A method for creating herbicide-resistant rice by gene editing the promoter region of OsEPSPS gene

By editing the non-coding regulatory region of the rice OsEPSPS gene using the CRISPR/Cas12i3 system, a new rice germplasm with stable glyphosate resistance was created, solving the problems of lack of resistance genes and insufficient resistance in existing technologies, and simplifying weed management in paddy fields and improving production efficiency.

CN121538265BActive Publication Date: 2026-04-21SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610066496.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-19
Publication Date
2026-04-21
Estimated Expiration
2046-01-19

AI Technical Summary

Technical Problem

Existing technologies for creating glyphosate-resistant rice suffer from problems such as a lack of heterologous resistance genes and poor resistance after mutation of endogenous resistance genes. Furthermore, chemical control methods are cumbersome and costly, making it difficult to simplify and improve the efficiency of weed management in paddy fields.

Method used

By using the CRISPR/Cas12i3 system to perform targeted editing of the non-coding regulatory region of the rice OsEPSPS gene, OsEPSPS gene mutants were created. By introducing WT/-29bp monoallelic deletion or -29bp/-29bp homozygous deletion mutations into the promoter region, new rice germplasm with stable resistance to glyphosate was obtained.

Benefits of technology

This technology enables stable resistance and normal growth of rice to glyphosate without altering the protein sequence, providing a safe and efficient herbicide-resistant rice variety. It also offers a simplified technical solution for weed management in paddy fields, thereby improving production efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121538265B_ABST
    Figure CN121538265B_ABST
Patent Text Reader

Abstract

This invention relates to the field of gene editing technology, specifically providing a method for creating herbicide-resistant rice by gene editing the promoter region of the OsEPSPS gene. The method involves introducing a WT / -29bp monoallelic deletion mutation into the OsEPSPS gene promoter region. Specifically, with position A of the OsEPSPS gene start codon ATG set to 0, a 29bp deletion is made in one allele located at positions 1122 to 1150 upstream of the start codon ATG, while the other allele remains unchanged. This invention demonstrates that by introducing this monoallelic deletion mutation, rice can acquire resistance to EPSPS inhibitor herbicides. This resistance was identified in the T0 generation plants carrying this mutation and can be stably inherited by their offspring, possessing significant application value for ensuring agricultural production safety and improving herbicide application efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant gene editing and crop molecular breeding, and relates to a method for creating herbicide-resistant rice by gene editing the promoter region of the OsEPSPS gene. Background Technology

[0002] Weed infestation is a significant factor affecting rice yield and quality, especially in direct-seeded rice cultivation. Given the current reduction in agricultural labor (manual weeding) and the underdeveloped state of mechanized weeding, chemical control remains a relatively economical and effective method. Non-selective herbicides are lethal to all green plants and are easy to apply, but improper use can easily damage the rice itself. Selective herbicides, while effective against specific weeds, require precise timing and application methods, making them cumbersome and costly. Therefore, breeding non-selective herbicide-resistant rice varieties will help improve the effectiveness of chemical weed control in paddy fields, simplify control measures, and ultimately increase rice yield and quality.

[0003] Glyphosate, a broad-spectrum, low-toxicity, and contact herbicide, is widely used for weed control in agricultural production. Glyphosate-resistant transgenic crops are also the most important trait among current transgenic crops. Glyphosate specifically binds to and inhibits the activity of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), a key enzyme in the shikimic acid pathway, thereby blocking the synthesis of aromatic amino acids, hindering protein synthesis, inhibiting growth and development, and ultimately leading to plant death. Currently, there are two main methods for creating glyphosate-resistant crops: one is to express glyphosate-resistant EPSPS derived from microorganisms in the crop to obtain glyphosate-resistant transgenic crops; however, the application of transgenic crops requires rigorous and complex safety evaluations and approvals. The other method is to refer to the EPSPS protein resistance variants (P171S, TIPS, etc.) of glyphosate-resistant weeds and use gene editing technology to modify the endogenous... EPSPS Precise editing of gene coding regions has yielded glyphosate-resistant gene-edited crops, but alterations to protein sequences and functions negatively impact crop growth and development. Currently, the creation of glyphosate-resistant crops still faces challenges such as a lack of heterologous resistance genes and poor resistance after mutations in endogenous resistance genes. Exploring more glyphosate-resistant gene resources is of paramount importance for breeding glyphosate-resistant crops.

[0004] This study, based on the CRISPR / Cas12i3 gene editing system, targeted the non-coding regulatory region of the rice OsEPSPS gene to screen and identify new rice germplasm with stable resistance to EPSPS inhibitor herbicides. This research not only expands the avenues for creating herbicide-resistant rice but also provides important references for non-coding region functional studies and precision molecular breeding. Summary of the Invention

[0005] The purpose of this invention is to create new rice germplasm that is resistant to glyphosate and whose growth and development are not affected by editing the non-coding regulatory region of the endogenous OsEPSPS gene in rice using the CRISPR / Cas12i3 system. This provides a new technical solution and gene resource for developing safe and efficient herbicide-resistant rice varieties, and ultimately simplifies and reduces costs and increases efficiency in rice paddy weed management.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] In a first aspect, the present invention provides an OsEPSPS gene mutant, wherein the mutation type of the OsEPSPS gene mutant is any one of the following:

[0008] 1) Introduce a single allelic deletion mutation of WT / -29bp into the promoter region of the OsEPSPS gene, that is, with A in the start codon ATG of the OsEPSPS gene as position 0, delete 29bp from position 1122 to 1150 upstream of the start codon ATG in one allele, while the other allele remains unchanged.

[0009] 2) Introduce a homozygous deletion mutation of -29bp / -29bp into the promoter region of the OsEPSPS gene, that is, with A in the start codon ATG of the OsEPSPS gene as position 0, delete 29bp from position 1122 to 1150 downstream of the start codon ATG, and this deletion mutation occurs in both alleles.

[0010] The nucleotide sequence of the OsEPSPS gene is shown in SEQ ID NO.5.

[0011] In a second aspect, the present invention provides the application of the above-mentioned OsEPSPS gene mutant in rice EPSPS inhibitor herbicides.

[0012] In a third aspect, the present invention provides a method for making rice resistant to EPSPS inhibitor herbicides. The method involves introducing the aforementioned WT / -29bp monoallelic deletion mutation into the promoter region of the OsEPSPS gene in the rice genome using gene editing technology, thereby obtaining rice resistant to EPSPS inhibitor herbicides.

[0013] In the above method, the gene editing is achieved through the CRISPR / Cas12i3 system, specifically including the following steps:

[0014] Step 1: Obtain the pHZLib-Cas12i3 vector;

[0015] Step 2: Obtain the crRNA sequence or target sequence for gene editing, wherein the crRNA sequence is shown in SEQ ID NO. 6; and the target sequence is located at positions 34 to 56 of the sequence shown in SEQ ID NO. 6.

[0016] Step 3: The crRNA sequence is cloned into the pHZLib-Cas12i3 vector to obtain pHZLib-Cas12i3-crRNA;

[0017] Step 4: pHZLib-Cas12i3-crRNA was transformed into Agrobacterium and used to infect rice callus tissue to screen for rice lines resistant to EPSPS inhibitor herbicides.

[0018] In one specific embodiment, the herbicide is glyphosate.

[0019] In one specific embodiment, the rice variety is Nanjing 46.

[0020] The beneficial effects of this invention are:

[0021] This invention aims to provide an innovative gene-editing breeding strategy. By using the CRISPR / Cas12i3 system to precisely edit the promoter region of the rice's OsEPSPS gene, a new rice germplasm with stable resistance to EPSPS inhibitor herbicides such as glyphosate and normal growth and development can be created without introducing exogenous genes or altering its protein sequence. This provides a new technical solution and genetic resource for developing safe and efficient herbicide-resistant rice varieties, ultimately simplifying weed management in paddy fields and improving production efficiency. Attached Figure Description

[0022] Figure 1 A schematic diagram of the main components of the knockout vector pHZLib-Cas12i3 and the editing vector library pHZLib-Cas12i3-crRNA(Pool02) after inserting crRNA into the CRISPR / Cas12i3 system.

[0023] Figure 2 A schematic diagram of the target sites for the non-coding region regulatory elements of rice OsEPSPS.

[0024] Figure 3Sanger sequencing was used to identify allele variation types in the selected resistant plant E2-#1 and the resistance phenotype of the T1 generation plants after glyphosate addition.

[0025] Figure 4 The resistance phenotypes of E2-#1-29 T2 generation plants and wild-type control (CK) after glyphosate application. Detailed Implementation

[0026] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0027] Unless otherwise specified, the strains, plasmids, and reagents used in the embodiments of this invention can all be purchased commercially.

[0028] Example 1 Construction of pHZLib-Cas12i3 recombinant plasmid

[0029] Using plasmid pHZLib2 (containing the ccdB gene, CN2017112944154) as a template, and ccdB-F1 (as shown in SEQ ID NO.1) and ccdB-R1 (as shown in SEQ ID NO.2) as primers, PCR amplification was performed using high-fidelity enzyme I-5™2×High-FidelityMasterMix (purchased from Kronin (Beijing) Biotechnology Co., Ltd.). The PCR fragment was recovered, which was an 809 bp ccdB gene fragment. Using plasmid pHZ33 (CN2024117722206) as a template, and phz33-outer-F (as shown in SEQ ID NO.3) and phz33-outer-R (as shown in SEQ ID NO.4) as primers, PCR amplification was performed using high-fidelity enzyme I-5™2×High-FidelityMasterMix (purchased from Kronin (Beijing) Biotechnology Co., Ltd.). The PCR fragment was recovered, which was a linearized vector backbone fragment of approximately 2.8 kb. The ccdB gene fragment was infused with a linearized vector backbone fragment using the ClonExpress® II One Step Cloning Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.) to obtain the vector pHZ33-ccdB. In pHZ33-ccdB, the DR-crRNA-BsaI-BsaI-DR element in pHZ33 was replaced with the suicide gene ccdB.

[0030] pHZ33-ccdB was linearized by digestion with Nhe I, and then cloned into pUbi-IEE-Cas12i3 (CN2024117722206) via Gateway's LR reaction to obtain pHZLib-Cas12i3. A schematic diagram of the main components of its plasmid is shown below. Figure 1 As shown.

[0031] Example 2: Construction of a plasmid library for the OsEPSPS gene

[0032] Based on the OsEPSPS sequence (accession number LOC_Os06g04280, rice variety Nipponbare) in the rice genome database (http: / / rice.plantbiology.msu.edu / ), the OsEPSPS gene and its upstream and downstream nucleic acid sequences (SEQ ID NO.5) were amplified and sequenced from the genome extract of Nanjing 46. The bases from positions 1 to 3049 at the 5' to 3' ends constitute the OsEPSPS promoter region; positions 3050 to 3131 constitute the 5' UTR of OsEPSPS; and positions 3132 to 3455, 4160 to 4404, 4486 to 4639, 4917 to 5131, 5225 to 5342, 5559 to 5769, 6007 to 6068, and 6180 to 6398 constitute the protein-coding region of the OsEPSPS gene. Among them, positions 3132 to 3134 are the start codon (ATG), positions 3456 to 4159, 4405 to 4486, 4640 to 4916, 5132 to 5224, 5343 to 5558, 5770 to 6006, and 6069 to 6179 are introns, positions 6399 to 6654 are exons of the OsEPSPS gene, and positions 4579 to 4920 are the 3'UTR of OsEPSPS.

[0033] Gene editing of the non-coding regions (promoter, 5'UTR, intron, and 3'UTR) of the OsEPSPS gene is divided into 8 libraries (Pool06 covers as SEQ ID NO). The sequence shown in SEQ ID NO. 5 contains bases 1 to 298, Pool05 covers bases 299 to 818, Pool04 covers bases 819 to 1367, Pool03 covers bases 1368 to 1967, Pool02 covers bases 1968 to 2532, Pool01 covers bases 2533 to 3131, Pool07 covers the 3'UTR region of the OsESPS gene, and Pool08 covers the first intron region of the OsEPSPS gene. A total of 177 oligonucleotide sequences were synthesized and divided into 8 libraries. Each library contains 12 to 39 crRNA oligonucleotide sequences (including the target sequence, conserved repeat sequences in the CRISPR / Cas12i system guide RNA located at both ends of the target sequence, and further sequences flanking the conserved repeat sequences to facilitate PCR amplification). The position of the target sequence as shown in SEQ ID NO. 5 is shown below. Figure 2 The sequence of the sixth oligonucleotide OsEPSPS-Pool02-crRNA6 in Pool02 is shown in SEQ ID NO.6.

[0034] Using an equal volume and concentration of each crRNA oligonucleotide sequence from each library as a template, PCR amplification was performed using Array-F1 (SEQ ID NO.7: CAGACGCCACACCAATCCAGCTGGTGAGAGAATGT) and Array-R1 (SEQ ID NO.8: GCAGAATTGCCCTTCGAAGGGACAAAAAAAaGTGTGACTAT) as primers with I-5™ 2×High-Fidelity Master Mix. The PCR products were recovered to obtain the crRNA of the OsEPSPS gene in each library. The vector pHZLib-Cas12i3 was digested with Bsa I, and approximately 15.8 kb of the vector backbone was recovered (releasing the ccdB gene fragment). Using 2×MultiF Seamless Assembly Mix, the crRNA of the OsEPSPS gene from each library was cloned into a 15.8kb vector backbone (i.e., the ccdB gene in the pHZLib-Cas12i3 vector was replaced with the crRNA of the OsHPPD gene in each library), and named pHZLib-Cas12i3-crRNA(Pool01), pHZLib-Cas12i3-crRNA(Pool02), pHZLib-Cas12i3-crRNA(Pool03), pHZLib-Cas12i3-crRNA(Pool04), pHZLib-Cas12i3-crRNA(Pool05), pHZLib-Cas12i3-crRNA(Pool06), pHZLib-Cas12i3-crRNA(Pool07), and pHZLib-Cas12i3-crRNA(Pool08). A schematic diagram of the main elements in the plasmid is shown below. Figure 1 As shown in the figure. Twenty colonies were randomly selected from each library for sequencing, with a 100% accuracy rate.

[0035] Example 3: Rice transformation and glyphosate resistance screening using pHZLib-Cas12i3-crRNA (Pool01) to pHZLib-Cas12i3-crRNA (Pool08) plasmid library

[0036] 1) Rice callus induction:

[0037] Treat the hulled, mature rice seeds with a 50% commercial disinfectant solution for 30 minutes; rinse 3-5 times with sterile water, then transfer the seeds to sterile petri dishes and remove excess water; place the seeds on MSD plates (4.43 g / L MS powder; 30 g / L sucrose; 2 ml / L 2,4-D; 8 g / L plant gel; pH 5.7) and culture in a light-controlled environment for 10 days to induce callus formation; remove the embryo and bud from the seeds, transfer the callus to a new MSD petri dish, and culture for 4 days until it is ready for Agrobacterium transformation.

[0038] 2) Agrobacterium-mediated transformation:

[0039] The pHZLib-Cas12i3-crRNA (Pool01) to pHZLib-Cas12i3-crRNA (Pool08) plasmid library was transformed into Agrobacterium strain EHA105 by electroporation, constructing eight EHA105 strain libraries containing all the above crRNA plasmid libraries. After eluting the eight Agrobacterium libraries with sterile water to achieve an OD600 between 1 and 2, the Agrobacterium bacteria from each library were collected by centrifugation and resuspended in MSD solution to achieve an OD600 of 0.2, obtaining the bacterial suspension for each library.

[0040] 3) Infection of rice callus by Agrobacterium:

[0041] Place the callus tissue in the suspension of each of the above 8 bacterial libraries for 30 minutes; remove the Agrobacterium suspension, transfer the callus tissue to sterile absorbent paper to remove excess Agrobacterium suspension, and then transfer the callus tissue to a new MSD medium containing 100 µM acetylsuccinone and incubate at room temperature in the dark for 2-3 days.

[0042] 4) Screening for resistant callus in rice:

[0043] After dark culture, the callus tissue was transferred to MSD medium (100 mg / L termethin; 50 mg / L hygromycin B) and cultured for 2 weeks to 2 months until resistant callus appeared on the surface of the callus tissue; the medium was changed every 2 weeks.

[0044] 5) Screening of glyphosate-resistant callus in rice and obtaining regenerated plants

[0045] Resistant callus was transferred to regeneration medium (4.43 g / L MS powder; 30 g / L sucrose; 25 g / L sorbitol; 0.5 mg / L NAA; 3 mg / L BA; 100 mg / L termethin; 50 mg / L hygromycin B; 12 g / L agar powder; pH=5.7). After 7-10 days, it was transferred to regeneration medium supplemented with 30 mg / mL glyphosate. Glyphosate-resistant rice callus was screened and transferred every 7-10 days until seedlings were formed. Seedlings were then transferred to 1 / 2 MS medium (2.21 g / L MS powder; 15 g / L sucrose; 8 g / L plant gel; pH 5.7) to root. T0 generation rice plants were obtained. The obtained T0 generation rice plants were grown in a greenhouse until self-pollination and T0 generation seeds were harvested.

[0046] 6) Screening of T1 generation glyphosate-resistant rice

[0047] Seeds from the selected T0 generation plants and wild-type controls were treated with 50% commercial disinfectant for 30 minutes; washed 3-5 times with sterile water, and then sown on 1 / 2 MS medium containing 5 mg / L glyphosate to screen for glyphosate-resistant T1 generation mutant lines. The plants were cultured in a light-controlled chamber for 10 days, and the germination and growth of seeds were observed. The resistant T1 generation (plants capable of germination and growth) were sequenced. The corresponding T0 generation lines of the obtained glyphosate-resistant T1 generation rice lines were identified. Compared to wild-type materials that germinated but could not grow on 1 / 2 MS medium (containing 5 mg / L glyphosate), E2-#1 seeds not only germinated on 1 / 2 MS medium (containing 5 mg / L glyphosate), but some seeds also grew. Figure 3 The results showed that the glyphosate-resistant rice line originated from Pool02, with the line number E2-#1. The E2-#1 line was obtained by editing OsEPSPS-Pool02-crRNA6.

[0048] Example 4: Molecular identification of glyphosate-resistant rice OsEPSPS mutant

[0049] 1) Extraction of genomic DNA

[0050] Approximately 0.1 g of leaves from glyphosate-resistant rice plants (T0 and T1 generations) were cut, flash-frozen in liquid nitrogen, and then ground using a grinder. 600 μl of 2× cetyltrimethylammonium bromide (CTAB) DNA extraction buffer (containing 1 / 1000 β-mercaptoethanol) was added, and the mixture was vortexed and incubated at 65°C for 45 min. 500 μL of chloroform was added, and the mixture was vigorously shaken to form an emulsion. The emulsion was centrifuged at 14000 rpm for 10 min. The supernatant was transferred to a 1.5 ml centrifuge tube, and an equal volume of isopropanol was added. The mixture was inverted and centrifuged at 14000 rpm for 10 min. The supernatant was discarded, and the white precipitate was washed with 700 μl of 70% ethanol. The tube was centrifuged at 14000 rpm for 5 min, and the supernatant was discarded. The tube was then air-dried in a fume hood for 10 min. 30 μl of ddH2O was added to dissolve the DNA. The DNA solution was stored at -20°C for later use.

[0051] 2) PCR amplification and sequencing detection of the crRNA sequence of the resistance material

[0052] Universal primers for amplifying the crRNA sequence of E2-#1 were designed: U6p-F1 (SEQ ID NO.9: AAGAACGAACTAAGCCGGAC) and pENTR4-R1 (SEQ ID NO.10: AGAATTGCCCTTCGAAGGGAC). Phanta Max Super-Fidelity DNA Polymerase (purchased from Nanjing Novizan Biotechnology Co., Ltd.) was used to perform PCR amplification on the T0 generation of E2-#1 plants screened on herbicide-treated medium, and the PCR products were directly sequenced by Sanger sequencing.

[0053] Sanger sequencing results showed that the crRNA sequence of E2-#1 was OsEPSPS-Pool02-crRNA6 from Pool02 (SEQ ID NO. 6: GGCTGGTGCAAGAGAATGTGTGCATAGTCACAC). ATTCCAGTGGCGTGGTACGTAGG AGAGAATGTGTGCATAGTCACACTTTTTTTTGT, the underlined part is the target nucleotide sequence of OsEPSPS-Pool02-crRNA6.

[0054] 3) PCR amplification and sequencing detection of mutation sites

[0055] Specific amplification primers OsEPSPS-F1 (SEQ ID NO.11: GCCACACCAATCCAGCTGGTG) and OsEPSPS-R1 (SEQ ID NO.12: CACGGCCTGGTCCAGGGACAC) were designed for E2-#1. PCR amplification was performed on T0 and T1 generation plants of E2-#1 using Phanta Max Super-Fidelity DNA Polymerase (purchased from Nanjing Novizan Biotechnology Co., Ltd.), and the PCR products were directly subjected to Sanger sequencing. Sanger sequencing results showed:

[0056] Sanger sequencing results from generation T0 of E2-#1, compared with wild-type results, showed that E2-#1 contained a deletion mutation. Specifically, it had a single allelic deletion mutation of WT / -29bp. OsEPSPS The A in the gene start codon ATG is at position 0, and a 29bp deletion occurs between positions 1122 and 1150 upstream of it. (See the results below.) Figure 3 In glyphosate-resistant T1 generation plants, the homozygous deletion mutation E2-#1-29 with -29bp / -29bp located 1122 to 1150 upstream of the start codon and the monoallelic deletion mutation E2-#1-WT / -29 with WT / -29bp located 1122 to 1150 upstream of the start codon were detected.

[0057] Example 5: Glyphosate spraying test on resistant mutant lines

[0058] The agricultural commercial herbicide Zhongbao glyphosate (active ingredient: 41% glyphosate isopropylammonium salt solution, purchased from Beijing Zhongbao Green Agriculture Technology Group Co., Ltd.) was diluted with tap water to obtain a glyphosate spray solution. The concentration of this glyphosate spray solution was four times the recommended field application dose. Seeds of the T1 generation homozygous mutant plant E2-#1-29 were sown in nutrient pots to obtain the corresponding T2 generation plants. Wild-type rice was sown simultaneously as a negative control. When the rice plants grew to 2-3 leaves in the greenhouse, the glyphosate spray solution was sprayed using a mobile sprayer. The plants were then continued to be cultivated in the greenhouse. The growth of the T2 generation plants was observed after 14 days. Figure 4 The results showed that wild-type negative control rice seedlings withered and died under the action of glyphosate, while the T2 generation plants of E2-#1-29 all showed normal growth and green plants, exhibiting glyphosate resistance. Therefore, this indicates that editing (disruption) of this regulatory region sequence led to the development of glyphosate resistance in rice.

Claims

1. The application of the OsEPSPS gene mutant in rice resistant to the EPSPS inhibitor herbicide glyphosate, characterized in that, The mutation type of the OsEPSPS gene mutant is as follows: a WT / -29bp single allelic deletion mutation is introduced into the promoter region of the OsEPSPS gene, that is, with A in the start codon ATG of the OsEPSPS gene set to position 0, 29bp is deleted from position 1122 to 1150 upstream of the start codon ATG in one allele, while the other allele remains unchanged; the nucleotide sequence of the OsEPSPS gene is shown in SEQ ID NO.5; the rice variety is Nanjing 46.

2. A method for making rice resistant to the EPSPS inhibitor herbicide glyphosate, characterized in that, By introducing the WT / -29bp monoallelic deletion mutation as described in claim 1 into the promoter region of the OsEPSPS gene in the rice genome using gene editing technology, rice resistant to glyphosate, an EPSPS inhibitor herbicide, is obtained; the rice variety is Nanjing 46.

3. The method according to claim 2, characterized in that, The gene editing was performed using the CRISPR / Cas12i3 system.

4. The method according to claim 3, characterized in that, The method includes the following steps: Step 1: Obtain the pHZLib-Cas12i3 vector; the pHZLib-Cas12i3 vector is constructed by the following operations: replacing the DR-crRNA-BsaI-BsaI-DR element in pHZ33 with the suicide gene ccdB to obtain the pHZ33-ccdB vector; integrating pHZ33-ccdB with pUbi-IEE-Cas12i3 into a single vector to obtain the pHZLib-Cas12i3 vector; Step 2: Obtain the crRNA sequence for gene editing, as shown in SEQ ID NO. 6; Step 3: Replace the ccdB gene on the pHZLib-Cas12i3 vector with the crRNA, thereby cloning the crRNA sequence into the pHZLib-Cas12i3 vector to obtain pHZLib-Cas12i3-crRNA; Step 4: pHZLib-Cas12i3-crRNA was transformed into Agrobacterium and used to infect rice callus tissue to screen for rice lines resistant to the EPSPS inhibitor herbicide glyphosate.

Citation Information

Patent Citations

  • Rice herbicide-resistant OsEPSPS mutant gene, protein and application thereof

    CN119491007A

  • Deleted mutant nucleic acid and application thereof in herbicide resistance

    CN120966899A