Penicillium for biological control of plant diseases and application thereof

Abstract

The present application relates to a kind of penicillium for plant disease biological control and its application.The present application is obtained by research and screening a new biocontrol agent Penicillium brefeldianum 54-13, the fermentation product thereof can effectively activate the immune induction level of plant, improve the disease resistance of plant caused by wheat powdery mildew, wheat scab and rice blast fungus, including wheat powdery mildew, wheat scab and rice blast fungus etc., provide a safe and environmentally friendly disease control strategy for the sustainable development of wheat and rice.

Description

Technical Field

[0001] This invention belongs to the field of agricultural science and technology, specifically relating to a Penicillium fungus used for the biological control of plant diseases and its application. Background Technology

[0002] Wheat (Triticum aestivum L.), one of the world's three major staple crops, feeds about 40% of the global population and is an important source of energy and protein for humankind. However, wheat has a long growth cycle (190-210 days), and its susceptibility throughout its entire growth period makes it vulnerable to diseases, especially fungal diseases, which are the most serious and lead to damage to its yield and quality.

[0003] Wheat powdery mildew is caused by the parasitic fungus *Blumeria graminis*, a member of the Poaceae family. It is a typical airborne fungal disease that is prevalent in almost all wheat-growing areas. Wheat powdery mildew can occur throughout the entire wheat growth cycle, primarily affecting the upper and lower surfaces of leaves, forming colonies that cover the surface. In severe cases, it can also infect other parts such as the stem and ear, causing the entire plant to loom and die, ultimately impacting wheat yield.

[0004] Fusarium head blight, a fungal plant disease caused by Fusarium graminearum, is widely distributed globally. It not only reduces wheat yield but also severely impacts wheat quality and feed value. In the early stages of Fusarium graminearum infection, affected plants develop water-soaked spots on their leaves, which subsequently expand into brown or reddish-brown streaks. When the ear is affected, the glumes of the spikelets turn red, the grains shrivel, and the entire ear may even die, leading to yield losses of over 30%, and in extreme cases, up to 80%. Furthermore, the pathogen Fusarium graminearum produces mycotoxins such as deoxynivalenol, posing a significant threat to human and animal health.

[0005] Rice (Oryza sativa L.) is a staple crop for more than half of the world's population and is one of the world's most important food crops. However, rice blast, caused by Magnaporthe oryzae, is the most destructive fungal disease in rice production. Rice blast can infect plants at all stages of rice growth, damaging leaves, stems, nodes, panicles, and seeds. Severe cases can lead to the death of the entire plant, resulting in a significant decrease in rice yield and quality.

[0006] Currently, chemical pesticides remain the main means of controlling fungal diseases such as wheat powdery mildew, wheat scab, and rice blast. Although they can be effective quickly, long-term use will exacerbate the resistance of pathogens and bring environmental pollution risks.

[0007] Therefore, providing biocontrol strains that can effectively inhibit diseases of wheat and rice caused by fungal pathogens can provide a safe and environmentally friendly control strategy for the sustainable development of wheat and rice. Summary of the Invention

[0008] To address the aforementioned problems, this invention discloses a Penicillium fungus for the biological control of plant diseases and its applications.

[0009] In a first aspect, the present invention provides a Penicillium brefeldianum 54-13, the preservation number of which is CGMCCNO.41138.

[0010] This strain was deposited on April 2, 2024, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO.41138, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0011] In some embodiments, the Penicillium breve ( Penicillium brefeldianum The nucleotide sequences of the ITS gene (54-13) are shown in SEQ ID NO.1, the nucleotide sequences of the β-tubulin gene are shown in SEQ ID NO.2, and the nucleotide sequences of the Calmodulin gene are shown in SEQ ID NO.3.

[0012] In a second aspect, the present invention provides a fermentation product obtained by fermentation culture of Penicillium brefeldianum 54-13 as described above.

[0013] In some embodiments, the fermentation product is a freeze-dried fermentation broth powder.

[0014] A third aspect of the present invention provides a method for preparing the fermentation product as described above, comprising the following steps: inoculating Penicillium brefeldianum 54-13 as described above into a fermentation medium for culture, obtaining a fermentation broth, filtering, and thus obtaining the product.

[0015] In some embodiments, the fermentation medium is corn culture medium.

[0016] In some embodiments, the culture temperature is 24°C to 28°C, and the time is 6 to 8 days.

[0017] In some embodiments, the culture is an oscillating culture.

[0018] In some embodiments, the rotation speed of the oscillation culture is 160 rpm to 180 rpm.

[0019] In some embodiments, the preparation method further includes freeze-drying the filtered fermentation broth to obtain freeze-dried fermentation broth powder.

[0020] A fourth aspect of the invention provides Penicillium brefeldianum 54-13 or its secondary metabolites as described above, wherein the fermentation product has any of the following applications:

[0021] (a1) Prevention and control of plant diseases caused by wheat powdery mildew fungus;

[0022] (a2) Prevention and control of plant diseases caused by Fusarium graminearum;

[0023] (a3) Control of plant diseases caused by rice blast fungus.

[0024] In some implementations, the plant disease caused by wheat powdery mildew fungus is wheat powdery mildew.

[0025] In some implementations, the plant disease caused by Fusarium graminearum is called Fusarium graminearum.

[0026] In some implementations, the plant disease caused by rice blast fungus is rice blast.

[0027] A fifth aspect of the present invention provides a biological agent, the active ingredient of which comprises at least one of Penicillium brefeldianum 54-13 or its secondary metabolites as described above, and the fermentation product.

[0028] In some embodiments, the active ingredient of the biopharmaceutical includes the fermentation product.

[0029] In some embodiments, the fermentation product is a freeze-dried fermentation broth powder.

[0030] A sixth aspect of the present invention provides a method for preventing and controlling plant diseases, comprising the following steps: spraying plants with the biological agent described above.

[0031] In some embodiments, the active ingredient of the biological agent comprises fermentation products.

[0032] In some embodiments, the fermentation product is a freeze-dried fermentation broth powder.

[0033] In some embodiments, the plant includes wheat and rice.

[0034] The beneficial effects of this invention are:

[0035] This invention has obtained a new biocontrol fungus, Penicillium brefeldianum 54-13, through research and screening. Its fermentation product can effectively activate the immune resistance level of plants and improve their resistance to plant diseases caused by wheat powdery mildew, wheat scab, and rice blast fungus, including wheat powdery mildew, wheat scab, and rice blast fungus. This provides a safe and environmentally friendly disease control strategy for the sustainable development of wheat and rice. Attached Figure Description

[0036] Figure 1 This is a diagram showing the results of the fermentation product of Penicillium brevis 54-13 promoting the release of reactive oxygen species in plant roots in Example 1.

[0037] Figure 2 The effect of Penicillium breve 54-13 fermentation product in Example 2 on wheat powdery mildew caused by Blumeriagraminis.

[0038] Figure 3 The effect of Penicillium breve 54-13 fermentation product in Example 2 on wheat scab caused by Fusarium graminearum.

[0039] Figure 4 The effect of Penicillium breve 54-13 fermentation product in Example 3 on rice blast disease caused by Magnaporothermae. Detailed Implementation

[0040] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0041] One embodiment of the present invention relates to a Penicillium brefeldianum 54-13, the preservation number of which is CGMCC NO.41138.

[0042] This strain was deposited on April 2, 2024, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO.41138, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0043] The fermentation product of Penicillium brefeldianum 54-13 of this invention can effectively activate the immune-induced resistance level of plants and improve their resistance to plant diseases caused by wheat powdery mildew, wheat scab, and rice blast fungus, including wheat powdery mildew, wheat scab, and rice blast fungus, providing a safe and environmentally friendly disease control strategy for the sustainable development of wheat and rice.

[0044] One embodiment of the present invention relates to a *Penicillium brefeldianum* 54-13, the nucleotide sequence of the ITS gene of said *Penicillium brefeldianum* 54-13 is shown in SEQ ID NO.1, the nucleotide sequence of the β-tubulin gene is shown in SEQ ID NO.2, and the nucleotide sequence of the Calmodulin gene is shown in SEQ ID NO.3.

[0045] One embodiment of the present invention relates to an engineered bacterium containing a nucleic acid fragment of Penicillium brefeldianum 54-13.

[0046] In some embodiments, the nucleic acid fragment includes nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, or nucleotide sequences with a similarity of more than 90%.

[0047] One embodiment of the present invention relates to a fermentation product obtained by fermentation culture of Penicillium brefeldianum 54-13 as described above and / or engineered bacteria as described above.

[0048] In some embodiments, the fermentation product is a freeze-dried fermentation broth powder.

[0049] In some embodiments, the method for preparing the fermentation product includes the following steps: inoculating Penicillium brefeldianum 54-13 and / or engineered bacteria as described above into a fermentation medium for culture, obtaining fermentation broth, and filtering to obtain the product.

[0050] In some embodiments, the fermentation medium is corn culture medium.

[0051] In some embodiments, the culture temperature is 24°C to 28°C, and the time is 6 to 8 days.

[0052] In some embodiments, the culture temperature is 24°C to 26°C, and the time is 6 to 8 days.

[0053] In some embodiments, the culture is an oscillating culture.

[0054] In some embodiments, the rotation speed of the oscillation culture is 160 rpm to 180 rpm.

[0055] In some embodiments, the rotation speed of the oscillation culture is 160 rpm to 170 rpm.

[0056] In some embodiments, the preparation method further includes freeze-drying the filtered fermentation broth to obtain freeze-dried fermentation broth powder.

[0057] One embodiment of the present invention relates to a biological agent, the active ingredient of which comprises at least one of Penicillium brefeldianum 54-13 or its secondary metabolites as described above, the engineered bacteria or its secondary metabolites, and the fermentation product.

[0058] In some embodiments, the active ingredient of the biopharmaceutical includes the fermentation product.

[0059] In some embodiments, the fermentation product is a freeze-dried fermentation broth powder.

[0060] One embodiment of the present invention relates to a method for preventing and controlling plant diseases, comprising the following steps: spraying plants with the biological agent described above.

[0061] In some embodiments, the plant includes wheat and rice.

[0062] In some embodiments, the active ingredient of the biological agent comprises fermentation products.

[0063] In some embodiments, the fermentation product is a freeze-dried fermentation broth powder.

[0064] In some embodiments, the lyophilized fermentation broth powder is dissolved in water to obtain an aqueous solution of the lyophilized fermentation broth powder, which is then sprayed.

[0065] In some embodiments, the concentration of the lyophilized fermentation broth aqueous solution is 5 mg / mL to 15 mg / mL.

[0066] In some embodiments, the concentration of the lyophilized fermentation broth aqueous solution is 8 mg / mL to 12 mg / mL.

[0067] In some implementations, the plant can be sprayed with the freeze-dried fermentation powder solution according to the actual growth of the plant during a plant growing cycle, for example, 1 to 3 times.

[0068] In some implementations, 1-2 L of the freeze-dried fermentation liquid is sprayed onto each area where 6,000-8,000 plants are planted.

[0069] Terminology Definition

[0070] As described in this invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can kill or suppress the number of pathogens to control the occurrence and development of plant diseases. These mainly include fungi.

[0071] As described in this invention, the term "wheat powdery mildew fungus" or "B. graminis" belongs to the genus Blumeria, a fungus belonging to the kingdom Fungi, phylum Ascomycota, class Leotiomycetes, order Erysiphales, family Erysiphaceae, and genus Blumeria.

[0072] The term "Fusarium graminearum" or "Fusarium graminearum" belongs to the genus Fusarium, which is a fungus belonging to the kingdom Fungi, phylum Deuteromycetes, class Deuteromycetes, order Moniliales, family Nectriaceae, and genus Fusarium.

[0073] The classification of the term "rice blast fungus (M. oryzae)" is as follows: fungus of the genus Pyricularia, belonging to the kingdom Fungi, subphylum Deuteromycotina, class Hyphomycetes, order Hyphomycetes, family Moniliaceae, and genus Pyricularia.

[0074] The following description is based on specific embodiments.

[0075] Example 1: Screening and resistance induction detection of Penicillium breve 54-13

[0076] 1. Isolation of biocontrol bacteria

[0077] Healthy soybean plants were selected from the field in Ma'anshan City, Anhui Province, and root tissue was collected as samples. Tissue blocks approximately 2 mm × 2 mm in size were cut from the soybean roots. The tissue blocks were then immersed in 75% ethanol for 30 seconds, followed by immersion in 2% sodium hypochlorite solution for 2 minutes, and then rinsed three times with sterile water. The surface moisture of the tissue blocks was blotted dry with sterile absorbent paper. Three to five tissue blocks were placed on each 7 cm diameter selective PDA plate containing 50 μg / mL rifampin and 50 μg / mL ampicillin. The plates were sealed and incubated at 26°C in the dark for 1 to 2 days. If colonies appeared on the tissue blocks, the mycelia were immediately transferred to new PDA plates for purification culture.

[0078] 2. Fermentation culture

[0079] The isolated fungi were inoculated into 9 cm diameter petri dishes containing 15 mL of PDA medium and cultured at 25 °C in the dark for 6–7 days until they filled the petri dishes. Different strains were then cut into 5 × 5 mm pieces and placed in corn culture medium (2 g corn extract powder, dissolved in an appropriate amount of deionized water by boiling, then diluted to 1 L with deionized water and sterilized at 121 °C for 15 min). Fermentation was carried out on a shaker at 25 °C and 160 rpm for 7 days. Subsequently, the fermentation broth was filtered through gauze to remove the mycelium, and then freeze-dried to obtain freeze-dried fermentation broth powder.

[0080] 3. Screening for Penicillium breve 54-13 enhances the immune-inducing ability of plant roots.

[0081] Plant seedling roots grown at 25℃ in the dark for 4 days were cut into 5mm segments and placed in 96-well plates. Two root segments were placed in each well and 200µL of sterile water was added. The plates were then placed in a 25℃ incubator in the dark for 30 minutes. After removing the sterile water, 200µL of reactive oxygen species (ROS) assay system was added and the plates were quickly placed in an ELISA reader for ROS detection.

[0082] The reactive oxygen species reaction system includes horseradish peroxidase (HRP, final concentration 10 µg / mL), enhanced luminol (final concentration 10 µg / mL), 2 µL of fermentation broth from different fungi (the fermentation broth was lyophilized into an aqueous solution at a concentration of 1 mg / mL), and sterile water.

[0083] like Figure 1 As shown, compared to the control group (CK), the ROS content in the roots of plants treated with Penicillium brevis 54-13 fermentation broth increased rapidly, reaching 2000 RLU at 5 min and maintaining a strong ROS emission capacity until 30 min, indicating a strong immune-inducing ability in the plant roots. These results suggest that the fermentation product of Penicillium brevis 54-13 can activate the immune-inducing level of plants, thereby improving crop disease resistance.

[0084] 4. Molecular biological identification of the screened strains

[0085] 4.1 Genomic DNA Extraction

[0086] Genomic DNA was extracted from the screened strain 54-13 using the TIANGEN DP320-50 kit. The extracted genomic DNA was used for subsequent molecular biological analysis according to the kit instructions.

[0087] 4.2 Gene Amplification

[0088] The ITS, β-tubulin (BenA), and Calmodulin (CaM) genes of *Penicillium brevis* 54-13 were amplified. ITS is an rDNA non-coding spacer region, while β-tubulin (BenA) and CaM are functional genes encoding proteins. ITS is a universal identification marker, while β-tubulin (BenA) and CaM are primarily used for distinguishing closely related species and for high-resolution phylogenetic analysis.

[0089] To amplify the above-mentioned genes of strain 54-13, a PCR amplification reaction was performed. The PCR amplification primers are shown in Table 1.

[0090] Table 1

[0091]

[0092] The PCR reaction volume was 25 μL. The reaction mixture contained 12.5 μL of 2×PCR Mix, 1 μL of forward and reverse primers (10 μM each), 2 μL of template DNA, and 8.5 μL of ddH2O. The PCR amplification program was as follows: pre-denaturation at 94 °C for 5 minutes; followed by 34 cycles, each cycle consisting of denaturation at 94 °C for 30 seconds, annealing at 52 / 56 °C for 30 seconds (52 °C for the ITS gene), extension at 72 °C for 30 seconds; and a final extension at 72 °C for 10 minutes.

[0093] 4.3 Electrophoresis and sequencing of PCR products

[0094] The amplified PCR products were detected by 1% agarose gel electrophoresis. PCR products with the target band were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. Sequencing results showed that the ITS gene sequence of strain 54-13 screened in step 2 is shown in SEQ ID NO.1, the β-tubulin (BenA) sequence is shown in SEQ ID NO.2, and the Calmodulin (CaM) gene sequence is shown in SEQ ID NO.3.

[0095]

[0096] AACCCCAAATGGTGCTGCTTTCTGGTACGTGTCACGCCCGCCAAAACTCCCTCAGCACAACACAGTGTCCCTCAATTGCGGGATTTGGTTGAAGAAAATGTACTGACTCGAACTACAGGCAGACCATTGCTGGTGAGCACGGCCTTGACGGCGATGGCCAGTAAGTTCCTTTGATACGCTCTCGATACTCCTCGACGCGGAATGGCGGTCTGATATTTTTGACTAGCTACAACGGTACCTCCGACCTCCAGCTCGAGCGCCTGAACGTCTACTTCACCCACGTAAGCTCCGTGCCCAGCCAACGACAACCCCCGAGAGCAAATCTAACCATGAATCGTTGTTTAGGCCAGCGGTGACAAGTATGTTCCCCGTGCCGTTCTGGTCGATCTGGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCCTTTGGCAAGCTCTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGTAACAACTGGGCCAAGGGTCACTACCTTGTGAGG(SEQ ID NO:2)。

[0097] CTCTTTGCCGGATTTCTGACTGAAGAGCAAGTCTCCGAGTATAAGGAGGCCTTCTCCCTGTTTGTGAGTACTTCTGGACGCGTGCATTGACAATTTCCGATTGGGAAAACAGTAGACTGACCAGGGCCACTTTCCGCTTGTGAACAGGACAAGGATGGCGATGGTGTGTGCAATCTTTTCCGATAACTCGAATGCTCTACTCTAAAAAGCAATTGTGGAGTCATTGGAGCCCGCGAATATTCTCAAAACAGAAAGATTGATTTAGTTTTGATGTCTAGGCCAAATCACCACCAAGGAGCTTGGCACCGTCATGCGCTCGCTCGGCCAGAACCCATCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAACAATGGCACCATCGACTTCCCCGGTATGCACTAAATAGCTCGGCCCTGGACTGTTGCCTTTTCTCCCTTGAGCCCAGACTAATTGCTTTCCGTGCACCTGCAGAATTCCTCACCATGATGGCCCGCAAGATGAAGGACACCGACTCAGAGGAGGAGATTCGGGAGGCCTTCAAGGTGTTTGACCGTGACAACAACGGCTTCATCTCCGCCGCCGAGCTGCGCCACGTGATGACCTCCATCGGCGAGAAGCTGACCGACGACGAGGTGGACGAGATGATCCGCGAGGCGGACCAGGACGGCGATGGTCGTATTGACTGTACGTTCATCAAAAATTTCAATCTGGCTGGGCATGAAGCGATTCCCATTGCATGAACCACATACTGACCCTCTTCGCAGACAACGAGTTCGTCCAACTCATGTTGCCAAAAAAAAAACAGGGGGGG (SEQ ID NO: 3).

[0098] 4.4 Gene sequence alignment and identification

[0099] The sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 were uploaded to the NCBI database for alignment analysis. The alignment results are shown in Table 2.

[0100] Table 2 Gene sequence alignment results

[0101]

[0102] According to the comparison results, the ITS, β-tubulin (BenA), and Calmodulin (CaM) gene sequences of *Penicillium brefeldianum* 54-13 are highly similar to the ITS, β-tubulin (BenA), and Calmodulin (CaM) gene sequences of *Penicillium brefeldianum* in NCBI, indicating that the biocontrol strain screened in this study is a new *Penicillium brefeldianum*, and therefore it is named *Penicillium brefeldianum* 54-13.

[0103] Example 2: Determination of the effect of Penicillium brefeldianum 54-13 on wheat disease resistance

[0104] Experiments were conducted to verify the effect of P. brefeldianum 54-13, which was screened in Example 1, on improving the disease resistance of wheat.

[0105] 1. Wheat planting and preliminary treatment

[0106] By observing natural disease occurrence in the field (the survey areas were high-incidence areas of wheat powdery mildew and wheat scab, and no other control strategies or artificial inoculation were carried out during the experiment; after spraying the experimental fermentation liquid, its control ability against wheat diseases was statistically analyzed under natural conditions), the test was conducted to determine whether the fermentation liquid of *Penicillium brefeldianum* 54-13 could improve the disease resistance of wheat.

[0107] Wheat was grown in fields in Huai'an City, Jiangsu Province, with 6,000-8,000 wheat plants planted in each plot. Two weeks before the initial flowering stage of wheat, freeze-dried powder of *Penicillium brefeldianum* 54-13 fermentation broth (prepared using the same method as in "2. Fermentation Culture" in Example 1) was prepared as an aqueous solution at a concentration of 10 mg / mL and sprayed evenly onto the wheat leaves. 1-2 L of solution was sprayed per plot (2 L in this example). A second spray was applied 7 days after the first, for a total of two sprays. An equal volume of water was used as a control group (CK). Disease surveys were conducted 20 days after the second spray.

[0108] 2. Wheat disease resistance testing

[0109] (1) The fermentation product of Penicillium brefeldianum 54-13 enhances the resistance of wheat to wheat powdery mildew.

[0110] In areas with a high incidence of wheat powdery mildew, 20 plants were counted in each of the control and treatment groups. The disease severity of wheat powdery mildew was counted from the first to the third leaf from top to bottom of each plant. A total of 60 leaves were counted for each treatment. The disease severity index of each treatment was calculated according to the disease severity grading standard shown in Table 3.

[0111] Table 3 Grading Standards for Wheat Powdery Mildew

[0112]

[0113] The results are as follows Figure 2 Table 4 shows that wheat treated with freeze-dried powder of *Penicillium brefeldianum* 54-13 fermentation broth had significantly smaller powdery mildew lesion area than the control group. Furthermore, the number of diseased leaves at each disease level was counted, and the disease index was calculated. The disease index of the control group was 45.6%, while that of the treatment group was 13.0%, demonstrating that the fermentation product of *Penicillium brefeldianum* 54-13 can improve the resistance of wheat to powdery mildew.

[0114] Table 4. Number of diseased leaves and disease index at each disease level of wheat powdery mildew.

[0115]

[0116] (2) The fermentation product of Penicillium brefeldianum 54-13 enhances the resistance of wheat to wheat scab.

[0117] In areas with a high incidence of wheat scab, six locations were surveyed in both the control and treatment groups. 100 ears of wheat were taken from each location, and a total of 600 ears of wheat were counted for each treatment. The disease severity index for each treatment was calculated according to the disease severity grading standards shown in Table 5.

[0118] Table 5 Grading Standards for Wheat Fusarium Head Blight

[0119]

[0120] The results are as follows Figure 3 Table 6 shows that wheat treated with freeze-dried powder of Penicillium brefeldianum 54-13 fermentation broth was analyzed for the number of diseased ears at each disease level, and the disease index was calculated. The disease index of the control group was 21.8%, while that of the treatment group was 12.6%. Furthermore, the treatment with freeze-dried powder of Penicillium brefeldianum 54-13 fermentation broth significantly reduced the amount of deoxynivalenol, a toxin produced by wheat scab. All of these results demonstrate that the fermentation product of Penicillium brefeldianum 54-13 can improve the resistance of wheat to wheat scab.

[0121] Table 6. Number of diseased ears and disease index at each disease level of wheat scab

[0122]

[0123] Example 3: Penicillium brefeldianum 54-13 enhances rice's resistance to rice blast.

[0124] Experiments were conducted to verify the effect of P. brefeldianum 54-13, which was screened in Example 1, on enhancing the disease resistance of rice.

[0125] 1. Rice planting and preliminary treatment

[0126] Rice CO39 seeds were germinated and cultured in a greenhouse for 10 days (greenhouse temperature 25℃, photoperiod of 16 hours light and 8 hours dark). After 10 days of growth, 6 mL of a 10 mg / mL lyophilized solution of *Penicillium brefeldianum* 54-13 fermentation broth (prepared as described in Example 1, "2. Fermentation Culture") was evenly sprayed onto the rice leaves. An equal volume of water was used as a control group. All groups continued to be cultured in the greenhouse under light for 12 hours.

[0127] 2. Inoculation and culture of rice blast fungus

[0128] Mycelial blocks of *Guy11*, the causal agent of rice blast fungus, were inoculated onto 6 cm diameter SDC medium and cultured at 28°C for 4 days. Aerial mycelia were then scraped off, and the culture was irradiated under black light for 3 days. Spores were washed with sterile ultrapure water and filtered through a filter cloth. The collected spores were then diluted to a concentration of 8 × 10⁻⁶. 4 Add spores / mL, add 4% gelatin solution to make up to 5mL, and spray the prepared spore suspension evenly onto the leaves of rice CO39 seedlings that have grown for 10 days after the preliminary treatment in step 1 above.

[0129] 3. Dark chamber culture and lesion observation

[0130] After culturing in a dark chamber for 24 hours, the cells were cultured in alternating light and dark conditions for 12 hours for 6 days, and then the condition of the lesions was observed and recorded.

[0131] like Figure 4 As shown, rice leaves treated with lyophilized powder of 10 mg / mL Penicillium brefeldianum 54-13 fermentation broth had significantly smaller blast disease lesions than the control group, demonstrating that the fermentation product of Penicillium brefeldianum 54-13 can effectively enhance the rice's resistance to rice blast fungus (Guy11).

[0132] Field experiments on wheat and pot experiments on rice showed that the survival rate and lesion area of ​​plants treated with fermented broth of *Penicillium brefeldianum* 54-13 were significantly lower than those of the control group, proving that *Penicillium brefeldianum* 54-13, as a biocontrol agent, can improve the disease resistance of wheat to powdery mildew and wheat scab, and rice to rice blast fungus.

[0133] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A type of Penicillium breve ( Penicillium brefeldianum )54-13, characterized in that, The Penicillium breve ( Penicillium brefeldianum The accession number of 54-13 is CGMCC NO.41138.

2. The Penicillium breve as described in claim 1 ( Penicillium brefeldianum 54-13. Any of the following applications of its fermentation broth or its lyophilized fermentation broth powder: (a1) Prevention and control of plant diseases caused by wheat powdery mildew fungus; (a2) Prevention and control of plant diseases caused by Fusarium graminearum; (a3) Control of plant diseases caused by rice blast fungus.

3. A biological agent, characterized in that, The active ingredient of the biological agent comprises *Penicillium breve* as described in claim 1. Penicillium brefeldianum 54-13, Containing *Penicillium breve* as described in claim 1 ( Penicillium brefeldianum Fermentation broth of 54-13 or containing *Penicillium breve* as described in claim 1 ( Penicillium brefeldianum )54-13 Fermentation liquid freeze-dried powder.

4. A method for preventing and controlling plant diseases, characterized in that, Includes the following steps: The plants were sprayed with the biological agent as described in claim 3; The plant diseases mentioned are wheat powdery mildew, wheat scab, or rice blast.

Images