Reagent and kit for detecting EB (Epstein-Barr) virus infection and method for identifying EB virus cell lineage infection

Abstract

The invention discloses a reagent and a kit for detecting EB (Epstein-Barr) virus infection and a method for detecting EB virus infected cell lineage, and belongs to the field of medical diagnosis. The technical problem to be solved by the invention is how to accurately locate different cell lineages of EBER + cells. The reagent for detecting EB virus infection disclosed by the invention contains an EBV probe and an antibody for marking a cell lineage, the sequence of the EBV probe is shown as SEQ ID No.1 and SEQ ID No.2, and the antibody for marking the cell lineage is a CD3 antibody, a CD20 antibody and / or a CD56 antibody. The reagent and the kit for detecting EB virus infection can be used for simultaneous marking of EBER genes and antigen proteins, accurate positioning of different cell lineages of EBER + cells is achieved, and cell lineage positioning of EB virus infection is further achieved.

Description

Technical Field

[0001] This invention belongs to the field of medical diagnostics, specifically relating to reagents and kits for detecting EB virus infection and methods for identifying EB virus cell lineage infection. Background Technology

[0002] Epstein-Barr virus (EBV) is a human herpesvirus type 4, a DNA virus belonging to the lymphotropic virus family. Due to its high infectivity and carcinogenicity, EBV has been classified as a Group 1 carcinogen by the International Agency for Research on Cancer (IARC). EBV encodes two small non-polyadenylated RNAs (EBER1 and EBER2), with 167 and 172 nucleotides respectively. These are non-protein-translated RNAs encoded by EBV, and their main function is to inhibit interferon-mediated antiviral effects. EBERs are abundant in cells latently infected with EBV, reaching up to 10 per cell. 6 ~10 7 copy.

[0003] Histological detection using EBER in situ hybridization on tissue biopsy sections is currently the gold standard for diagnosing Epstein-Barr virus (EBV) infection. The general procedure involves heating paraffin sections in antigen retrieval solution, followed by sequential processing with EBER probe hybridization, primary antibody, amplification agent, secondary antibody, staining, and hematoxylin. However, current techniques cannot simultaneously detect the EBER gene and CD molecules on the same tissue section, meaning they cannot directly identify the EBV-infected cell type. Inference can only be made by staining consecutive sections with EBER and CD molecules separately. This method is wasteful of samples and has low accuracy.

[0004] Currently, flow cytometry is used to detect EBV-infected cell types. However, a drawback is that EBV does not necessarily infect cells in peripheral blood or bone marrow, requiring in-situ detection in tumor tissue. Furthermore, the flow cytometry-based sorting and PCR method is complex and suffers from significant sample loss. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to detect different cell lineages of EBER+ cells and how to accurately locate different cell lineages of EBER+ cells.

[0006] To address the aforementioned technical problems, the present invention first provides a reagent for detecting EBV infection, wherein the reagent for detecting EBV infection contains EBV probes FISH Probe-Hsa-EBER1 and FISH Probe-Hsa-EBER2, wherein FISH Probe-Hsa-EBER1 is the single-stranded DNA shown in SEQ ID No. 1, and FISH Probe-Hsa-EBER2 is the single-stranded DNA shown in SEQ ID No. 2.

[0007] Specifically, the reagent may also contain antibodies for labeling cell lineages (such as CD3 antibodies, CD20 antibodies, and / or CD56 antibodies).

[0008] Furthermore, the reagent may also contain a secondary antibody labeled with a fluorescent dye. Even further, the secondary antibody is labeled with the fluorescent dye AF647.

[0009] In one embodiment of the present invention, the secondary antibody is goat anti-rabbit IgG H&L (Alexa Fluor® 647).

[0010] The reagent for detecting EBV infection may consist solely of the EBV probe, or it may consist of the EBV probe and the antibody for labeling cell lineages, or it may consist of the EBV probe, the antibody for labeling cell lineages, and the secondary antibody containing a labeled fluorescent dye.

[0011] The present invention also provides a kit for detecting EB virus infection, the kit containing the reagent for detecting EB virus infection.

[0012] In one embodiment of the present invention, the kit further contains reagents from the SEERNA® FISH RNA fluorescence in situ hybridization kit.

[0013] The present invention also provides any of the following applications of the reagent for detecting EB virus infection or the kit for detecting EB virus infection: X1) Prepare products for identifying EB virus-infected cell lineages, or identify EB virus-infected cell lineages; X2) Prepare products that identify therapeutic targets for EB virus infection, or identify therapeutic targets for EB virus infection. X3) Guide the preparation of drugs for treating EB virus infection; X4) Prepare products for detecting EB virus infection samples, or test EB virus infection samples; X5) Prepare products for detecting EBV infection in multiple cell lineages in the same sample, or detect EBV infection in multiple cell lineages in the same sample; X6) Prepare products that can distinguish between different EB virus infection statuses in the same sample, or distinguish between different EB virus infection statuses in the same sample.

[0014] X7) Prepare EB virus positive cell localization products for in vitro samples, or localize EB virus positive cells for in vitro samples.

[0015] The present invention also provides a method for identifying EB virus cell lineage infection for guiding the preparation of drugs for treating EB virus infection, the method comprising: (a) Preparation of tissue sections from ex vivo samples of the subject; (b) Using the EBV probe to perform hybridization to determine EBV-infected tissues or cells; (c) Marking tissue sections with markers of different cell lineages to obtain different cell lineages; (d) Analyze the cell lineages of EB virus infection to obtain the cell lineages of EB virus infection.

[0016] Specifically, the cell lineage refers to different subsets of lymphocytes, such as cell subpopulations that are positive for a single antibody or a combination of multiple antibodies, including CD3 antibody, CD20 antibody, and CD56 antibody.

[0017] In step (c), labeling tissue sections with markers of different cell lineages includes: incubating the tissue sections with antibodies (such as CD3 antibody, CD20 antibody and / or CD56 antibody) that are markers of different cell lineages, and then incubating with the secondary antibody that is labeled with the fluorescent dye to complete the labeling of the tissue sections with markers of different cell lineages.

[0018] The application of the method in identifying therapeutic targets for EB virus infection, or in guiding the preparation of drugs for treating EB virus infection, is also within the scope of protection of this invention.

[0019] The present invention also provides an apparatus for detecting EB virus-infected cell lineages, the apparatus comprising a preprocessing module, an EB virus detection module, a cell sorting module, and an analysis module; The preprocessing module is used to prepare tissue sections of the subject's ex vivo samples; The EB virus detection module is used for EB virus detection in tissue sections; The cell sorting module is used to label samples tested for EB virus with markers of different cell lineages (such as CD3, CD20 and / or CD56). The analysis module determines the cell lineage of EB virus infection based on the results of the EB virus detection module and the cell sorting module.

[0020] Specifically, the cell lineage refers to different subsets of lymphocytes, such as cell subpopulations that are positive for a single antibody or a combination of multiple antibodies, including CD3 antibody, CD20 antibody, and CD56 antibody.

[0021] The detection of EB virus is performed using the reagents described for detecting EB virus infection.

[0022] The samples tested in this invention can be tissue sections, such as paraffin tissue sections.

[0023] Histological detection using EBER in situ hybridization on tissue biopsy sections is the gold standard for diagnosing Epstein-Barr virus (EBV) infection. Current technological limitations include the inability to stain the EBER gene and CD antigens (cell type identifiers) on the same tissue section. This invention utilizes reagents and kits for detecting EBV infection, enabling simultaneous labeling of the EBER gene and antigen proteins. This allows for precise localization of different cell lineages of EBER+ cells, further facilitating the localization of EBV-infected cell lineages. Attached Figure Description

[0024] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0025] Figure 1 These are test results for patients with NK / T-cell lymphoma.

[0026] Figure 2 The test results are for PTLD patients.

[0027] Figure 3 The test results are for a patient with EBV+DLBCL-NOS. Detailed Implementation

[0028] In this document, unless otherwise defined herein, terms should be understood according to their common usage by those skilled in the art. Examples of resources describing many of the molecular biology-related terms used herein can be found in the following references: Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, GenesIX, Oxford University Press: New York, 2007.

[0029] Unless otherwise stated, the terms “nucleic acid,” “nucleotide,” and “polynucleotide” cover both DNA and RNA.

[0030] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.

[0032] 100×Antigen Retrieval Buffer (100×Tris-EDTA Buffer, pH 9.0): Abcam, ab93684; Triton X-100: Yisheng, 20107ES76; SEERNA® FISH RNA Fluorescence In Situ Hybridization Kit: Devondale, SP1003-T; This kit contains wash buffer, 3 mg / mL pepsin stock solution, permeabilization buffer, Hyb Buffer 1, PG, Hyb wash buffer, B1, PG, ST, E1, B2, E2, Hyb Buffer 2, FISH DP-AF488-EBER1 / 2; Recombinant Anti-CD20 antibody [EP459Y]: Abcam, ab78237; Recombinant Anti-CD3 antibody [SP162]: Abcam, ab135372; Recombinant Anti-NCAM1 antibody (also known as recombinant Anti-CD56 antibody) [EP2567Y]: Abcam, ab75813; Goat anti-rabbit IgG H&L (Alexa Fluor® 647): Abcam, ab150079; 5% BSA blocking solution: Solarbio, SW3015; 20×TBS: Solarb, T1080; Anti-fluorescence decay mounting medium (containing DAPI): Solarbio, S2110.

[0033] Example 1: A kit for diagnosing EB virus infection This embodiment provides a kit for diagnosing EB virus infection, which contains probes for identifying EB virus, namely FISH Probe-Hsa-EBER1 and FISH Probe-Hsa-EBER2.

[0034] The FISH Probe-Hsa-EBER1 sequence is as follows: TGCCGTCTTCGGTCAAGTACCAGCTGGTGGTC (SEQ ID No. 1); The FISH Probe-Hsa-EBER2 sequence is as follows: CCTAGAGCATTTGCAAGTCAGGATTCTCTAAT (SEQ ID No. 2).

[0035] Example 2: Establishment of a method for detecting EB virus infection using the kit from Example 1 Test sample: Paraffin tissue section of lymph nodes from the subject.

[0036] 1. Pretreatment of formalin-fixed stone embedded tissue sections 1) Baking: Bring the paraffin tissue slices to room temperature and air dry, then bake in a 65℃ oven for 30-60 minutes; 2) Preheat 1×Antigen Retrieval buffer: Dilute 100×Antigen Retrieval buffer with ddH2O to 1×Antigen Retrieval buffer. Pour the diluted buffer into a plastic vertical staining bottle, ensuring the height is completely submerged in tissue. Set the water bath to 97°C and place the vertical staining bottle in it to preheat for later use. 3) Dewaxing: Take out the paraffin section (4μm) and immerse it in two xylene baths at room temperature for 10 min each. During this time, move the section up and down from time to time to ensure that the dewaxing is complete. 4) Rehydration: Immerse the sections in a series of ethanol concentrations (100%, 100%, 95%, 95%, 75%) for 5 minutes each time; 5) Rinse the slide with ddH2O for 5 minutes (place the staining bottle on a horizontal shaker). 6) Place the slides in a vertical staining bottle containing preheated 1×Antigen Retrieval buffer and incubate at 97°C for 30 minutes. Do not tighten the cap to maintain internal and external pressure balance. 7) After incubation, place the upright staining bottle at room temperature and allow it to cool naturally to 70 degrees Celsius in 10 minutes; 8) Transfer the slices into a vertical staining bottle containing ddH2O and wash for 10 minutes; 9) Draw a hydrophobic circle: After the slices have dried, use ImmEdge. TM The pen draws a hydrophobic circle around the tissue; 10) Preheat hydrochloric acid: Add 0.1M HCl solution to a 15mL centrifuge tube and preheat in a 42℃ constant temperature incubator for later use; 11) Washing: After step 9), after the hydrophobic zone dries, add 50L of washing buffer, let stand for 10 seconds and then discard the liquid. Repeat 3 times. 12) Fixation: Add 50 μL of 4% PFA solution to the hydrophobic zone, let stand for 10 min, aspirate the liquid from the hydrophobic zone, add 50 μL of washing buffer, let stand for 10 sec, then discard the liquid. Repeat 3 times, keeping the last washing buffer. 13) Permeabilization: Add 1 μL of 3 mg / mL pepsin stock solution to 999 μL of preheated 0.1M HCl aqueous solution to make the final concentration of pepsin 0.003 mg / mL. Vortex and centrifuge. Aspirate the washing buffer from the hydrophobic zone and add it to the permeabilization solution. Place in a humidified chamber (with lid) and incubate at 42℃ for 15 min. (Due to tissue heterogeneity, the pepsin treatment time may vary and can be adjusted according to the actual situation.) 14) Washing: After permeation, aspirate the liquid in the hydrophobic zone, add 50 μL of washing buffer, let stand for 10 seconds and then discard the liquid. Repeat 3 times, keeping the last washing buffer.

[0037] 2. Probe hybridization 1) Prepare a 50 μL reaction solution in a 1.5 mL centrifuge tube: nuclease-free water (15 μL), Hyb Buffer 1 (vortex centrifugation, 25 μL), PG (fully thawed and vortex centrifugation, 5 μL), FISH Probe-Hsa-EBER 1 (fully thawed and vortex centrifugation, 2.5 μL, concentration 250 μM), and FISH Probe-Hsa-EBER 2 (fully thawed and vortex centrifugation, 2.5 μL, concentration 250 μM). 2) Vortex mix and centrifuge; aspirate the liquid from the hydrophobic zone, immediately add the reaction solution, place in a humidified box (tightly cover the box), and hybridize in a 42℃ constant temperature incubator for 4 hours; 3) After the reaction is complete, aspirate the liquid from the hydrophobic zone, immediately add 50 μL of washing buffer, let stand for 10 seconds and then discard the liquid. Wash a total of 3 times, retaining the last washing buffer.

[0038] 3. Washing after hybridization 1) Vortex and centrifuge the Hyb washing buffer, aspirate the liquid in the hydrophobic zone, immediately add 50 μL of Hyb washing buffer, place in a humidified box (cover, but do not tighten), and incubate in a 42°C incubator for 5 min. Repeat the washing process 3 times. 2) After the reaction is complete, aspirate the liquid in the hydrophobic zone, immediately add 50 μL of washing buffer, let stand for 10 seconds and then discard the liquid. Wash a total of 3 times, and retain the last washing buffer.

[0039] 4. Probe ring formation 1) Prepare a 50 μL reaction solution in a 1.5 mL centrifuge tube: nuclease-free water (12.5 μL), B1 (25 μL after vortexing and centrifugation after complete thawing), PG (5 μL after vortexing and centrifugation after complete thawing), ST (2.5 μL after vortexing and centrifugation after complete thawing), and E1 (5 μL after flash centrifugation after complete thawing). 2) Vortex mix and centrifuge; immediately add the liquid from the hydrophobic zone to the reaction solution, place it in a humidified box (tightly cover the box), and react in a 42℃ constant temperature incubator for 0.5h; 3) After the reaction is complete, aspirate the liquid in the hydrophobic zone, immediately add 50 μL of washing buffer, let stand for 10 seconds and then discard the liquid. Wash a total of 3 times, retaining the last washing buffer.

[0040] 5. Rolling circle amplification 1) Prepare a 50 μL reaction solution in a 1.5 mL centrifuge tube: nuclease-free water (23 μL), B2 (fully thawed and centrifuged by vortexing, 25 μL), and E2 (fully thawed and centrifuged by flash, 2 μL). 2) Vortex mix and centrifuge; immediately add the liquid from the hydrophobic zone to the reaction solution, place it in a humidified box (tightly cover the box), and react in a 42℃ constant temperature incubator for 2 hours; 3) After the reaction is complete, aspirate the liquid in the hydrophobic zone, immediately add 50 μL of washing buffer, let stand for 10 seconds and then discard the liquid. Wash a total of 3 times, retaining the last washing buffer.

[0041] This point can be used as a pause point for this experiment. With the washing buffer retained in the hydrophobic zone, the slides can be placed in a humidified box (with the lid tightly closed) and stored at 4°C for about a week.

[0042] 6. Probe hybridization 1) Prepare a 50 μL reaction solution in a 1.5 mL centrifuge tube: nuclease-free water (22.5 μL), Hyb Buffer 2 (vortex centrifugation, 25 μL), FISH DP-AF488-EBER 1 / 2 (vortex centrifugation, 2.5 μL); 2) Vortex mix and centrifuge; immediately add the liquid from the hydrophobic zone to the reaction solution, place it in a humidified box (tightly cover the box), and react in a 42℃ constant temperature incubator for 0.5h; 3) After the reaction is complete, aspirate the liquid from the hydrophobic zone, immediately add 50 μL of washing buffer, let stand for 10 seconds, then discard the liquid. Repeat this washing process 3 times.

[0043] 7. Incubation with immunofluorescent antibodies 1) Block with 5% BSA blocking buffer for 2 hours at room temperature; 2) Remove the fluid from the tissue (do not rinse), then wipe around the slide with a paper towel; 3) Add the primary antibody diluted with TBS solution containing 1% BSA [recombinant Anti-CD3 antibody (1:200 dilution) or recombinant Anti-CD20 antibody (1:200 dilution) or recombinant Anti-CD56 antibody (1:100 dilution)], and incubate overnight at 4°C; 4) Wash the slide twice with gentle agitation in a TBS solution containing 0.025% Triton X-100 for 5 minutes each time; 5) Dilute the secondary antibody (fluorescent secondary antibody AF647 (i.e., goat anti-rabbit IgG H&L (Alexa Fluor® 647)) with TBS solution containing 1% BSA at a dilution factor of 1:500) and coat the enzyme-conjugated secondary antibody onto the slide and incubate at room temperature for 1 hour; 6) Clean with TBS solution 3 times, 5 minutes each time; 7) Mount the slide with an anti-fluorescence attenuation mounting medium (containing DAPI) and cover with a coverslip.

[0044] Example 3: Detection of NK / T-cell lymphoma patients using the method of Example 2 Patients with NK / T-cell lymphoma (diagnosed by immunohistochemistry and EBER in situ hybridization of pathological serial sections, combined with clinical phenotype) were used as subjects. Paraffin tissue sections of their ex vivo lymph nodes were examined using the method in Example 2, and CD3+ cells, CD20+ cells, and CD56+ cells were sorted.

[0045] like Figure 1 As shown, the results indicated that the CD3+, CD20+, and CD56+ cells of the NK / T-cell lymphoma patients were all positive for EBER, meaning that the CD3+, CD20+, and CD56+ cells were all infected with EB virus.

[0046] Example 4: Detection of PTLD patients using the method of Example 2 Patients with post-transplant lymphoproliferative disorders (PTLD) (diagnosed by immunohistochemistry and EBER in situ hybridization of serial pathological sections, combined with clinical phenotype) were used as subjects. Paraffin tissue sections of their ex vivo lymph nodes were examined using the method in Example 2, and CD3+ cells, CD20+ cells, and CD56+ cells were sorted.

[0047] like Figure 2 As shown, the results indicated that the CD3+, CD20+, and CD56+ cells of the PTLD patients were all positive for EBER, meaning that the CD3+, CD20+, and CD56+ cells were all infected with EB virus.

[0048] Example 5: Detection of EBV+DLBCL-NOS patients using the method of Example 2 Patients with EBV+DLBCL-NOS (diagnosed by immunohistochemistry and EBER in situ hybridization of pathological serial sections, combined with clinical phenotype) were used as subjects. Paraffin tissue sections of their ex vivo lymph nodes were examined using the method in Example 2, and CD3+ cells, CD20+ cells, and CD56+ cells were sorted.

[0049] like Figure 3 As shown, the results indicated that CD3+ cells in the EBV+DLBCL-NOS patients were EBER negative, CD20+ cells were EBER positive, and CD56- cells were negative. In other words, CD3+ cells were not infected with EBV, CD20+ cells were infected with EBV, and there were no CD56+ cells.

[0050] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A reagent for detecting EB virus infection, characterized in that: The reagent contains EBV probes FISH Probe-Hsa-EBER1 and FISH Probe-Hsa-EBER2, wherein FISH Probe-Hsa-EBER1 is the single-stranded DNA shown in SEQ ID No. 1, and FISH Probe-Hsa-EBER2 is the single-stranded DNA shown in SEQ ID No.

2.

2. The reagent according to claim 1, characterized in that: The reagent also contains CD3 antibody, CD20 antibody and / or CD56 antibody.

3. A kit for detecting EB virus infection, characterized in that: The kit contains the reagent as described in claim 1 or 2.

4. Any of the following applications of the reagent of claim 1 or 2 or the kit of claim 3: X1) Prepare products for identifying EB virus-infected cell lineages, or identify EB virus-infected cell lineages; X2) Prepare products that identify therapeutic targets for EB virus infection, or identify therapeutic targets for EB virus infection. X3) Guide the preparation of drugs for treating EB virus infection; X4) Prepare products for detecting EB virus infection samples, or test EB virus infection samples; X5) Prepare products for detecting EBV infection in multiple cell lineages in the same sample, or detect EBV infection in multiple cell lineages in the same sample; X6) Prepare products that can distinguish between different EB virus infection statuses in the same sample, or cell lines that can distinguish between different EB virus infection statuses in the same sample; X7) Prepare EB virus positive cell localization products for in vitro samples, or localize EB virus positive cells for in vitro samples.

5. A method for identifying EB virus cell lineage infection, characterized in that: The method includes: (a) Preparation of tissue sections from ex vivo samples of the subject; (b) Use EBV probes to perform hybridization to determine EBV-infected tissues or cells; (c) Marking tissue sections with markers of different cell lineages to obtain different cell lineages; (d) Analyze the cell lineages of EB virus infection to obtain the cell lineages of EB virus infection.

6. The method according to claim 5, characterized in that: The cell lineage is a subpopulation of cells that are positive for a single antibody or a combination of multiple antibodies, including CD3 antibody, CD20 antibody, and CD56 antibody.

7. The method according to claim 5 or 6, characterized in that: In step (c), labeling tissue sections with markers of different cell lineages includes: incubating tissue sections with antibodies against markers of different cell lineages, and then incubating with secondary antibodies labeled with fluorescent dyes to complete the labeling of tissue sections with markers of different cell lineages.

8. The use of the method according to any one of claims 5-7 in identifying therapeutic targets for EB virus infection, or in guiding the preparation of medicaments for treating EB virus infection.

9. An apparatus for detecting EB virus-infected cell lineages, characterized in that: The device includes a preprocessing module, an EB virus detection module, a cell sorting module, and an analysis module. The preprocessing module is used to prepare tissue sections of the subject's ex vivo samples; The EB virus detection module is used for EB virus detection in tissue sections; The cell sorting module is used to label samples tested for EB virus with markers of different cell lineages. The analysis module determines the cell lineage of EB virus infection based on the results of the EB virus detection module and the cell sorting module.

10. The apparatus according to claim 9, characterized in that: The cell lineage is a subpopulation of cells that are positive for a single antibody or a combination of multiple antibodies, including CD3 antibody, CD20 antibody, and CD56 antibody. The detection of the EB virus is performed using the reagent described in claim 1.

Images