Aspergillus flavus and methods and uses of enzymes produced thereby

Abstract

The application provides an Aspergillus flavus and an enzyme production method and application thereof, and belongs to the technical field of microorganisms.The Aspergillus flavus (Aspergillus flavus) HNZY01 is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No.42147.The Aspergillus flavus HNZY01 has the ability of high-yield cellulase, can efficiently and synergistically decompose key structural components such as cellulose, hemicellulose and lignin in tobacco stems, and can also increase the content of reducing sugar in the tobacco stems, so that the Aspergillus flavus HNZY01 can be applied in the degradation of the tobacco stems and the smoking safety of cigarettes can be improved.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to an Aspergillus flavus and its enzyme production method and application. Background Technology

[0002] Tobacco stems are a byproduct of tobacco processing, with a huge annual output. Their resource utilization is crucial for environmental protection and cost reduction. Currently, tobacco stems are mainly recycled into cigarette shreds, which helps reduce waste and dilute harmful components. However, the high content of cell wall substances such as cellulose in tobacco stems limits their application. These substances produce large amounts of irritating odors and carcinogens (such as polycyclic aromatic hydrocarbons) when burned at high temperatures, severely damaging cigarette quality and smoking safety. Therefore, degrading these macromolecules is key to enhancing the value of tobacco stems. Traditional chemical methods suffer from pollution and corrosion problems, while enzymatic hydrolysis offers milder conditions and higher specificity, making it a more promising environmentally friendly technology. Existing research focuses primarily on tobacco leaves; research on the unique enzyme resources of tobacco stems and their application is urgently needed. Summary of the Invention

[0003] In view of the above, in order to at least partially solve at least one of the aforementioned technical problems, the present invention provides an Aspergillus flavus HNZY01, which is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 42147.

[0004] According to one embodiment of the present invention, an application of Aspergillus flavus HNZY01 is provided, comprising at least one of the following: (1) producing carboxymethyl cellulase; (2) producing β-glucosidase; (3) producing xylanase; (4) producing filter paper enzyme system.

[0005] According to another embodiment of the present invention, an application of Aspergillus flavus HNZY01 is provided, comprising at least one of the following: (1) degrading cellulose; (2) degrading lignin; (3) degrading hemicellulose; (4) degrading cellulose, hemicellulose and / or lignin in tobacco stems; (5) increasing the reducing sugar content in tobacco stems; (6) reducing the nicotine, tar and carbon monoxide content during cigarette combustion; and (7) improving the safety of cigarette smoking.

[0006] According to another embodiment of the present invention, a method for producing an enzyme is provided, comprising the steps of inoculating Aspergillus flavus HNZY01 into a culture medium for cultivation and then collecting the enzyme product; the enzyme produced comprises at least one of carboxymethyl cellulase, β-glucosidase or xylanase.

[0007] According to another embodiment of the present invention, a method for degrading cellulose in tobacco stems is provided, comprising the step of inoculating Aspergillus flavus HNZY01 into the tobacco stems and culturing it.

[0008] According to another aspect of the present invention, a composition is provided containing Aspergillus flavus HNZY01.

[0009] According to another embodiment of the present invention, a culture is provided comprising Aspergillus flavus HNZY01 and a culture medium comprising K2HPO4, Tween-80, KNO3, MgSO4, CaCl2 and NaCl.

[0010] According to an embodiment of the present invention, a high-yield cellulase-producing Aspergillus flavus strain, HNZY01, was screened. Through systematic optimization of its culture medium composition and conditions, the cellulase activity of the strain was significantly increased by 1.6 times compared to before optimization, and an efficient and stable fermentation production process was established. In tobacco stem degradation applications, this strain and its produced enzyme preparation exhibit excellent comprehensive degradation capabilities, efficiently and synergistically decomposing key structural components such as cellulose, hemicellulose, and lignin in tobacco stems, while simultaneously increasing reducing sugar content and improving cigarette smoking safety. This provides an efficient and environmentally friendly biotechnological pathway for the high-value and resource-based treatment of tobacco stems, possessing good potential for industrial application and widespread adoption. Attached Figure Description

[0011] The above and other objects, features and advantages of the present invention will become more apparent from the following description of embodiments of the invention with reference to the accompanying drawings, in which:

[0012] Figure 1 This is a standard glucose curve diagram for calculating enzyme activity in an embodiment of the present invention;

[0013] Figure 2 This is an electrophoresis diagram of the PCR product of strain HNZY01 in an embodiment of the present invention;

[0014] Figure 3 Phylogenetic tree diagram of strain HNZY01 constructed for embodiments of the present invention;

[0015] Figure 4 This is a graph showing the effect of corn husk mesh size on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0016] Figure 5 This is a graph showing the effect of corn husk concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0017] Figure 6 This is a graph showing the effect of nitrogen source type on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention;

[0018] Figure 7 This is a graph showing the effect of KNO3 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0019] Figure 8 This is a graph showing the effect of surfactant type on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention;

[0020] Figure 9 This is a graph showing the effect of Tween 80 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0021] Figure 10 This is a graph showing the effect of K2HPO4 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0022] Figure 11 This is a graph showing the effect of MgSO4 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0023] Figure 12 This is a graph showing the effect of CaCl2 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0024] Figure 13 This is a graph showing the effect of NaCl concentration on the cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0025] Figure 14 This is a graph showing the effect of the initial pH of the culture medium on the cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0026] Figure 15 This is a graph showing the effect of inoculum size on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0027] Figure 16 This is a graph showing the effect of liquid volume on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0028] Figure 17 This is a graph showing the effect of rotation speed on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention;

[0029] Figure 18 This is a graph showing the effect of temperature on the cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention;

[0030] Figure 19The figure shows the effect of culture time on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention. Detailed Implementation

[0031] Hereinafter, embodiments of the present invention will be described with reference to the accompanying drawings. However, it should be understood that these descriptions are exemplary only and are not intended to limit the scope of the invention. In the following detailed description, numerous specific details are set forth to provide a thorough understanding of the embodiments of the invention for ease of explanation. However, it will be apparent that one or more embodiments may be practiced without these specific details. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.

[0032] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "comprising" as used herein indicates the presence of features, steps, or operations, but does not exclude the presence or addition of one or more other features.

[0033] When using expressions such as "at least one of A, B and C", they should generally be interpreted in accordance with the meaning that is commonly understood by those skilled in the art (e.g., "a system having at least one of A, B and C" should include, but is not limited to, a system having A alone, a system having B alone, a system having C alone, a system having A and B, a system having A and C, a system having B and C, and / or a system having A, B and C, etc.).

[0034] In realizing the concept of this invention, it was discovered that while traditional chemical methods (such as acid-base treatment) can degrade cellulose and hemicellulose in tobacco stems, they suffer from problems such as severe equipment corrosion, environmental pollution from waste liquid, and difficulty in controlling byproducts. In contrast, enzymatic hydrolysis offers advantages such as mild conditions, high specificity, and environmental friendliness, and has become a research hotspot for tobacco stem quality improvement. However, existing research mostly focuses on the application of enzymes in tobacco leaves, with limited research on the treatment of tobacco stems, which have different compositions and structures. There is an urgent need to screen for highly efficient enzyme resources suitable for tobacco stems. Aspergillus flavus, as an important enzyme-producing microorganism, has broad prospects in biodegradation, providing a direction for this invention.

[0035] Specifically, according to one embodiment of the present invention, an Aspergillus flavus HNZY01 is provided.

[0036] Preservation Instructions

[0037] Strain name: Aspergillus flavus;

[0038] Strain number: HNZY01;

[0039] Preservation period: July 30, 2025;

[0040] Preservation Center: China General Microbiological Culture Collection Center (CGMCC);

[0041] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing;

[0042] Registered with the China National Collection Center (CGMCC) No. 42147.

[0043] According to an embodiment of the present invention, a high-yield cellulase-producing Aspergillus flavus strain, HNZY01, was screened. Through systematic optimization of its culture medium composition and conditions, the cellulase activity of the strain was significantly increased by 1.6 times compared to before optimization, and an efficient and stable fermentation production process was established. In tobacco stem degradation applications, this strain and its produced enzyme preparation exhibit excellent comprehensive degradation capabilities, efficiently and synergistically decomposing key structural components such as cellulose, hemicellulose, and lignin in tobacco stems, while simultaneously increasing reducing sugar content and improving cigarette smoking safety. This provides an efficient and environmentally friendly biotechnological pathway for the high-value and resource-based treatment of tobacco stems, possessing good potential for industrial application and widespread adoption.

[0044] According to another embodiment of the present invention, an application of Aspergillus flavus is provided, comprising at least one of the following: (1) producing carboxymethyl cellulase; (2) producing β-glucosidase; (3) producing xylanase; (4) producing filter paper enzyme system.

[0045] According to an embodiment of the present invention, *Aspergillus flavus* HNZY01 can produce a variety of cellulases, which work together to degrade the complex lignocellulose structure of tobacco stems. Specifically, carboxymethyl cellulase and filter paper enzymes synergistically destroy the cellulose crystal structure, degrading it into cellulosic sugars; β-glucosidase further hydrolyzes the oligosaccharides into glucose, effectively increasing the yield of reducing sugars; and xylanase specifically degrades the abundant hemicellulose in tobacco stems, effectively disrupting its dense network. This synergistic effect of the multi-enzyme system enables more comprehensive and efficient degradation of tobacco stems, significantly superior to single-enzyme treatment, laying a solid foundation for the high-value utilization of tobacco stems.

[0046] According to another embodiment of the present invention, an application of Aspergillus flavus is provided, comprising at least one of the following: (1) degrading cellulose; (2) degrading lignin; (3) degrading hemicellulose; (4) degrading cellulose, hemicellulose and / or lignin in tobacco stems; (5) increasing the reducing sugar content in tobacco stems; (6) reducing the nicotine, tar and carbon monoxide content during cigarette combustion; and (7) improving the safety of cigarette smoking.

[0047] According to an embodiment of the present invention, Aspergillus flavus HNZY01 achieves synergistic degradation of lignin, hemicellulose, and cellulose in tobacco stems through its multi-enzyme system. This strain degrades lignin, disrupting its cross-linking structure with cellulose and hemicellulose, thus releasing the lignin's encapsulation of carbohydrates; simultaneously, it degrades hemicellulose through xylanase and other enzymes, disrupting the microstructure of the tobacco stems and increasing porosity. The disruption of the lignin barrier and the breakdown of the hemicellulose network create favorable conditions for the efficient degradation of cellulose.

[0048] According to an embodiment of the present invention, cellulose and hemicellulose are hydrolyzed to generate a large amount of reducing sugars such as glucose and xylose. The release of these reducing sugars can effectively reduce their irritation and off-flavors; at the same time, as key substrates for the Maillard reaction and caramelization reaction, they can be converted into abundant aroma-producing substances such as pyrazines and furans during cigarette combustion, thereby significantly improving the aroma quality and industrial usability of tobacco stems.

[0049] According to an embodiment of the present invention, after biodegradation treatment, the tobacco stem structure becomes loose and aggregated, exhibiting more complete and uniform combustion characteristics during cigarette combustion. This improved combustion behavior effectively reduces the pyrolysis zone, thereby significantly reducing the formation of total particulate matter (such as tar) and harmful gaseous components (such as carbon monoxide) in the mainstream flue gas. This method achieves source control of harmful substances at the raw material end through biological pretreatment, providing an effective approach to reducing harm from cigarettes.

[0050] According to another embodiment of the present invention, a method for producing an enzyme is provided, comprising the steps of inoculating Aspergillus flavus HNZY01 into a culture medium for cultivation and then collecting the enzyme product; the enzyme produced comprises at least one of carboxymethyl cellulase, β-glucosidase or xylanase.

[0051] According to an embodiment of the present invention, the specific steps for enzyme production are as follows: A spore suspension is inoculated into a culture medium and cultured on a constant-temperature shaker. After the culture is completed, the fermentation broth is centrifuged, and the supernatant is collected to obtain the enzyme product.

[0052] According to an embodiment of the present invention, the conditions for enzyme production by Aspergillus flavus HNZY01 further include the following parameters: inoculum size of 6% to 8%, for example 6%, 7%, or 8%; volume of shake flask culture medium of 25 to 50 mL / 250 mL, for example 25 mL / 250 mL, 30 mL / 250 mL, 35 mL / 250 mL, 40 mL / 250 mL, 45 mL / 250 mL, or 50 mL / 250 mL; and shaking speed of 160 to 200 r / min, for example 160 r / min, 170 r / min, 180 r / min, 190 r / min, or 200 r / min.

[0053] According to an embodiment of the present invention, the culture medium satisfies at least one of the following conditions: (1) the initial pH of the culture medium is 6 to 8; (2) the inorganic salt in the culture medium includes 2 to 4 g / L of K2HPO4; (3) the culture medium includes 4 to 8 g / L of surfactant; (4) the culture medium includes surfactant, the surfactant including at least one of glycerol, Tween-60 or Tween-80; (5) the culture medium includes 6 to 8 g / L of nitrogen source, the nitrogen source including at least one of KNO3, NaNO3 or NH4Cl.

[0054] According to an embodiment of the present invention, the initial pH of the culture medium can affect the enzyme production efficiency of Aspergillus flavus HNZY01. Maintaining the initial pH within a suitable range not only helps maintain cell membrane stability and enzyme protein activity, but also promotes the absorption and transformation of carbon sources, nitrogen sources, and inorganic salts by the microorganisms, thereby significantly improving the specific growth rate and cellulase synthesis efficiency of the strain. Preferably, the initial pH is 6.5.

[0055] According to an embodiment of the present invention, the inorganic salt is selected from the following components: 2-4 g / L K₂HPO₄, 0.1-1 g / L MgSO₄, 0.5-1.5 g / L CaCl₂, and 0.5-1.5 g / L NaCl. Preferably, the concentration of K₂HPO₄ is 2.9 g / L; the concentration of MgSO₄ is 0.5 g / L; the concentration of CaCl₂ is 1 g / L; and the concentration of NaCl is 1 g / L.

[0056] According to an embodiment of the present invention, the surfactant is selected from one of Tween-20, Tween-40, Tween-60, Tween-80, Triton-100, Triton-114, and glycerol, preferably Tween-80. As a nonionic surfactant, Tween-80 optimizes the mass transfer efficiency and oxygen transport capacity of the culture medium by reducing surface tension; simultaneously, it promotes substrate absorption and enzyme secretion by enhancing cell membrane permeability. The synergistic effect of these effects ultimately significantly optimizes the cellulase production efficiency of Aspergillus flavus HNZY01 and its adaptability to the fermentation environment.

[0057] According to embodiments of the present invention, the concentration of the surfactant can be 4 g / L, 5 g / L, 6 g / L, 7 g / L, 8 g / L, etc. Preferably, the concentration of the surfactant is 5.3 g / L.

[0058] According to an embodiment of the present invention, the nitrogen source concentration can be 6 g / L, 7 g / L, 8 g / L, etc., preferably 8 g / L. The nitrogen source is selected from one of yeast extract, peptone, beef peptone, urea, KNO3, NaNO3, NH4Cl, or (NH4)2SO4, preferably KNO3.

[0059] According to an embodiment of the present invention, the culture medium further comprises 50-70 g / L of corn husks, with a particle size of 60-80 mesh. The concentration of corn husks directly affects the contact interface between the strain and the substrate, thereby regulating its growth metabolism and enzyme production efficiency. Preferably, the corn husk concentration is 52.3 g / L.

[0060] According to an embodiment of the present invention, the enzyme production method satisfies at least one of the following conditions: (1) the culture time is 3 to 5 days; (2) the culture temperature is 30°C to 35°C.

[0061] According to an embodiment of the present invention, the culture time can be 3 days, 4 days, 5 days, etc., preferably 76.6 hours; the culture temperature can be 30℃, 31℃, 32℃, 33℃, 34℃, 35℃, etc., preferably 32.4℃.

[0062] According to an embodiment of the present invention, the enzyme production process of Aspergillus flavus HNZY01 is jointly regulated by culture time and temperature, which can act independently or produce a synergistic effect. The enzyme activity exhibits dynamic changes with culture time, mainly due to the succession of the strain's growth stages, the accumulation of metabolites, and the synthetic characteristics of different enzymes. Meanwhile, a suitable culture temperature is a key factor, improving efficiency by maintaining enzyme protein stability and optimizing cell metabolism. Therefore, applying appropriate temperatures at different times during enzyme production can achieve synergistic optimization of both factors, thereby significantly improving overall enzyme production efficiency.

[0063] According to another embodiment of the present invention, a method for degrading cellulose in tobacco stems is provided, comprising the step of inoculating the tobacco stems with Aspergillus flavus HNZY01 and culturing it; specifically, the degradation method includes in vitro enzymatic hydrolysis of tobacco stems and fermentation degradation of tobacco stems.

[0064] According to an embodiment of the present invention, the specific operation of in vitro enzymatic hydrolysis of tobacco stems by Aspergillus flavus HNZY01 is as follows: A certain mass of pretreated tobacco stem sample is accurately weighed into an Erlenmeyer flask, and the substrate concentration is calculated and maintained according to its oven-dry mass. Subsequently, an appropriate volume of enzyme solution is added according to the target enzyme activity, and the volume is made up to the specified total volume with a buffer solution of a specific pH. After mixing, the enzymatic hydrolysis reaction is carried out at a specific temperature, for example, as follows.

[0065] In one specific embodiment, enzyme solution produced by Aspergillus flavus HNZY01 was used for synergistic enzymatic hydrolysis of tobacco stems. The results showed that the degradation rates of cellulose, hemicellulose, and lignin in the tobacco stems reached 16.5%, 14.3%, and 27.1%, respectively, while the reducing sugar content significantly increased from 0.6% to 8.6%. These results indicate that Aspergillus flavus HNZY01 exhibits a significant treatment effect in the degradation of tobacco stems, providing a feasible microbial resource for the biodegradation of tobacco stems.

[0066] According to an embodiment of the present invention, the specific steps of Aspergillus flavus HNZY01 fermentation to degrade tobacco stems are as follows: First, the strain is cultured on a suitable solid culture medium until spores are produced, and a spore suspension is prepared using sterile physiological saline; then, the spore suspension is inoculated into a liquid fermentation medium with pretreated tobacco stems as the sole carbon source, and the mixture is shaken and cultured under controlled conditions for a certain period of time to achieve the degradation of tobacco stems.

[0067] In one specific embodiment, *Aspergillus flavus* HNZY01 exhibited excellent degradation performance in a fermentation system using tobacco stems as the sole carbon source. Degradation analysis showed that this strain achieved degradation rates of 73.1% for cellulose, 33.3% for hemicellulose, and 59.0% for lignin in tobacco stems, with the degradation of cellulose being particularly outstanding. This result confirms that *Aspergillus flavus* HNZY01 has a significant degradation capacity for tobacco stem components through fermentation, providing new microbial resources and methodological support for the development of tobacco stem resource utilization technologies.

[0068] According to another aspect of the present invention, a composition is provided containing Aspergillus flavus HNZY01.

[0069] According to embodiments of the present invention, the active ingredient of the composition may be Aspergillus flavus HNZY01 and / or metabolites of Aspergillus flavus HNZY01 and / or cultures of Aspergillus flavus HNZY01.

[0070] According to embodiments of the present invention, the composition is a microbial agent. Its dosage form includes, but is not limited to, liquid, emulsion, suspension, powder, granule, wettable powder, or water-dispersible granule, and may also include a carrier for preparing the microbial agent and other adjuvant components. Furthermore, the product form of the composition may be a solid composition, a liquid composition, or a compound bio-fertilizer, etc.

[0071] According to another aspect of the present invention, a culture comprising Aspergillus flavus HNZY01 and a culture medium comprising K2HPO4, Tween-80, KNO3, MgSO4, CaCl2 and NaCl is provided.

[0072] Preferably, the culture comprises Aspergillus flavus HNZY01 and its fermentation medium, which contains the following components: 2.9 g / L K2HPO4, 0.5 g / L MgSO4, 1 g / L CaCl2, 1 g / L NaCl, 8 g / L KNO3 and 5.3 g / L Tween-80.

[0073] In summary, the *Aspergillus flavus* strain HNZY01 obtained by this invention possesses the ability to efficiently synthesize multiple cellulases, with its enzyme production spectrum including key functional components such as carboxymethyl cellulase, β-glucosidase, xylanase, and filter paper enzymes. The optimized culture medium composition includes, but is not limited to, specific concentrations of carbon sources, nitrogen sources, and inorganic salts; the culture conditions cover key parameters such as temperature, pH, rotation speed, and liquid volume. Under this optimized process, cellulase activity is significantly enhanced. Further application of the produced enzyme preparation or strain directly to tobacco stem degradation shows that it can synergistically and efficiently hydrolyze cellulose, hemicellulose, and even some lignin in tobacco stems. This synergistic degradation effect far exceeds that of single enzyme treatment, not only achieving deep conversion of tobacco stem components and effective enrichment of reducing sugars, but also significantly reducing the content of harmful substances during cigarette combustion, effectively improving the safety of cigarette consumption, providing key technical support for the high-value utilization of tobacco stem resources, and demonstrating good application prospects.

[0074] The present invention will be further explained below through specific embodiments. Unless otherwise specified, all reagents used are commercially available and all experimental methods used are conventional experimental methods in the art. In the following experiments, each experimental group has three parallel replicates, and the experimental results are expressed as mean ± standard deviation (x ± s). In the attached figures, a, b, c, d, and e are statistical significance markers.

[0075] The materials used in the following embodiments are as follows:

[0076] Daqu: Originated from Songhe Winery in Henan Province;

[0077] Tobacco stem shreds: sourced from Hunan Tobacco Industry Co., Ltd., and prepared as follows: using tobacco stems produced in Longshan, Hunan in 2024 as raw materials, processed according to the requirements of the "Hunan Tobacco Stem Shred Process Specification", through water washing, stem moistening, stem cutting (stem shred width 0.17mm) and drying processes;

[0078] Corn husk screening medium (1L): 20g corn husk powder, 4g NaNO3, 2g KH2PO4, 0.5g MgSO4, 0.4g CaCl2, 0.5g NaCl, 1L distilled water, natural pH;

[0079] PDA solid medium (1L): 200g potato, 20g glucose, 20g agar, 1L distilled water, natural pH;

[0080] YPD liquid medium (1L): 20g glucose, 20g tryptone, 10g yeast extract, 1L distilled water, natural pH;

[0081] Huchinson's medium (1L): 1g KH2PO4, 0.1g NaCl, 0.3g MgSO4, 2.5g NaNO3, 0.01g FeCl3, 0.1g CaCl2, 1L distilled water, pH 7.2~7.4;

[0082] Filter paper strip disintegration medium (1L): 1g KH2PO4, 0.1g NaCl, 0.3g MgSO4, 2.5g NaNO3, 0.01g FeCl3, 0.1g CaCl2, 1L distilled water, pH 7.2~7.4, carbon source is 1 cm × 6 cm filter paper strip;

[0083] Basic fermentation medium for cellulase production (1L): 20g corn husks, 4g NaNO3, 2g K2HPO4, 0.5g MgSO4, 0.4g CaCl2, 0.5g NaCl, 1L distilled water, natural pH;

[0084] All the above culture media were sterilized in an autoclave at 121°C for 20 minutes.

[0085] The measurement methods involved in the following embodiments are all conventional techniques and may be as follows:

[0086] Preparation of crude enzyme solution: Inoculate the spore suspension at a rate of 5% (v / v) into the cellulase fermentation medium and culture at 30℃ and 180 r / min for 3 days. After the culture is completed, centrifuge the fermentation broth at 10000 r / min for 10 min, collect the supernatant to obtain the crude enzyme solution, and store it at 4℃ for later use.

[0087] 1. Determination of carboxymethyl cellulase (CMCase) activity

[0088] Take four centrifuge tubes and add 0.15 mL of 1% sodium carboxymethyl cellulose (CMC-Na) solution to each, with one tube serving as a blank control. Add 0.05 mL of diluted crude enzyme solution to each of the remaining three sample tubes, mix well, and incubate at 50°C for 30 minutes. After the reaction, add 0.05 mL of enzyme inactivation solution to the blank tube, then add 0.2 mL of DNS reagent to all tubes, incubate in a boiling water bath for 10 minutes, and then cool. Add 1 mL of distilled water to each tube and mix well. Zero the microscope using the blank tube and measure the absorbance at 540 nm. Calculate the reducing sugar production and enzyme activity based on the glucose standard curve.

[0089] 2. Determination of β-glucosidase activity (βDGlucosidase, βGase)

[0090] Take four centrifuge tubes and add 0.15 mL of 1% salicin solution to each, with one tube serving as a blank control. Add 0.05 mL of diluted crude enzyme solution to the remaining three sample tubes, mix well, and incubate at 50°C for 30 minutes. After the reaction, add 0.05 mL of enzyme inactivation solution to the blank tube, then add 0.2 mL of DNS reagent to all tubes, incubate in a boiling water bath for 10 minutes, and cool. Add 1 mL of distilled water to each tube and mix well. Zero the microscope using the blank tube and measure the absorbance at 540 nm. Calculate the reducing sugar production and enzyme activity based on the glucose standard curve.

[0091] 3. Determination of Filter Paper Activity (FPA)

[0092] Take four centrifuge tubes and add 0.15 mL of pH 4.8 citrate buffer and a 1 cm × 0.6 cm starch-free filter paper strip to each. One tube should be used as a blank control. Preheat all centrifuge tubes in a 50°C water bath for 5 minutes. Then, add 0.05 mL of diluted crude enzyme solution to each of the three sample tubes and continue the reaction for 30 minutes. After the reaction, add 0.05 mL of inactivated enzyme solution to the blank tube, and add 0.2 mL of DNS reagent to all tubes. Heat in a boiling water bath for 10 minutes, cool, and then add 1 mL of distilled water to mix. Zero the microscope using the blank tube and measure the absorbance at 540 nm. Calculate the enzyme activity based on the glucose standard curve.

[0093] 4. Enzyme activity calculation

[0094] (1) Definition of enzyme activity unit (U / mL): In an enzyme activity assay system, the amount of cellulase required to catalyze the hydrolysis of a specific substrate and generate 1 μg of glucose within a 1 min time span is defined as 1 enzyme activity unit (U).

[0095] (2) The formula for enzyme activity conversion is as follows:

[0096] Enzyme activity = X × N × 1000 / (A × T).

[0097] In the formula, X refers to the glucose content obtained from the glucose standard curve, in milligrams (mg); N refers to the dilution factor of the enzyme solution; T refers to the enzyme reaction time, in minutes (min); and A refers to the amount of enzyme solution added, in milliliters (mL).

[0098] (3) Determination of glucose standard curve

[0099] Take nine 2mL centrifuge tubes, numbered 08. Prepare glucose solutions of different concentrations by adding distilled water and glucose standard solution to the volumes shown in Table 1. Add 0.2mL of 3,5-dinitrosalicylic acid (DNS) reagent to each tube, mix well, and heat in a boiling water bath for 10 minutes. After cooling to room temperature, add 1mL of distilled water and mix thoroughly. Zero the microscope using the solution in tube 0 as a blank, and measure the absorbance (OD value) of each tube at a wavelength of 540nm. Plot the glucose content (mg) on ​​the x-axis, and the corresponding OD value... 540 The value is the ordinate; plot the standard curve ( ). Figure 1 ).

[0100] Table 1. Preparation of Glucose Standard Solution

[0101]

[0102] Figure 1 This is a standard glucose curve diagram for calculating enzyme activity in an embodiment of the present invention.

[0103] Depend on Figure 1 It can be seen that the linear regression equation of the standard curve is y = 7.7517x - 0.056, and the coefficient of determination R0 is... 2 =0.9935, indicating that the curve has excellent linear correlation, meets the requirements for enzyme activity determination, and can be used as a standard for quantitative analysis. In the enzyme activity determination process, the crude enzyme solution of each strain was diluted, and its OD540 value was measured using a UV spectrophotometer. This value was then converted to glucose content based on the standard curve, and the enzyme activity value was calculated accordingly.

[0104] 5. Determination of reducing sugar content

[0105] Centrifuge the enzymatic hydrolysate or fermentation broth at 10,000 rpm for 1 min, collect the supernatant, and dilute with deionized water to a suitable concentration. Take 250 μL of the diluted solution and mix thoroughly with an equal volume of DNS reagent. Heat in a boiling water bath for 15 min, cool to room temperature, and measure the absorbance at 540 nm using a UV spectrophotometer. Calculate the reducing sugar content in the sample based on the glucose standard curve.

[0106] 6. Determination of cellulose, hemicellulose, and lignin content

[0107] (1) Acid treatment of the sample

[0108] Accurately weigh 0.30±0.01g of dried tobacco stem sample into a stoppered test tube, add 3.00±0.01mL of 72% (w / w) sulfuric acid solution, stir well, and incubate in a water bath at 30±3℃ for 60±5 min, stirring every 5-10 min. Then transfer the mixture to a 200mL Erlenmeyer flask, add 84.00±0.04mL of deionized water to dilute the sulfuric acid to 4% (w / w), seal, and autoclave at 121℃ for 1 h. After cooling, filter, collect the hydrolysate, and store at 4℃ for later use.

[0109] (2) Determination of cellulose and hemicellulose content

[0110] Take 10 mL of hydrolysate, adjust to neutral with calcium carbonate, allow to stand and precipitate, then take 1 mL of the supernatant, centrifuge at 10000 rpm for 5 min, filter through a 0.22 μm filter membrane, and determine the glucose and xylose contents using high-performance liquid chromatography (HPLC). Chromatographic conditions: BioRad Aminex HPX87H column, column temperature 35℃, mobile phase 5 mM sulfuric acid solution, flow rate 0.5 mL / min, detector temperature 35℃. Cellulose and hemicellulose contents were calculated using the following formula:

[0111] Cellulose % = (C 葡 ×86.73×10^(3)×0.90) / m0×100;

[0112] Hemicellulose % = (C 木 ×86.73×10^(3)×0.88) / m0×100;

[0113] In the formula C 葡 This indicates the glucose concentration after HPLC detection, in g / mL; C 木 The xylose concentration after HPLC detection is expressed in g / mL; m0 represents the oven-dry weight of the hydrolyzed sample raw material in g; 0.9 is the conversion factor between glucose and glucan; and 0.88 is the conversion factor between xylose and xylan.

[0114] (3) Determination of acid-insoluble lignin content

[0115] The acid hydrolysis residue was washed with distilled water until neutral. The sand core funnel, along with the residue, was then dried in a 105°C oven to constant weight. It was transferred to a desiccator and cooled to room temperature. The mass was weighed using a four-position analytical balance and recorded as M1. The constant-weighted sand core funnel and residue were then ignited in a muffle furnace at (575±5)°C for 4 hours. After ignition, they were again placed in a desiccator and cooled to room temperature. The mass was weighed using a four-position analytical balance and recorded as M2. The acid-insoluble lignin content was calculated using the following formula:

[0116] Acid-insoluble lignin % = (M1M2) / m0×100%.

[0117] (4) Determination of acid-soluble lignin content

[0118] The absorbance of the acid-hydrolyzed solution was measured at 280 nm using a UV-Vis spectrophotometer. Deionized water was used as a blank control for zeroing. Samples were appropriately diluted according to the absorbance range (0.700-1.000), and the dilution factor and absorbance (accurate to 0.001) were recorded. Each sample required at least two parallel measurements, and all operations had to be completed within 6 hours after hydrolysis. The acid-soluble lignin content was calculated using the following formula:

[0119] Acid-soluble lignin % = (A×D×V) / (96×m0)×100%.

[0120] In the formula, A is the absorbance of the sample to be tested; D is the dilution factor of the sample to be tested; V is the volume of the sample hydrolysate, 0.087 L; 96 is the absorption coefficient; and m0 is the oven-dry mass of the hydrolysate sample, in g.

[0121] 7. Xylanase activity assay

[0122] Add 25 μL of enzyme solution appropriately diluted with 50 mmol / L sodium citrate buffer (pH 5.0) to 225 μL of 1% beech xylan substrate. React precisely at 50°C for 10 min. Then, terminate the reaction by adding 250 μL of DNS solution containing 0.1% anhydrous sodium sulfite. Boil in a water bath for 15 min. After cooling, add 250 μL of 40% potassium sodium tartrate tetrahydrate solution, mix well, and measure the OD using a UV spectrophotometer. 540 value.

[0123] Example 1 Isolation of bacterial strains

[0124] Accurately weigh 1.00g of Daqu sample and add it to a 25mL Erlenmeyer flask containing 9mL of sterile water and glass beads. Shake thoroughly to mix, and prepare 10 -1 The bacterial suspension was then serially diluted with sterile water to obtain 10... -4 10 5 and 10 6 Diluted solutions were prepared. 0.1 mL of each graded dilution was spread onto corn husk selection medium plates. The plates were incubated at 30°C and observed periodically. Based on differences in colony morphology, single colonies were selected and inoculated onto fresh corn husk selection medium plates using the streak plating method to obtain morphologically uniform and stable single colonies. The activities of three cellulases (CMCase, βGCase, and FPA) in each colony were measured, and the colony with the optimal enzyme activity was selected and named HNZY01.

[0125] Example 2 Identification of bacterial strains

[0126] 2.1 Genomic DNA Extraction

[0127] Scrape an appropriate amount of HNZY01 bacterial cells, grind them in liquid nitrogen, and transfer the bacterial powder to a 1.5 mL centrifuge tube. Add 0.6 mL of TE buffer to the centrifuge tube to fully suspend the bacterial cells. Add 250 µL of 10% SDS solution and 3 µL of 20 ng / µL proteinase K sequentially, mix well, and incubate in a 37°C water bath for 1 hour. Add 150 µL of 5 mol / L NaCl solution and mix well. Add 150 µL of 2% CTAB solution, mix well, and incubate in a 65°C water bath for 20 minutes. Centrifuge at 12000 rpm for 20 minutes at room temperature, and aspirate the supernatant to a new centrifuge tube. Add an equal volume of isopropanol to the supernatant, mix well, and let stand at room temperature for 30 minutes. Then centrifuge at 12000 rpm for 10 minutes at 4°C, and discard the supernatant. Wash the precipitate with 750 µL of 70% ethanol, centrifuge at 12000 rpm for 2 minutes at 4 °C, discard the supernatant and drain the remaining liquid. Dissolve the DNA precipitate in 30 µL of purified water containing RNase and incubate overnight at 4 °C. The resulting product is the genomic DNA solution.

[0128] 2.2 PCR amplification

[0129] Using genomic DNA of strain HNZY01 as a template, PCR amplification was performed using the universal fungal ITS primers ITS1 and ITS4. The PCR reaction system and conditions are detailed in Tables 2 and 3 below. After agarose gel electrophoresis, the PCR amplification products were observed and recorded using a gel imaging system. Figure 2 ).

[0130] The universal primer sequences for amplifying the fungal ITS region are as follows:

[0131] ITS1: 5'GGAAGTAAAAGTCGTAACAAGG3' (SEQ ID No. 1);

[0132] ITS4: 5'TCCTCCGCTTATTGATATGC3' (SEQ ID No. 2).

[0133] Table 2 PCR reaction system

[0134]

[0135] Table 3 PCR reaction conditions

[0136]

[0137] Figure 2This is an electrophoresis diagram of the PCR product of strain HNZY01 in an embodiment of the present invention.

[0138] Depend on Figure 2 As can be seen, both sample lanes showed single, clear DNA bands without non-specific amplification or tailing. This result indicates that the primers (ITS1 / ITS4) successfully amplified the specific target fragment, and the product quality met sequencing requirements, ensuring the accuracy of subsequent sequence analysis results.

[0139] 2.3 Construction of the phylogenetic tree

[0140] The PCR amplification products were sent to Beijing BGI Genomics Co., Ltd. for sequencing. After software correction and assembly, the nucleotide sequence of strain HNZY01 (504 bp in length) was obtained. Subsequently, this sequence was submitted to the NCBI database for homology comparison analysis, and a phylogenetic tree was constructed using the neighbor-joining method with analysis software. Figure 3 ).

[0141] Figure 3 Phylogenetic tree diagram of strain HNZY01 constructed for an embodiment of the present invention.

[0142] Depend on Figure 3 It can be seen that strain HNZY01 and a standard strain of *Aspergillus flavus* with accession number PP837989.1 form a highly supported evolutionary branch. Combined with homology comparison results, the sequence similarity between strain HNZY01 and *Aspergillus flavus* is over 99%. The above molecular phylogenetic and sequence analysis results corroborate each other, jointly confirming the taxonomic position of strain HNZY01 as *Aspergillus flavus*, providing a molecular biological basis for the classification and identification of this strain.

[0143] Example 3: Optimization of the culture medium composition for cellulase production by Aspergillus flavus HNZY01

[0144] 3.1 Preparation of spore suspension

[0145] To potato dextrose agar (PDA) plates cultured at 30°C for 3 days, 10 mL of sterile physiological saline was added. A spore suspension was prepared by gently scraping the surface of the medium with a sterile inoculation loop. After thorough mixing, spores were counted using a hemocytometer, and the spore suspension concentration was adjusted to 1 × 10⁻⁶. 8 per mL.

[0146] 3.2 Optimization of Culture Medium Composition

[0147] 3.2.1 Single-factor optimization

[0148] A single-factor experimental design was used to systematically investigate the effects of key factors such as corn husk mesh size, corn husk concentration, nitrogen source type and concentration, surfactant type and concentration, and the concentrations of K2HPO4, MgSO4, CaCl2, and NaCl on the cellulase production capacity of Aspergillus flavus HNZY01. The specific levels of each factor are detailed in Table 4. During the experiment, spore suspension was inoculated at a rate of 5% (v / v) into 250 mL Erlenmeyer flasks containing 50 mL of culture medium and cultured at 30 °C and 180 rpm for 72 h using a constant temperature shaker. After culture, the activities of carboxymethyl cellulase (CMCase), β-glucosidase (βGase), and filter paper enzyme (FPA) in the culture medium were measured to evaluate the effects of different factors on the enzyme production characteristics of the strain.

[0149] Table 4 Single-factor optimization design of culture medium components

[0150]

[0151] Figure 4 The figure shows the effect of corn husk mesh number on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0152] Depend on Figure 4 It was found that the CMCase activity of corn husks treated with different particle sizes showed significant differences. The enzyme activity first increased and then decreased with increasing corn husk mesh size, with the 60-80 mesh particle size group reaching the peak cellulase activity (50.4 U / mL). In conclusion, 60-80 mesh is the optimal corn husk particle size for enzyme production by this strain, and subsequent experiments were conducted based on this particle size.

[0153] Figure 5 The figure shows the effect of corn husk concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0154] Depend on Figure 5 It was found that when the corn husk concentration was below 60 g / L, the cellulase activity of *Aspergillus flavus* HNZY01 increased significantly with increasing corn husk concentration; the enzyme activity reached its maximum value (66.9 U / mL) when the corn husk concentration reached 60 g / L. However, when the substrate concentration exceeded this threshold, the enzyme activity decreased, possibly because high corn husk concentrations significantly increased the viscosity of the culture medium, thus hindering dissolved oxygen transfer and nutrient diffusion during fermentation. In conclusion, 60 g / L corn husk concentration is the optimal substrate concentration for enzyme production by this strain, and subsequent experiments were conducted based on this concentration.

[0155] Figure 6 The figure shows the effect of nitrogen source type on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0156] Depend on Figure 6It was found that among organic nitrogen sources, yeast extract had the most significant promoting effect, followed by urea, beef peptone, and peptone. Among inorganic nitrogen sources, KNO3 showed the best induction effect, significantly superior to NaNO3, NH4Cl, and (NH4)2SO4. The enzyme secretion-promoting mechanism of inorganic nitrogen sources mainly involves two aspects: first, they are easily and rapidly absorbed, efficiently meeting the nitrogen metabolism needs of microorganisms and providing support for cell growth and protein synthesis; second, their metabolic processes can regulate intracellular enzyme activity, thereby enhancing the secretion capacity of cellulase. Subsequent experiments selected KNO3 as the optimal nitrogen source for enzyme production by this strain.

[0157] Figure 7 The figure shows the effect of KNO3 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0158] Depend on Figure 7 It can be seen that with the increase of KNO3 concentration, the cellulase activity in the fermentation broth first increases and then decreases. When the KNO3 concentration is 8 g / L, the cellulase activity reaches the highest value of 71.2 U / mL. KNO3 can effectively promote the hydrolysis of cellulose and other substances in the fermentation system within a suitable concentration range; however, excessively high KNO3 concentrations will inhibit cellulose hydrolysis by affecting the metabolic activity of microorganisms.

[0159] Figure 8 The figure shows the effect of surfactant type on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0160] Depend on Figure 8 It was found that the cellulase secretion capacity of *Aspergillus flavus* HNZY01 varied significantly under different surfactant conditions. Compared with the control, the Triton series surfactants showed an inhibitory effect on cellulase activity; while the Tween series (especially Tween 60 and Tween 80) significantly promoted cellulase secretion. The promoting effect of Tween 80, as a nonionic surfactant, is mainly attributed to the following mechanisms: reducing the surface tension of the culture medium, improving mass transfer and dissolved oxygen efficiency; enhancing cell membrane permeability, promoting nutrient absorption and enzyme secretion; and possibly positively regulating cellular metabolic activity. In conclusion, Tween 80 is the optimal surfactant for enzyme production in this strain.

[0161] Figure 9 The figure shows the effect of Tween 80 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0162] Depend on Figure 9It was found that cellulase activity initially increased and then decreased with increasing Tween 80 concentration, reaching a peak at 4 g / L (75.2 U / mL). Appropriate amounts of Tween 80 (≤4 g / L) can promote substrate uptake and enzyme secretion by reducing culture medium surface tension, improving dissolved oxygen and mass transfer efficiency, and enhancing cell membrane permeability. However, when the concentration exceeds 4 g / L, Tween 80 may lead to excessive cell membrane permeability and even toxicity, interfering with normal metabolism and inhibiting enzyme activity.

[0163] Figure 10 The figure shows the effect of K2HPO4 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0164] Depend on Figure 10 It was found that the cellulase activity of Aspergillus flavus HNZY01 initially increased and then decreased with increasing K₂HPO₄ concentration, reaching a peak at 4 g / L (72.9 U / mL). Appropriate amounts of K₂HPO₄ (≤4 g / L) can serve as an effective phosphorus source, promoting cellular nucleic acid and ATP synthesis, maintaining pH stability, and optimizing cell membrane function, thereby enhancing enzyme activity. However, concentrations exceeding 4 g / L may inhibit the activity of key enzymes, alter the culture medium microenvironment, and cause osmotic stress to cells, ultimately leading to a decrease in cellulase activity.

[0165] Figure 11 The figure shows the effect of MgSO4 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0166] Depend on Figure 11 It was found that the cellulase activity of Aspergillus flavus HNZY01 initially increased and then decreased with increasing MgSO4 concentration, reaching a peak at 0.5 g / L (77.3 U / mL). Appropriate amounts of MgSO4... 2+ As a cofactor for many key enzymes, it can effectively promote cell metabolism and cellulase synthesis; however, when the concentration is too high, it may inhibit normal physiological activities of cells due to metal ion stress, leading to a decrease in enzyme activity.

[0167] Figure 12 The figure shows the effect of CaCl2 concentration on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0168] Depend on Figure 12 It was found that the cellulase activity of Aspergillus flavus HNZY01 initially increased and then decreased with increasing CaCl2 concentration, reaching a peak at 1 g / L (77.3 U / mL). Appropriate amounts of Ca... 2+ As a key cofactor, it can participate in cellular metabolic processes, enhance enzyme activity, and promote cellulase synthesis; however, when the concentration is too high, excessive Ca... 2+ It may disrupt cell membrane stability and interfere with metabolism, thereby inhibiting enzyme activity.

[0169] Figure 13 The figure shows the effect of NaCl concentration on the cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0170] Depend on Figure 13 It was found that the cellulase activity of Aspergillus flavus HNZY01 initially increased and then decreased with increasing NaCl concentration, reaching a peak at 1 g / L (73.0 U / mL). Appropriate amounts of NaCl... + It helps maintain cell osmotic balance and metabolic activity, thereby promoting cellulase synthesis; however, when the concentration is too high, osmotic stress will inhibit cell growth and enzyme secretion.

[0171] 3.2.2 PB Test

[0172] Based on the results of single-factor experiments, this study employed a Plackett-Burman (PB) experimental design to analyze the significance of seven culture medium components affecting the cellulase activity of Aspergillus flavus HNZY01: corn husk concentration (X1), KNO3 concentration (X2), Tween 80 concentration (X3), K2HPO4 concentration (X4), MgSO4 concentration (X5), CaCl2 concentration (X6), and NaCl concentration (X7). The high (+1) and low (1) levels for each factor were set based on the single-factor optimization results. A total of 15 experimental combinations were designed to evaluate the significance of each component's influence on cellulase activity. The experimental results are detailed in Table 5.

[0173] Table 5. PB Experimental Design and Results

[0174]

[0175] The above experimental results were subjected to regression fitting using computational analysis software, and the resulting regression equation is: enzyme activity = 88.3 - 0.831X1 + 1.468X2 + 1.243X3 + 2.318X4 + 3.19X5 + 2.71X6 + 1.49X7.

[0176] Table 6 Factor Levels and Statistical Analysis of PB Experimental Design

[0177]

[0178] According to the analysis of variance results in Table 6, the F-value of the regression model was 9.40, with a corresponding P-value of 0.007 (P < 0.01), indicating that the model was highly significant and could effectively reflect the effects of various factors on the cellulase activity of Aspergillus flavus HNZY01. Analysis showed that corn husk concentration had a negative effect on enzyme activity, suggesting the possible presence of inhibitory components; the remaining nutrients all showed positive effects, possibly improving conversion efficiency by promoting enzyme synthesis or enhancing metabolic activity. These results provide a basis for subsequent culture medium optimization.

[0179] Among the seven nutrients affecting the cellulase activity of Aspergillus flavus HNZY01, the concentrations of corn husk, Tween 80, and K2HPO4 had significant effects and were key factors in regulating the enzyme production process; while the effects of KNO3, MgSO4, CaCl2, and NaCl were not significant. Therefore, subsequent optimization will focus on the concentrations of corn husk, Tween 80, and K2HPO4 to increase enzyme yield; the remaining four components will be further validated in a scaling-up experiment based on the optimal levels determined by single-factor experiments to comprehensively optimize the culture medium composition.

[0180] 3.2.3 Steepest Climb Test

[0181] Based on the PB experiment results, three factors significantly affecting the cellulase activity of Aspergillus flavus HNZY01 were identified: corn husk concentration, Tween 80 concentration, and K2HPO4 concentration. A steepest climb experiment was then conducted. The direction of movement for each factor was based on the PB experiment results, and the step size was determined by combining the results of single-factor experiments with practical experience. Other non-significant factors were fixed at the optimal concentration obtained from single-factor optimization. Specific experimental design and results are shown in Table 7.

[0182] Table 7. Experimental Design and Results for the Steepest Climb

[0183]

[0184] According to the results in Table 7, in the steepest climbing experiment, the cellulase activity of Aspergillus flavus HNZY01 showed a parabolic trend, reaching its highest value (93.5 U / mL) in group 4, indicating that the concentrations of each component in the culture medium in this group were within the optimal range for enzyme production. Therefore, the component concentrations in group 4 were selected as the center point for subsequent response surface methodology design to further optimize the culture medium composition and improve enzyme yield.

[0185] 3.2.4 Response Surface Analysis

[0186] Based on the results of the PB test and steepest climbing test of Aspergillus flavus HNZY01, three factors were selected: corn husk concentration (X1), Tween 80 concentration (X1), and dipotassium hydrogen phosphate concentration (X3). A three-factor, three-level response surface experiment was constructed using response surface design. The specific design scheme is detailed in Table 8 below.

[0187] Table 8 Response Surface Design

[0188]

[0189] The response surface methodology and results of Aspergillus flavus HNZY01 are shown in Table 9 below. The experimental data were analyzed using computational analysis software, and the following multiple quadratic regression equations were obtained for cellulase activity (Y) versus corn husk concentration (X1), Tween 80 concentration (X2), and K2HPO4 concentration (X3):

[0190] Y =-804+29.68X1+8.02X2+68.6X3-0.2608X1 2 -0.805X2 2 -5.42X3 2 -0.025X1X2-0.760X1X3+0.625X2X3.

[0191] Table 9 Response Surface Design and Results

[0192]

[0193] The results of the analysis of variance based on the response surface methodology are shown in Table 10 below. The regression model is highly significant (F=19.76, P<0.001), and the lack-of-fit term is not significant (P=0.424), indicating a good model fit. The R-squared value of the model... 2 The accuracy is 99.2%, and the corrected R... 2 The accuracy rate was 98.3%, indicating that the model can accurately reflect the relationship between corn husk concentration, Tween 80 concentration, K2HPO4 concentration and cellulase activity, and can be used to optimize the formulation of Aspergillus flavus HNZY01 fermentation medium.

[0194] Table 10 Analysis of Variance of Regression Model

[0195]

[0196] Based on the Box-Behnken design experimental results, computational analysis software was used to optimize the fermentation medium for cellulase production by Aspergillus flavus HNZY01. The optimal medium composition for cellulase production by Aspergillus flavus HNZY01 was determined to be: corn husk 52.3 g / L, Tween 80 5.3 g / L, and K2HPO4 2.9 g / L. Under these conditions, the model predicted an enzyme activity of 95.3 U / mL, and the actual enzyme activity measured in the validation experiment was 96.7 U / mL, with a relative error of 2%, indicating good model prediction performance. Compared with the unoptimized medium (enzyme activity 61.9 U / mL), the optimized medium increased the enzyme activity to 1.6 times the original level, demonstrating the effectiveness and significance of the optimization strategy.

[0197] Example 4: Optimization of culture conditions for cellulase production by Aspergillus flavus HNZY01

[0198] 4.1 Single-factor optimization

[0199] The effects of initial pH, inoculum size, culture volume, rotation speed, temperature, and culture time on the activities of cellulases (CMCase, βGase, FPA) in Aspergillus flavus HNZY01 were systematically investigated through single-factor experiments. Specific factor levels are shown in Table 11 below. The basic culture conditions were: 50 mL of culture medium in a 250 mL Erlenmeyer flask, inoculum size 5% (v / v), cultured at 30℃ with shaking at 180 r / min for 72 h. After culture, the activities of each enzyme were measured to evaluate enzyme production efficiency.

[0200] Table 11 Single-factor optimization design of cultivation conditions

[0201]

[0202] 4.1.1 Effect of initial pH on cellulase activity of Aspergillus flavus HNZY01

[0203] Seven different pH levels (4, 5, 6, 7, 8, 9, and 10) were set up in the liquid enzyme-producing medium. Spore suspensions of *Aspergillus flavus* HNZY01 were inoculated into these media, and other conditions were kept constant. The enzyme production of this strain at different pH levels was measured, and the results are as follows: Figure 14 As shown.

[0204] Figure 14 The figure shows the effect of the initial pH of the culture medium on the cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0205] Depend on Figure 14 It can be seen that the initial pH value has a significant impact on the cellulase activity of Aspergillus flavus HNZY01. As the pH value gradually increases, the enzyme activity initially shows an upward trend; when the pH value reaches a certain critical point, the enzyme activity begins to decrease. Specifically, the enzyme activity is low in a strongly acidic environment (pH 45); as the pH value rises to the slightly acidic range (56), the enzyme activity value continuously increases, reaching a maximum of 100.6 U / mL at pH 6; when the pH value exceeds 7 and enters the slightly alkaline range, the enzyme activity value gradually decreases; it drops to a minimum of 65.0 U / mL at pH 9.

[0206] 4.1.2 Effect of inoculum size on cellulase activity of Aspergillus flavus HNZY01

[0207] Five inoculum levels (1%, 3%, 5%, 7%, and 10%) were set up. Spore suspensions of *Aspergillus flavus* HNZY01 were inoculated into liquid enzyme-producing medium at different inoculum levels, while other culture conditions remained constant. The effect of different inoculum levels on enzyme production by the strain was determined, and the results are as follows: Figure 15 As shown.

[0208] Figure 15The figure shows the effect of inoculum amount on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0209] Depend on Figure 15 It was found that the inoculum size significantly affected the enzyme activity of Aspergillus flavus HNZY01. With increasing inoculum size, the enzyme activity initially increased and then decreased. Specifically, the cellulase activity reached its maximum value (103.5 U / mL) at an inoculum size of 7%, showing a significant difference compared to other inoculum size levels (P<0.05). The activity was lowest at an inoculum size of 1% (64.4 U / mL), decreasing after exceeding 7%, reaching 95.4 U / mL at 10%.

[0210] 4.1.3 Effect of liquid volume on cellulase activity of Aspergillus flavus HNZY01

[0211] Six inoculum volumes were set up (12.5 mL / 250 mL, 25 mL / 250 mL, 37.5 mL / 250 mL, 50 mL / 250 mL, 62.5 mL / 250 mL, and 75 mL / 250 mL). Spore suspensions of *Aspergillus flavus* HNZY01 were inoculated into liquid enzyme-producing medium at different inoculum volumes. The enzyme production of the strain at each inoculum volume was then measured. The results are as follows: Figure 16 As shown.

[0212] Figure 16 The figure shows the effect of liquid volume on the cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0213] Depend on Figure 16 It was found that the cellulase activity of Aspergillus flavus HNZY01 initially increased and then decreased with increasing solution volume. The enzyme activity reached its peak (100.6 U / mL) at a solution volume of 37.5 mL / 250 mL, indicating that the dissolved oxygen level was suitable under these conditions, which was beneficial for cell growth and enzyme production. Too low a solution volume may lead to insufficient nutrients, while too high a volume may cause oxygen restriction or nutrient dilution, thereby inhibiting enzyme synthesis.

[0214] 4.1.4 Effect of rotational speed on cellulase activity of Aspergillus flavus HNZY01

[0215] Five different rotation speeds (120 r / min, 140 r / min, 160 r / min, 180 r / min, and 200 r / min) were set up. Spore suspensions of *Aspergillus flavus* HNZY01 were inoculated into liquid enzyme-producing medium at different inoculum amounts. The enzyme production of the strain at each rotation speed was then measured. The results are as follows: Figure 17 As shown.

[0216] Figure 17 The figure shows the effect of rotation speed on the cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0217] Depend on Figure 17 It was found that the cellulase activity of Aspergillus flavus HNZY01 first increased and then decreased with increasing rotation speed, reaching a peak at 200 r / min (107.7 U / mL). Appropriate rotation speed is beneficial to increase dissolved oxygen, promoting cell growth and enzyme production; however, excessive rotation speed may lead to supersaturation of dissolved oxygen or increased shear force, inhibiting enzyme synthesis.

[0218] 4.1.5 Effect of temperature on cellulase activity of Aspergillus flavus HNZY01

[0219] Five different culture temperature conditions were set up (25℃, 30℃, 35℃, 40℃, and 45℃). Spore suspensions of *Aspergillus flavus* HNZY01 were inoculated into liquid enzyme-producing medium at an inoculum size of 7%, and the cellulase yield was measured under each temperature condition. The results are as follows: Figure 18 As shown.

[0220] Figure 18 The figure shows the effect of temperature on the cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0221] Depend on Figure 18 It was found that the culture temperature significantly affected the cellulase activity of Aspergillus flavus HNZY01. Specifically, the enzyme activity reached its peak at 30℃ (97.7 U / mL), and decreased at both lower (25℃) and higher (35-45℃) temperatures, reaching its lowest level (56.7 U / mL) at 45℃. A suitable temperature is beneficial for maintaining enzyme activity and reaction efficiency.

[0222] 4.1.6 Effect of culture time on cellulase activity of Aspergillus flavus HNZY01

[0223] A 7% inoculum of Aspergillus flavus spore suspension was inoculated into liquid enzyme-producing medium and incubated at 30℃ and 180 rpm. Samples were taken every 24 hours after inoculation to determine cellulase production for 7 days. The results are as follows: Figure 19 As shown.

[0224] Figure 19 The figure shows the effect of culture time on cellulase activity of Aspergillus flavus HNZY01 in an embodiment of the present invention.

[0225] Depend on Figure 19 It can be seen that the cellulase activity of Aspergillus flavus HNZY01 showed a trend of first increasing and then decreasing with the extension of culture time. The enzyme activity reached its peak (99.0 U / mL) on the 3rd day of culture. In the early stage of culture (day 1, 34.1 U / mL), the bacteria were in the adaptation period, while in the later stage (>3 days), the enzyme activity decreased due to nutrient consumption and metabolite accumulation.

[0226] 4.2 PB Test Optimization

[0227] Based on the results of single-factor experiments with Aspergillus flavus HNZY01, the PB experimental design method was used to screen key factors in the fermentation enzyme production medium, including initial pH (X1), inoculum size (X2), liquid volume (X3), temperature (X4), and culture time (X5). The high (+1) and low (1) levels of each factor were set according to the single-factor optimization results. A total of 15 experimental combinations were designed to evaluate the significance of the influence of each factor on cellulase activity. The experimental results are detailed in Table 12 below.

[0228] Table 12 PB Experimental Design and Results

[0229]

[0230] Regression analysis was performed on the experimental data using computational analysis software, and the regression equations between enzyme activity (Y) and various factors are as follows:

[0231] Y=-8.04+1.358X1+0.077X2-0.0367X3+1.355X4+11.592X5.

[0232] Analysis of variance (see Table 13 below) showed that the model was highly significant (F = 213.81, p < 0.001), indicating that the model can effectively reflect the effects of various culture conditions on the cellulase activity of Aspergillus flavus HNZY01. This result further indicates that different culture conditions have varying effects on the cellulase activity of Aspergillus flavus HNZY01. Specifically, the culture volume had a negative effect on enzyme activity, suggesting that excessive culture volume may lead to insufficient oxygen supply, thereby inhibiting enzyme production; while other factors generally showed positive effects, indicating that they can effectively promote enzyme synthesis and activity. These findings provide important theoretical basis for subsequent culture medium optimization and enzyme production.

[0233] Table 13 Factor Levels and Effects Analysis of PB Experimental Design

[0234]

[0235] Of the five culture conditions investigated, initial pH, temperature, and culture time significantly affected cellulase activity, while inoculum size and liquid volume had no significant effect. Future optimization will focus on initial pH, temperature, and culture time; inoculum size and liquid volume will be fixed at their single-factor optimal levels, and their potential impact will be assessed through a scaling-up experiment.

[0236] 4.3 Optimization of the steepest climb test

[0237] Based on the PB experiment results, three factors that significantly affect cellulase activity—initial pH, temperature, and culture time—were selected for the steepest climbing experiment. The direction of movement for each factor was determined based on the PB experiment results, and the step size was set by combining the results of single-factor experiments with practical experience; non-significant factors were fixed at their single-factor optimal levels. The specific experimental design and results are shown in Table 14 below.

[0238] Table 14. Experimental Design and Results for the Steepest Climb

[0239]

[0240] According to the data in Table 14, the cellulase activity of Aspergillus flavus HNZY01 showed a trend of first increasing and then decreasing in the steepest climbing test, reaching a peak in group 4 (118.9 U / mL), indicating that the culture conditions in this group were within the optimal range for enzyme production. Therefore, the parameters of group 4 were selected as the center point for subsequent response surface methodology experiments.

[0241] 4.4 Response Surface Experiment

[0242] Based on the results of the PB experiment and the steepest climbing experiment, three factors that significantly affected the cellulase activity of Aspergillus flavus HNZY01 were selected: initial pH (X1), temperature (X2), and culture time (X3). A Box-Behnken design was used for response surface methodology optimization. Using the optimal conditions obtained from the steepest climbing experiment (Group 4) as the center point, 17 experimental schemes were constructed, including 5 center point replicates. The specific design is shown in Table 15 below. This design aims to further clarify the influence of each factor and its interactions on the cellulase activity of the strain by systematically optimizing the above-mentioned factor combinations, providing a scientific basis for the precise regulation of enzyme production conditions in Aspergillus flavus HNZY01.

[0243] Table 15 Box Behnken Experimental Design

[0244]

[0245] The response surface methodology and results of Aspergillus flavus HNZY01 are listed in Table 16 below. The experimental data were analyzed using computational analysis software, and a multiple quadratic regression equation was established between cellulase activity (Y) and initial pH (X1), temperature (X2), and culture time (X3):

[0246] Y =﹣4949+713.6X1+164.9X2+2.18X3-59.35X1 2 -2.65X2 2 - 0.00946X3 2 +1.52X1X2+0.092X1X3-0.0408X2X3.

[0247] Meanwhile, based on the analysis of variance results of the Box Behnken experiment in Table 17, the F-value of the regression equation was 70.03 (P < 0.001), indicating that the model was highly statistically significant. The P-value for the lack-of-fit term was 0.285 (> 0.05), further validating the applicability of the model. Furthermore, the coefficient of determination R² of the regression equation was 98.9%, and the adjusted coefficient of determination R... 2 Adj The accuracy rate of 97.5% indicates that the model fits the data well and accurately reflects the nonlinear relationship between cellulase activity and culture conditions. In summary, this multiple quadratic regression model can provide a scientific basis for optimizing the initial pH, temperature, and culture time during the fermentation of Aspergillus flavus HNZY01, and supports subsequent experimental design and process improvement.

[0248] Table 16 BoxBehnken Design and Results

[0249]

[0250] Table 17 Analysis of Variance for Regression Models

[0251]

[0252] Based on the Box-Behnken design experimental results, the optimal culture conditions for Aspergillus flavus HNZY01 were systematically optimized using computational analysis software. The optimal culture conditions for Aspergillus flavus HNZY01 were determined to be: initial pH 6.5, temperature 32.4℃, and culture time 76.6 h. Under these conditions, the predicted cellulase activity was 121.5 U / mL. To verify the reliability of the model, the experiment was repeated under the optimal conditions, and the actual measured cellulase activity was 122.7 U / mL. The relative error between the measured and predicted values ​​was only 2%, with no significant difference (P > 0.05). This indicates that the established model has high accuracy and practicality and can provide reliable guidance for the industrial production of microbial enzymes.

[0253] Application Example 1: Degradation of tobacco stems by Aspergillus flavus HNZY01

[0254] 1.1 Pretreatment of tobacco stems

[0255] Accurately weigh 10.00 g of tobacco stem sample into a 2L stoppered conical flask and pretreat it using a stepwise water extraction method: add 1L of distilled water preheated to 80±0.5℃ successively, and extract in a constant temperature shaker (120rpm) for 1h and 30min respectively. After filtration, discard the extract, and dry the residue at 105℃ to constant weight to obtain the pretreated tobacco stem matrix, which is then dried and stored.

[0256] 1.2 In vitro enzymatic digestion test

[0257] Accurately weigh the pretreated sample into a 50 mL Erlenmeyer flask, and calculate and add the corresponding volume of enzyme solution based on the cellulase activity assay results. Then, add pH 5.0, 50 mmol / L citrate-sodium citrate buffer to bring the volume to the specified level, making the material-to-liquid ratio 1:30. The following experimental groups were set up: a blank control group (buffer solution replaced the enzyme solution) and an enzymatic hydrolysis group (50 U / mL cellulase, 30.5 U / mL xylanase). All samples were sealed and enzymatically hydrolyzed at 50℃ and 120 rpm in a water bath for 5 h. The hydrolysate was used to determine the reducing sugar content; the hydrolysate residue, after drying, was used to determine the cellulose, hemicellulose, and lignin content. The results are shown in Table 18 below.

[0258] Table 18 Effects of Enzymatic Hydrolysis of Tobacco Stems

[0259]

[0260] Table 18 shows that after enzymatic hydrolysis by xylanase and cellulase, the contents of cellulose, hemicellulose, and lignin in tobacco stems decreased to varying degrees. The degradation rate of cellulose was 16.5%, the degradation rate of hemicellulose was 14.3%, and the degradation rate of lignin was 27.1%, while the reducing sugar content increased from 0.6% to 8.6%. This indicates that Aspergillus flavus HNZY01 has a certain effect on degrading tobacco stems. Furthermore, since no purification treatment was performed, a small amount of other enzymes may have been present during enzymatic hydrolysis in addition to the two enzymes mentioned above, resulting in a higher lignin degradation rate.

[0261] 1.3 Degradation of tobacco stems by Aspergillus flavus strain HNZY01

[0262] Aspergillus flavus HNZY01 was cultured on PDA medium at 30℃ for 5 days. A spore suspension was prepared using sterile physiological saline and adjusted to 1×10⁻⁶. 8 CFU / mL. A 7% inoculum was added to an optimized fermentation medium with tobacco stems as the sole carbon source, and cultured at 32.4℃ and 200 rpm for 10 days with shaking. After fermentation, the solid and liquid phases were separated by filtration: the solid residue was dried and used for the determination of cellulose, hemicellulose, and lignin content; the fermentation broth was centrifuged at 10000 rpm for 5 min for enzyme activity determination. The results are shown in Table 19 below.

[0263] Table 19 Changes in the composition of the culture medium after fermentation of tobacco stems with Aspergillus flavus HNZY01

[0264]

[0265] Table 19 shows that when tobacco stems were used as the sole carbon source, *Aspergillus flavus* HNZY01 secreted xylanase and cellulase, with enzyme activities of 28.9 U / mL and 65.9 U / mL, respectively. The reducing sugar content in the culture medium decreased significantly after fermentation, indicating that the strain utilized reducing sugars during growth. The determination of tobacco stem components showed that the cellulose degradation rate reached 73.1%, the hemicellulose degradation rate was 33.3%, and the lignin degradation rate was 59%, indicating that this strain has a significant degradation effect on tobacco stems through fermentation.

[0266] This invention successfully screened Aspergillus flavus strain HNZY01 and established the optimal fermentation process for enzyme production by systematically optimizing key components and cultivation parameters of its fermentation medium, significantly enhancing the cellulase activity of the strain. Further application of the produced enzyme preparation or strain directly to tobacco stem degradation showed that it can synergistically and efficiently hydrolyze cellulose, hemicellulose, and even some lignin. This synergistic effect far exceeds the effect of single enzyme treatment, achieving not only deep conversion of tobacco stem components and effective enrichment of reducing sugars, but also providing a novel biological solution for tobacco stem treatment. Based on its significant characteristics of high efficiency and environmental friendliness, this technology shows broad prospects for industrial application in the field of tobacco waste resource utilization.

[0267] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A type of Aspergillus flavus ( Aspergillus flavus HNZY01, characterized in that, It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 42147.

2. The Aspergillus flavus of claim 1 ( Aspergillus flavus The application of HNZY01 is characterized by, It is at least one of the following: (1) Production of carboxymethyl cellulase; (2) Production of β-glucosidase; (3) Production of xylanase; (4) Production of filter paper enzyme system.

3. The Aspergillus flavus of claim 1 ( Aspergillus flavus The application of HNZY01 is characterized by, It is at least one of the following: (1) Degradation of cellulose; (2) Degradation of lignin; (3) Degradation of hemicellulose; (4) Degrading cellulose, hemicellulose and / or lignin in tobacco stems; (5) Increase the reducing sugar content in tobacco stems.

4. A method for producing an enzyme, characterized in that, Includes the Aspergillus flavus of claim 1 ( Aspergillus flavus The steps for collecting enzyme products after inoculating HNZY01 into the culture medium and culturing it; The enzyme product includes at least one of carboxymethyl cellulase, β-glucosidase, or xylanase.

5. The method according to claim 4, characterized in that, The culture medium meets at least one of the following conditions: (1) The initial pH of the culture medium is 6-8; (2) The inorganic salts in the culture medium include 2-4 g / L of K2HPO4; (3) The culture medium contains 4~8 g / L of surfactant; (4) The culture medium includes a surfactant, which includes at least one of glycerol, Tween-60 or Tween-80; (5) The culture medium contains 6-8 g / L of nitrogen source, which includes at least one of KNO3, NaNO3 or NH4Cl.

6. The method according to claim 4, characterized in that, At least one of the following conditions must be met: (1) The incubation period is 3 to 5 days; (2) The culture temperature is 30℃~35℃.

7. A method for degrading cellulose in tobacco stems, characterized in that, Includes the Aspergillus flavus of claim 1 ( Aspergillus flavus The steps for inoculating HNZY01 into tobacco stems for culture.

8. A composition, characterized in that, The composition contains the Aspergillus flavus of claim 1 ( Aspergillus flavus )HNZY01.

9. The composition according to claim 8, characterized in that, The composition is a microbial agent.

10. A culture, characterized in that, Including the Aspergillus flavus of claim 1 ( Aspergillus flavus HNZY01 and a culture medium comprising K2HPO4, Tween-80, KNO3, MgSO4, CaCl2 and NaCl.

Images