine maize variety obtained by the method of claim 4 or 5 is used as a parent for breeding.

Images