SiRNA for inhibiting ASGR1 expression and application thereof
By designing siRNA that specifically inhibits ASGR1 gene expression and using GalNAc derivatives and LNP vectors for targeted delivery, the problem of ASGR1 dysfunction in NAFLD treatment has been solved, achieving effective lipid regulation and disease control, with significant therapeutic effects and application potential.
Patent Information
- Application Number
- CN202511521992.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-23
- Publication Date
- 2026-02-27
AI Technical Summary
The existing treatment options for non-alcoholic fatty liver disease (NAFLD) are limited, and the existing interventions are not effective enough, leading to the progression of the disease to more severe forms. Impaired expression and function of the ASGR1 gene are key factors, and RNAi therapy has issues with cell penetration and stability.
We designed siRNAs that specifically inhibit ASGR1 gene expression and used GalNAc derivatives or lipid nanoparticles (LNPs) as carriers to achieve targeted delivery of siRNAs, enhance intracellular delivery and stability, selected siASGR1-1 and siASGR1-2 as preferred sequences, and combined them with GalNAc-L96 ligands and LNP carriers to improve the bioavailability of siRNAs.
It significantly inhibits ASGR1 gene expression, reduces blood lipids, treats lipid disorders, improves the stability and therapeutic effect of siRNA, reduces side effects, and has broad application prospects.
Smart Images

Figure CN121574980A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to an siRNA for inhibiting the expression of ASGR1 gene and its application, and belongs to the technical field of molecular biology. BACKGROUND
[0002] As the most prevalent chronic liver disease, nonalcoholic fatty liver disease (NAFLD) affects approximately one-quarter of the global population, but treatment options remain limited, posing a major public health challenge. Currently, the main clinical intervention for managing NAFLD is through lifestyle changes. However, the therapeutic effects of these interventions are often insufficient, leading to progression of the disease to more severe forms, including steatohepatitis, cirrhosis, and related metabolic comorbidities, ultimately resulting in high mortality rates.
[0003] The multiple-hit theory emphasizes the key role of metabolic dyslipidemia in the early stages of NAFLD, although the biological pathogenesis has not yet been fully deciphered. Uncontrolled accumulation of lipid droplets is mainly due to increased influx and impaired breakdown of intraliver triglycerides. This lipid accumulation in the liver subsequently triggers endoplasmic reticulum stress, organelle dysfunction, cell damage, and chronic inflammation. Interventions targeting abnormal lipid accumulation appear to be a controllable treatment method. Therefore, molecules related to lipid accumulation have become attractive targets for NAFLD treatment.
[0004] RNA interference (RNAi) therapy is a method of silencing specific target genes to block their protein expression in vivo, and some RNAi technologies have been proven to be useful for treating diabetes, myocardial ischemia, acute lung injury cancer.
[0005] Asialoglycoprotein receptor 1 (ASGR1) is the main subunit of ASGPR (also known as Ashwell-Morell receptor, Ashwell receptor or hepatic lectin), which is highly conserved in mammals. It is a transmembrane protein specifically expressed in hepatocytes, which plays a key role in maintaining the homeostasis of circulating glycoproteins; by binding to terminal galactose / N-acetylgalactosamine, ASGR1 mediates the endocytosis and lysosomal degradation of circulating asialoglycoproteins, thereby participating in various biological functions. Currently, there are studies that have found that the ASGR1 gene exists ASGR1 del12 mutant, characterized by the deletion of the 12th base pair in the fourth intron, resulting in a frameshift mutation that activates the stop codon prematurely, showing impaired expression and function of ASGR1.
[0006] RNAi therapy has a wide range of druggable targets, with high specificity, enabling precise and personalized therapy, high safety, long-lasting effect, faster and higher success rate of development, and relatively low manufacturing cost. Inhibition of ASGR1 expression by RNAi is expected to prevent the development of nonalcoholic fatty liver. SUMMARY
[0007] The present application aims to overcome some defects in the prior art, and provides an siRNA for inhibiting ASGR1 gene expression and application thereof.
[0008] To achieve the above technical purposes, the technical scheme adopted by the present application comprises: The present application first provides an siRNA for inhibiting ASGR1 gene expression, which is selected from any one of the following (1) to (4): (1) a sense strand as shown in SEQ. ID. No: 1 and an antisense strand as shown in SEQ. ID. No: 2; (2) a sense strand as shown in SEQ. ID. No: 3 and an antisense strand as shown in SEQ. ID. No: 4; (3) a sense strand as shown in SEQ. ID. No: 5 and an antisense strand as shown in SEQ. ID. No: 6; (4) a sense strand as shown in SEQ. ID. No: 7 and an antisense strand as shown in SEQ. ID. No: 8.
[0009] Preferably, the siRNA is selected from any one of the following: (1) a sense strand as shown in SEQ. ID. No: 1 and an antisense strand as shown in SEQ. ID. No: 2; (2) a sense strand as shown in SEQ. ID. No: 3 and an antisense strand as shown in SEQ. ID. No: 4.
[0010] More preferably, the sense strand of the siRNA is as shown in SEQ. ID. No: 1, and the antisense strand is as shown in SEQ. ID. No: 2.
[0011] The sequence information of SEQ. ID. Nos: 1 to 8 is as follows: SEQ. ID. No: 1: 5'-AUUAAAGGAGAGGUGGCUCCU-3', SEQ. ID. No: 2: 5'-GAGCCACCUCUCCUUUAAUUU-3'; SEQ. ID. No: 3: 5'-CCUGAGAGAGACGUUCAGCAA-3', SEQ. ID. No: 4: 5'-UUGCUGAACGUCUCUCUCAGG-3'; SEQ. ID. No: 5: 5'-ACUACGAGACGGGCUUCAAGA-3', SEQ.ID.No: 6: 5'-UCUUGAAGCCCGUCUCGUAGU-3'; SEQ.ID.No:7:5'-CAGAAGGACCUGAGUGAAGAU-3', SEQ.ID.No: 8: 5'-AUCUUCACUCAGGUCCUUCUG-3'.
[0012] Note: According to the sequence list submission requirements, "u" in the above sequence is represented by "t" in the sequence list.
[0013] Preferably, the siRNA that inhibits ASGR1 gene expression according to the present invention includes a sense strand as shown in SEQ.ID.No:1 and an antisense strand as shown in SEQ.ID.No:2.
[0014] The present invention also provides a siRNA inhibitor that inhibits ASGR1 gene expression, wherein the inhibitor comprises the siRNA.
[0015] According to embodiments of the present invention, siRNA, as a negatively charged small RNA molecule, has certain shortcomings in its actual function. For example, it exhibits electrostatic repulsion with the equally negatively charged cell membrane, making it difficult to autonomously penetrate the barrier and enter the cell. Furthermore, it is easily degraded rapidly by nucleases in vivo, resulting in an extremely short half-life and hindering its effective function. The carrier used in this invention can protect siRNA from degradation and overcome the electrostatic repulsion of the cell membrane for intracellular delivery through encapsulation and modification. It can also help siRNA target specific cells or tissues, thereby significantly improving the stability and efficacy of siRNA in vivo.
[0016] Therefore, the siRNA inhibitor further includes a ligand or a carrier; preferably, the ligand or carrier includes lipid nanoparticles (LNP), GalNAc, or GalNAc derivatives; more preferably, the ligand is conjugated to the 3′ end of the positive strand of the siRNA.
[0017] According to one embodiment of the present invention, the ligand is preferably GalNAc-L96.
[0018] The present invention also provides a pharmaceutical composition comprising the siRNA described above.
[0019] Furthermore, the pharmaceutical composition also contains LNP, GalNAc, or a GalNAc derivative.
[0020] The present invention also provides the use of the siRNA, the siRNA inhibitor, or the pharmaceutical composition in the preparation of a medicament for the prevention or treatment of lipid disorders, hyperlipidemia, non-alcoholic fatty liver disease, or high cholesterol.
[0021] This invention also provides a method for inhibiting ASGR1 gene expression for non-therapeutic purposes, wherein the method... The method includes administering the siRNA, the inhibitor, or the pharmaceutical composition to the sample.
[0022] The beneficial effects of this invention are: This invention provides siRNA molecules that significantly inhibit ASGR1 gene expression. Experimental verification shows that the four siRNAs provided by this invention can efficiently inhibit ASGR1 gene expression, with siASGR1-1 and siASGR1-2 showing more significant inhibitory effects. Furthermore, through vector or ligand delivery, ASGR1 mRNA levels are significantly downregulated, and protein expression is significantly inhibited. Cellular and animal experiments have verified that the siRNA molecules provided by this invention can significantly treat lipid disorders, lower blood lipids, and inhibit or treat cholesterol. The siRNA molecules of this invention can target and recognize target cells or tissues, thereby increasing bioavailability, reducing side effects, and improving the stability of siRNA drugs, showing broad application prospects. Attached Figure Description
[0023] Figure 1 This is a graph showing the relative expression level of ASGR1 mRNA in HepG2 cells detected by RT-qPCR. *P<0.001.
[0024] Figure 2 This is a graph showing the expression level of ASGR1 protein in HepG2 cells as detected by Western blotting.
[0025] Figure 3 This is a grayscale analysis image of ASGR1 protein in HepG2 cells detected by Western blotting.
[0026] Figure 4 This is a flowchart of the preparation process of siASGR1-LNP.
[0027] Figure 5 This is a flowchart of the preparation process of siASGR1-GalNAc.
[0028] Figure 6 This is a TEM image of siASGR1-LNP.
[0029] Figure 7 This is the particle size distribution of siASGR1-LNP.
[0030] Figure 8 This is the mass spectrum of siASGR1-GalNAc.
[0031] Figure 9This is a graph showing the expression level of TC in mouse serum after siRNA was loaded with a vector. *P<0.001.
[0032] Figure 10 This is a graph showing the expression level of TG in mouse serum after siRNA was loaded with a vector. *P<0.001.
[0033] Figure 11 This is a graph showing the expression level of HDL-c in mouse serum after siRNA was loaded with a vector. *P<0.001.
[0034] Figure 12 This is a graph showing the expression level of LDL-c in mouse serum after siRNA was loaded with a vector. *P<0.001.
[0035] Figure 13 This is a graph showing the expression level of ASGR1 mRNA in mouse liver tissue detected by RT-qPCR.
[0036] Figure 14 This is a graph showing the expression level of ASGR1 protein in mouse liver tissue as detected by Western blotting.
[0037] Figure 15 This is a graph showing the change in mouse body weight in the results of siASGR1 treatment efficacy verification. *P<0.001.
[0038] Figure 16 This is a graph showing the mouse body weight / liver mass ratio in the efficacy verification results of siASGR1 treatment. *P<0.001.
[0039] Figure 17 This is a graph showing the expression level of TC in mouse serum during the efficacy verification of siASGR1 treatment. *P<0.001.
[0040] Figure 18 This is a graph showing the expression level of TG in mouse serum during the efficacy verification of siASGR1 treatment. *P<0.001.
[0041] Figure 19 This is a graph showing the expression level of HDL-C in mouse serum during the efficacy verification of siASGR1 treatment. *P<0.001.
[0042] Figure 20 This is a graph showing the expression level of LDL-C in mouse serum during the efficacy verification of siASGR1 treatment. *P<0.001.
[0043] Figure 21 This is a graph showing the expression level of FFA in mouse serum during the efficacy verification of siASGR1 treatment. *P<0.001.
[0044] Figure 22This is a graph showing the expression level of ApoB in mouse serum during the efficacy verification of siASGR1 treatment. *P<0.001.
[0045] Figure 23 This is a graph showing the serum ALT expression level in mice in the results of siASGR1 treatment efficacy verification. *P<0.001.
[0046] Figure 24 This is a graph showing the expression level of AST in mouse serum during the efficacy verification of siASGR1 treatment. *P<0.001.
[0047] Figure 25 These are images of mouse livers stained with HE and Oil Red O in the results of siASGR1 treatment efficacy verification. Detailed Implementation
[0048] To enable those skilled in the art to better understand the technical solutions of the present invention, the preferred embodiments of the present invention will be described in detail below. However, the following embodiments do not limit the scope of protection of the present invention.
[0049] In the embodiments of the present invention, unless otherwise described, conventional molecular biology experimental methods were used. The processes involved in the embodiments, such as PCR, enzyme digestion, ligation, and codon optimization, are all understandable and easily implemented by those skilled in the art based on product instructions or basic knowledge in the field, and therefore will not be described in detail.
[0050] Example 1: Acquisition and Screening of siRNA S1: Obtaining siRNA: Based on the known ASGR1 sequences in the database (Gene ID: 432, NM_001197216.3, NM_001671.5), siRNAs were designed, targeting different siRNA target sites in the coding region: siASGR1-1, siASGR1-2, siASGR1-3, and siASGR1-4. Information for each siRNA sequence is as follows: siASGR1-1: Chain of Justice: 5'-AUUAAAGGAGAGGUGGCUCCU-3' (SEQ.ID.No: 1) Antonym: 5'-GAGCCACCUCUCCUUUAAUUU-3' (SEQ.ID.No: 2) siASGR1-2: Chain of Justice: 5'-CCUGAGAGAGACGUUCAGCAA-3' (SEQ.ID.No: 3) Antonym: 5'-UUGCUGAACGUCUCUCUCAGG-3' (SEQ.ID.No: 4) siASGR1-3: Chain of Justice: 5'-ACUACGAGACGGGCUUCAAGA-3' (SEQ.ID.No: 5) Antonym: 5'-UCUUGAAGCCCGUCUCGUAGU-3' (SEQ.ID.No: 6) siASGR1-4: Chain of Justice: 5'-CAGAAGGACCUGAGUGAAGAU-3' (SEQ.ID.No: 7) Antonym: 5'-AUCUUCACUCAGGUCCUUCUG-3' (SEQ.ID.No: 8).
[0051] In the embodiments of the present invention, the synthesized siRNA is dissolved in citrate buffer. On the one hand, the buffer can stabilize the pH value and maintain a suitable ion concentration (such as specific metal ions), thereby eliminating the interference of external environmental fluctuations on the binding process. For example, it can prevent extreme pH from damaging the structure of siRNA or the vector, and weaken the electrostatic repulsion between siRNA and the vector (or enhance the specific binding force) through ion regulation, thus creating a basis for efficient binding between the two. On the other hand, the buffer can maintain the biological activity of siRNA and the vector, prevent them from becoming ineffective due to dehydration, denaturation, etc., and at the same time allow the two to fully contact in a homogeneous liquid environment, ensuring the formation of a stable and homogeneous binding complex, which is ready for subsequent in vivo delivery.
[0052] S2: Transiently transfect siRNA targeting ASGR1. Cell culture: HepG2 cells (Wuhan Zishan Biotechnology Co., Ltd.) were grown to near confluence in DMEM high-glucose complete medium containing 10% FBS at 37°C and in a 5% CO2 atmosphere.
[0053] Transfection system preparation: Dilute 5 µL of siRNA (20 µM) with 125 µL of Opti-MEM (Beijing Innovent Biologics Inc.) medium. The experimental groups were diluted with siASGR1-1, siASGR1-2, siASGR1-3, and siASGR1-4 respectively. The negative control group was diluted with siRNA-control, and the mock group was diluted with PBS. Dilute 5 µL of Lipo8000 transfection reagent (Beyotime Biotechnology Co., Ltd.) with 125 µL of Opti-MEM medium. The two dilutions were mixed to prepare a 250 µL transfection premix.
[0054] The siRNA-control sequence is as follows: 5'-GTAAATCTATGTCGGAACCATCTTA-3' (SEQ. ID. No: 9).
[0055] Transfection procedure: HepG2 cells were transfected at a rate of 10 per well. 5 Cells were seeded at a density of [insert density here] into six-well plates. Once the cells reached approximately 50% confluence, the culture medium was replaced with serum-free medium. 250 µL of the transfection premixed solution was added to each of the experimental group, negative control group, and mock group and incubated at room temperature for 5 minutes before being added to the six-well plates and incubated in a cell culture incubator. Subsequent experiments were performed two days after transfection.
[0056] The effectiveness of the ASGR1 siRNA designed in this invention was verified by extracting total RNA from cells using the Trizol method, RT-qPCR, extracting total protein from cells, and Western blotting.
[0057] Trizol method for extracting total RNA from cells: (1) After digesting the cells in each well of the six-well plate with trypsin, centrifuge, remove the supernatant and collect the cell pellet in an EP tube. Add 1 mL of Trizol (Beijing Inokai Technology Co., Ltd.) to each tube and mix by pipetting repeatedly.
[0058] (2) Add 200µL of chloroform (Beijing Inokai Technology Co., Ltd.) to each tube, shake vigorously for 15 seconds, and let stand on ice for 10 minutes.
[0059] (3) After centrifugation at 4℃ and 12000rpm / min for 15min, the mixture in the tube is divided into 3 layers: the upper layer is a colorless aqueous phase containing RNA, the middle layer is a white flocculent layer containing protein and DNA, and the lower layer is a red layer containing phenol and chloroform.
[0060] (4) Take 400µL of the colorless liquid from the upper layer into an EP tube without RNase, add 400µL of isopropanol, gently invert and mix, and let stand on ice for 10 min.
[0061] (5) After centrifuging at 4℃ and 12000rpm / min for 10min, white RNA precipitate can be seen on the side and bottom of the EP tube.
[0062] (6) Discard the supernatant, add 1 mL of 75% ethanol (anhydrous ethanol: DEPC water = 3:1) (Beijing Innocare Technology Co., Ltd.) to wash the RNA precipitate, centrifuge at 4℃, 7500 rpm / min for 10 min.
[0063] (7) Discard the supernatant and let the RNA precipitate dry at room temperature for 5-10 minutes.
[0064] (8) Add 10-20µL of DEPC water to dissolve and mix to obtain RNA sample.
[0065] RT-qPCR: (1) Genomic DNA removal: Prepare the following mixture in an RNase-free EP tube: RNase-free ddH2O: to 16µL 4×gDNA wiper Mix: 4µL Template RNA: Total RNA: 1µg Gently pipette to mix, set the program on the machine, and react at 42°C for 2 minutes.
[0066] (2) Configure the reverse transcription reaction system: Add 4µL of 5×HiScriptIII qRT SuperMix and 16µL of the reaction solution obtained in step (1), and gently mix with a pipette.
[0067] (3) Primer design and synthesis: qPCR primers were designed based on the gene sequences of ASGR1 (Gene ID: 432) and GAPDH (Gene ID: 2597) in the NCBI database. 10µM primer solution was synthesized and provided by Shanghai Sangon Biotech Co., Ltd. The primer sequences are as follows: ASGR1: GACACGCAGACACAGAGACA (Sense, SEQ.ID.No: 10) CTGGACCTGGGATTGCTCAG (Antisense, SEQ.ID.No: 11) GAPDH: AGGTCGGTGTGAACGGATTTG (Sense, SEQ.ID.No: 12) TGTAGACCATGTAGTTGAGGTCA (Antisense, SEQ.ID.No: 13) (4) Prepare the qPCR reaction system: Table 1. qPCR reaction system
[0068] Three replicates were set up for each reverse transcription product.
[0069] (5) Set the program on the machine and perform real-time quantitative PCR reaction. React at 37℃ for 15 min, react at 85℃ for 5 sec, and then follow the program in Table 2 below.
[0070] Table 2. qPCR reaction procedure
[0071] (6) After the reaction is complete, the results are exported, and the mRNA abundance of ASGR1 relative to GAPDH is calculated based on the CT values of ASGR1 and GAPDH.
[0072] (7) Statistical analysis: The experiment was repeated three times, and the results were expressed as mean ± SD. The relative mRNA expression level of ASGR1 was obtained by comparing the experimental group with the control group.
[0073] The results are as follows Figure 1 RT-qPCR results showed that all four siRNAs designed in this invention could inhibit ASGR1 gene mRNA expression, with siASGR1-1 and siASGR1-2 showing better inhibition, especially siASGR1-1, which showed an effect of over 60%.
[0074] Extracting total cellular protein: (1) The cells in each well of the six-well plate were digested with trypsin and centrifuged. The supernatant was removed and the cell pellet was collected in an EP tube. (2) Prepare RIPA cell lysis buffer containing 1% protease inhibitor and add it to EP tubes, 60µL per tube; (3) The EP tube was oscillated on a vortex oscillator for 30 seconds, and then incubated on ice for 5 minutes; (4) After repeating step (3) 6 times, centrifuge at 4℃, 13000 rpm / min for 20 min; (5) Aspirate the supernatant to obtain a cell protein sample and place it on ice; (6) Protein concentration determination by BCA method: ①Preparation of BCA colorimetric solution: Mix solution A and solution B from the BCA kit thoroughly at a ratio of 50:1 to prepare the colorimetric solution.
[0075] ② Add ddH2O, protein standard (Shanghai Beyotime Biotechnology Co., Ltd.), and colorimetric solution to wells 1-8 of a 96-well microplate according to the following system.
[0076] Table 3. Components added to each well of a 96-well microplate
[0077] ③ Add 19µL ddH2O, 1µL protein sample, and 200µL chromogenic solution to each additional well of the ELISA plate. Then incubate the ELISA plate at 37℃ for 30 minutes. After that, use an ELISA reader to detect the absorbance at a wavelength of 570nm.
[0078] ④ Using the absorbance of wells 1-8 as the x-axis and the concentration of the corresponding protein standard as the y-axis, a protein standard curve and linear regression equation were obtained after linear regression. The concentration of each protein sample diluted 20 times was calculated based on the absorbance of the protein samples and the regression equation.
[0079] ⑤ Add PBS to the protein sample to adjust its concentration to a uniform level, then add protein loading buffer (1 / 4 volume of the protein sample), mix thoroughly, and boil at 100°C to denature the protein. Aliquot and store at -80°C. The final concentration of the denatured protein sample is calculated by multiplying the concentration by 20 and then by 0.8. Obtain the protein loading volume for subsequent Western blotting based on a loading amount of 30µg.
[0080] Western blotting: (1) Glue making: ① Clean the glass plate, align it and place it in the glue-making frame, add ddH2O and let it stand for 10 minutes to observe whether there is any leakage.
[0081] ②After the leak test is completed, pour out the ddH2O and blot it dry with filter paper for later use.
[0082] ③ Prepare a 10% separating gel and add it to the glass plates. Add 4.5 mL of separating gel to a 1.0 mm glass plate and 7 mL to a 1.5 mm glass plate. Immediately after adding the gel, add isopropanol until the plate is full. Let it stand for 20-30 minutes until the separating gel solidifies.
[0083] ④ Discard the isopropyl alcohol, and add the prepared 5% concentrated gel to the glass plates. Add 2 mL of concentrated gel to a 1.0 mm glass plate and 3 mL to a 1.5 mm glass plate. Immediately after adding the gel, insert the comb of the appropriate size and let it stand for 20-30 minutes to solidify.
[0084] ⑤ Place the prepared gel in an electrophoresis tank, add an appropriate amount of electrophoresis solution to submerge the glass plate, short plate, and electrode wires. The prepared gel can be used directly for subsequent experiments or stored at 4℃ until use.
[0085] (2) Sample loading: ① Before loading the sample, pull the comb out evenly to ensure that the loading holes are relatively neat.
[0086] ② Remove the protein sample and freeze-thaw it on ice, then shake to mix.
[0087] ③ Add different protein samples slowly into different wells at a loading rate of 30µg, and try to load the samples symmetrically.
[0088] ④ Add 5µL of protein marker to both sides of the protein sample.
[0089] (3) Electrophoresis: Turn on the electrophoresis apparatus and set the initial voltage to 80V for constant voltage electrophoresis. When an orange-red marker appears on the gel (about 30 minutes), adjust the voltage to 120V and continue constant voltage electrophoresis until the bottom of the electrophoresis tank, i.e., the bands are completely separated (about 60 minutes). During this process, the current value of the electrophoresis apparatus should always be set to be greater than the voltage value, and the time can be set to 2 hours. Stop the program after electrophoresis is completed.
[0090] (4) Cutting the gel: Remove the glass plate and place it in a dish containing the transfer solution. Gently pry open the glass plate and cut the gel according to the molecular weight of the target protein and the internal control (ASGR1: 42kD; GAPDH: 37kD).
[0091] (5) Transfer: ① Cut PVDF films of the same size as the cut adhesive, mark them, and soak them in methanol for later use.
[0092] ② Place the transfer clamp in a dish containing transfer solution. Then, place the sponge, three layers of filter paper, the cut gel, the PVDF membrane, the three layers of filter paper, and the sponge in that order, being careful to remove air bubbles and keep the mixture moist. Close the transfer clamp and place the membrane in the black-red transfer tank with the gel facing black and the PVDF membrane facing red. Add pre-cooled transfer solution until the tank is submerged.
[0093] ③ Place the transfer tank on ice, set the current to 250mA and the voltage to be greater than the current value for constant current transfer, and stop the transfer after 1.5h.
[0094] (6) Blocking: After the transfer is completed, the strip bubble is removed and placed in the blocking solution and incubated on a horizontal shaker for 1 hour.
[0095] (7) Incubation of primary antibody: ① After sealing, wash three times with TBST, 5 minutes each time.
[0096] ② Dilute the anti-human / mouse ASGR1 antibody (Wuhan Sanying Biotechnology Co., Ltd.) and the rabbit anti-human / mouse GAPDH antibody (Wuhan Sanying Biotechnology Co., Ltd.) at a ratio of 1:10000 using primary antibody dilution buffer.
[0097] ③ Place the target band and internal control band in the antibody incubation box, add 2-3 mL of diluted (1:10000) primary antibody to each, incubate on a horizontal shaker at room temperature for 1 h, and then place in a refrigerator at 4 ℃ overnight.
[0098] (8) Incubation of secondary antibodies: ① The recovered primary antibody was stored in a refrigerator at 4°C.
[0099] ② Wash the strip with TBST three times, 5 minutes each time.
[0100] ③ Dilute goat anti-mouse IgG antibody (Wuhan Sanying Biotechnology Co., Ltd.) with secondary antibody dilution buffer at a ratio of 1:10000.
[0101] ④ Place the target band and internal control band in the antibody incubation box, add 2-3 mL of diluted (1:10000) secondary antibody to each, and incubate at room temperature on a horizontal shaker for 1 h.
[0102] (9) Exposure: ① The recovered secondary antibody was stored in a refrigerator at 4°C.
[0103] ② Wash the strip with TBST three times, 5 minutes each time.
[0104] ③ Prepare the exposure solution by mixing solution A and solution B from the ECL kit at a 1:1 ratio. Be sure to prepare the solution immediately before use.
[0105] ④ Blot the strip dry with filter paper, immerse the strip in the exposure solution for 30 seconds, then remove the strip and place it in a preheated gel imaging instrument. Set the exposure time and expose the strip, then save the results.
[0106] (10) Statistical analysis: The results were analyzed using ImageJ software. The experiment was repeated three times. The results of the grayscale analysis were expressed as mean ± SD. The relative protein expression level of ASGR1 was obtained by comparing the experimental group with the control group.
[0107] The results are as follows Figure 2 , 3 As shown, all four siRNAs designed in this invention can inhibit the expression of ASGR1 at the protein level, with siASGR1-1 and siASGR1-2 showing better effects.
[0108] Meanwhile, the results of Western blotting were consistent with those of RT-qPCR, both showing that siASGR1-1 and siASGR1-2 could effectively inhibit the expression of ASGR1 protein, with siASGR1-1 showing better results. Therefore, siASGR1-1 was selected as the preferred siRNA sequence for subsequent experiments.
[0109] Example 2: RNAi Inhibitor This invention provides an RNAi inhibitor that can inhibit the expression of ASGR1 in cells. The RNAi inhibitor comprises any one of the four siRNAs designed in Example 1, preferably siASGR1-1. The sequence of siASGR1-1 includes a sense strand composed of the bases AUUAAAGGAGAGGUGGCUCCU and an antisense strand composed of the bases GAGCCACCUCUCCUUUAAUUU.
[0110] The inhibitors also include ligands or carriers.
[0111] The ligand or carrier is one or more GalNAc derivatives attached via a divalent or trivalent branched linker, or selected lipid nanoparticles (LNPs).
[0112] The GalNAc (N-acetylgalactosamine) selected in this invention can achieve precise delivery of siRNA to the liver by binding to specific receptors on the surface of hepatocytes, which greatly improves the enrichment efficiency of siRNA in the liver and reduces systemic off-target effects.
[0113] GalNAc derivatives are a class of compounds obtained by chemically modifying N-acetylgalactosamine (GalNAc). GalNAc derivative ligands modified with divalent or trivalent branched linkers are designed to maximize the "multivalent effect" and enhance their binding affinity to ASGPR. Structurally, divalent branches typically form symmetrical bibranched structures, while trivalent branches often employ trident-shaped scaffolds (such as lysine- or polyethylene glycol-based branching units), with each branch terminal connected to a GalNAc derivative.
[0114] In this embodiment, the preferred ligand GalNAc-L96 (a triantennae N-acetylgalactosamine molecule) is a ligand for the sialic acid glycoprotein receptor (ASGPR). In this invention, it is used to synthesize GalNAc-siRNA, promote the targeted delivery of siRNA to hepatocytes, and plays an important role in oligonucleotide delivery.
[0115] The chemical formula of GalNAc is C8H. 15 NO6, the structure of the ligand GalNAc-L96 is as follows:
[0116] The ligand is attached to the 3′ end of the siASGR1-1 positive chain and is covalently coupled through the chemical bonds (linker) inherent in GalNac.
[0117] This ligand molecule was synthesized by Shanghai Sangon Biotech. The ligand molecule mimics sialic acid and specifically binds to the desialylate glycoprotein receptor highly expressed on the surface of hepatocytes via its galactose residues, thereby targeting and delivering siRNA to hepatocytes. The ligand is conjugated to siRNA as shown in the following diagram:
[0118] The carrier selected in this embodiment also includes LNP. LNP self-assembles into nanoparticles with ionizable lipids, cholesterol and other components through non-covalent physical encapsulation, and encapsulates negatively charged siRNA inside. In terms of delivery mechanism, LNP relies on non-specific membrane fusion and endocytosis. After intravenous injection, it passively accumulates in tissues such as the liver by taking advantage of the physical properties of nanoparticles (such as particle size and charge), and then releases siRNA by destroying endosomal tissue through the "proton sponge effect".
[0119] The inhibitory effect of the siRNA designed in this invention was further verified through the following experiments: (1) Preparation and characterization of siASGR1-LNP: Lipid nanoparticles (LNPs) were constructed based on previous reports in the literature (Optimized RNA interference therapy combined with interleukin-2 mRNA for treating hepatitis B virus infection, https: / / doi.org / 10.1038 / s41392-024-01871-8).
[0120] First, a lipid phase (oil phase) was prepared by dissolving SM-102, DSPC, cholesterol (Chol), and mPEG-DSPE (2000) in anhydrous ethanol, with a molar ratio of 50:10:38.5:1.5. The nucleic acid phase (aqueous phase) was generated in citrate buffer (10 mm, pH 4.0) containing siASGR1-1. The lipid and nucleic acid phases were then mixed at a volume ratio of 1:3 at a flow rate of 1 mL / min using a microfluidic device (INano E, Micro & Nano Biologics). The resulting siASGR1-LNP was dialyzed at room temperature (20 k MWCO) for 2 h. The LNP was further filtered through a 0.22 μm membrane (SLGPR33RB, Millipore) and stored at 4 °C.
[0121] Figure 4 This is a flowchart of the preparation process of siASGR1-LNP, and the physicochemical characteristics of siASGR1-LNP are characterized. The results are as follows: Figure 6 and 7 As shown, Figure 6 and Figure 7The images show the TEM and particle size distribution of siASGR1-LNP. The images show that siASGR1-LNP has a uniform spherical morphology and a hydrodynamic diameter of 100 nm.
[0122] (2) Preparation of siASGR1-GalNAc: SiASGR1-1 and GalNAc-L96 were coupled and purified to obtain siASGR1-GalNAc, which was synthesized by a company under contract, and is a conventional and well-known technique.
[0123] In this embodiment, liver-specific knockdown is achieved using siRNA conjugated to N-acetylgalactoside (GalNAc). siASGR1-1 consists of two strands: a sense strand and an antisense strand. siASGR1-1 carries the sequence information required for target recognition, while the antisense strand supports loading into the RNA-induced silencing complex (RISC). A GalNAc ligand, covalently linked to the 3' end of the siRNA sense strand via a phosphodiester bond between a proline scaffold and the first nucleotide, enables hepatocyte-specific delivery and uptake. Figure 5 ). Figure 8 The image shows the mass spectrum of siASGR1-GalNAc. The molecular weights (MW) of the sense and antisense strands of the siRNA coupled in siASGR1-GalNAc are 7233.3 and 9154.6 Da, respectively.
[0124] Following the same method as steps (1) and (2), LNP-siASGR1-2, LNP-siASGR1-3, LNP-siASGR1-4, GalNAc-siASGR1-2, GalNAc-siASGR1-3, and GalNAc-siASGR1-4 are prepared using siASGR1-2, siASGR1-3, and siASGR1-4.
[0125] (3) Animal experiments: ① Screening of siRNA encapsulation vector effects Animals were housed under pathogen-free (SPF) conditions with a 12-hour light / dark cycle. As an acclimatization phase, animals were fed a standard rodent diet for one week, and were divided into groups and given a high-fat diet (HFD) (D12492, Jiangsu Xietong Biotechnology Co., Ltd.).
[0126] BIO mice (Changzhou Cavens Laboratory Animal Co., Ltd.) fed a high-fat diet were divided into three groups: Control, GalNAc, and LNP. The GalNAc group consisted of three mice: GalNAc-siASGR1-1, GalNAc-siASGR1-2, GalNAc-siASGR1-3, and GalNAc-siASGR1-4. The LNP group consisted of three mice: LNP-siASGR1-1, LNP-siASGR1-2, LNP-siASGR1-3, and LNP-siASGR1-4. The Control group was fed a high-fat diet and administered PBS by gavage.
[0127] The GalNAc group received a subcutaneous injection of 2 mg kg in the back. -1 GalNAc-siASGR1-1, GalNAc-siASGR1-2, GalNAc-siASGR1-3, and GalNAc-siASGR1-4 were administered via tail vein injection. The LNP group received 2 mg / kg of the drug. -1 LNP-siASGR1-1, LNP-siASGR1-2, LNP-siASGR1-3, and LNP-siASGR1-4. In this embodiment, GalNAc-siASGR1-x and LNP-siASGR1-x (x is 1, 2, 3, and 4) are injected in the form of an injection solution, with 2 mg of siASGR1-LNP or siASGR1-GalNAc injected per kilogram of mouse body weight.
[0128] After one week of feeding, serum was collected from the anesthetized mice for biochemical analysis: The expression levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) in serum were analyzed using a reagent kit (Nanjing Jiancheng Biotechnology Co., Ltd.).
[0129] The results of mouse serum biochemical indicators showed that... Figures 9-12 As shown, the four siRNAs designed in this invention can all reduce total cholesterol (TC), triglycerides (TG), and low-density lipoprotein cholesterol (LDL-C) and increase high-density lipoprotein cholesterol (HDL-C) in mice after being loaded with a vector, with GalNAc-siASGR1-1 and LNP-siASGR1-1 showing better effects.
[0130] The effects were further verified using GalNAc-siASGR1-1 and LNP-siASGR1-1.
[0131] ② Validation of siASGR1 treatment efficacy Animals were housed under pathogen-free (SPF) conditions with a 12-hour light / dark cycle. As an acclimatization phase, animals were fed a standard rodent diet for one week, and then divided into groups and fed either a normal diet (1010001, Jiangsu Xietong Biotechnology Co., Ltd.) or a high-fat diet (HFD) (D12492, Jiangsu Xietong Biotechnology Co., Ltd.) for six weeks.
[0132] BIO mice (Changzhou Cavens Laboratory Animal Co., Ltd.) fed a high-fat diet were divided into four groups: NAFLD group, GalNAc-siASGR1 group, LNP-siASGR1 group, and Atorvastatin group, with four mice in each group; C57BL / 6 mice (Jiangsu University Animal Experiment Center) served as the control group, with four mice in each group. Mice in the high-fat diet group (NAFLD group) received daily PBS gavage, while mice in the LNP-siASGR1 group received a tail vein injection of 1 mg / kg every four days. -1 The LNP-siASGR1 and GalNAc-siASGR1 groups received a weekly subcutaneous injection of 1 mg / kg in the back. -1 The GalNAc-siASGR1 and atorvastatin groups received 10 mg / kg via gavage daily. -1 Atorvastatin calcium tablets. In this example, LNP-siASGR1 and GalNAc-siASGR1 are administered as injections, with 1 mg of LNP-siASGR1 or GalNAc-siASGR1 injected per kilogram of mouse body weight; atorvastatin is administered as an aqueous solution at a concentration of 2 mg / mL, or other concentrations may be used, but 10 mg of atorvastatin per kilogram of mouse body weight should be administered by gavage according to the mouse body weight).
[0133] Mice were euthanized using conventional methods, and experimental materials were obtained using methods commonly used in the field.
[0134] Total RNA was extracted from liver tissue cells of mice in each group using a rapid RNA extraction kit (Beyotime Biotechnology Co., Ltd.). (1) Take 15-20 mg of animal tissue, grind it into powder in liquid nitrogen, and immediately add 600 μL of lysis buffer. Alternatively, place the tissue in a 1.5 mL centrifuge tube, quickly add 600 μL of ice-cold lysis buffer, and homogenize using a micro electric homogenizer or a regular glass homogenizer. After grinding or homogenizing, gently blow the homogenate 8-10 times and let it stand at room temperature for 3-5 minutes. Then centrifuge at approximately 14,000 × g for 2 minutes and transfer the supernatant to a new centrifuge tube.
[0135] (2) Add an equal volume of binding solution to the lysis solution and gently invert to mix 3-5 times. Precipitation may occur at this time, which is normal.
[0136] (3) Transfer the mixture (including the precipitate) to the purification column, centrifuge at 12,000×g for 30 seconds, and discard the liquid in the collection tube.
[0137] (4) Add 600 μL of Wash Buffer I, centrifuge at 12,000 × g for 30 seconds, and discard the liquid in the collection tube. Optional: The RNA extracted by this kit has had most of the DNA removed, and DNase treatment is usually not required.
[0138] (5) Add 600 μL of washing solution II, centrifuge at 12,000 × g for 30 seconds, and discard the liquid in the collection tube.
[0139] (6) Repeat step (5) once.
[0140] (7) Centrifuge at the highest speed (approximately 14,000-16,000×g) for 2 minutes to remove residual liquid.
[0141] (8) Place the RNA purification column in the RNA elution tube, add 30-50 μL of elution buffer, let it stand at room temperature for 2-3 minutes, centrifuge at the highest speed for 30 seconds, and the resulting solution is the purified RNA.
[0142] cDNA synthesis: RNA was extracted using a rapid RNA extraction kit (Beyotime Biotechnology Co., Ltd.), and reverse transcribed into cDNA. Gene expression levels were then detected using SYBR.
[0143] cDNA synthesis was performed using the HisyGo RT Red SuperMix for qPCR (+gDNA Wiper) kit (Nanjing Novizan). 3 μL of 5× gDNA was mixed with 2 μL of extracted total cellular RNA, and the volume was brought to 15 μL with ddH2O. The mixture was then pipetted and incubated at 42°C for 2 min.
[0144] Add 5 μL of 4× HisyGo qRT Red SuperMix directly to the reaction tube from the previous step, mix well by pipetting, incubate at 37°C for 15 min, then incubate at 85°C for 5 sec. The resulting product is cDNA.
[0145] RT-qPCR: Mix 5 μL of 2× chamQ SYBR qPCR Master Mix, 0.4 μL of primer 1 (10 μM), 0.4 μL of primer 2 (10 μM), and 1 μL of cDNA, and finally add ddH2O to a final volume of 20 μL.
[0146] qPCR reaction process:
[0147]
[0148] qPCR primer sequences:
[0149] To calculate the relative multiple change, the real-time data was analyzed using the ΔΔCt method, and the data was normalized. The results are as follows: Figure 13 As shown, compared with the control group (Atorvastatin group) and the model group (NAFLD group), the ASGR1 mRNA expression level in the siRNA administration groups (LNP, GalNAc group) was significantly reduced.
[0150] Western Blotting: Mouse liver tissue was lysed mechanically, and then BCA analysis was performed to obtain the total protein concentration. The total protein was separated by SDS-PAGE, transferred to a membrane, and incubated with anti-ASGR1, GAPDH, and HRP antibodies, respectively. Finally, it was developed with ECL substrate.
[0151] The results are as follows Figure 14 As shown, consistent with the qPCR results, the expression level of ASGR1 protein in the siRNA administration groups (LNP, GalNAc groups) was significantly reduced compared to the control group (Atorvastatin group) and the model group (NAFLD group).
[0152] Biochemical analysis: After six weeks of feeding, serum was collected from anesthetized mice. The expression levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), and liver enzymes (alanine aminotransferase [ALT], aspartate aminotransferase [AST]) in serum were analyzed using a serum total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), and liver enzymes (alanine aminotransferase [ALT], aspartate aminotransferase [AST]) kit (Nanjing Jiancheng Biotechnology Co., Ltd.).
[0153] Serum biochemical results in mice showed that, compared with the NAFLD group, the liver index of the siRNA administration groups (LNP, GalNAc groups) was significantly reduced. Figures 15-16In mice in the LNP-siASGR1 and GalNAc-siASGR1 groups, serum total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), free fatty acids (FFA), and ApoB were all decreased, while high-density lipoprotein cholesterol (HDL-C) was increased. Figures 17-22 Excessive accumulation of fatty acids in hepatocytes triggers endoplasmic reticulum stress and induces an inflammatory response. After siRNA treatment, serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels decreased in mice in the LNP-siASGR1 and GalNAc-siASGR1 groups. These results demonstrate that intervention with LNP-siASGR1 and GalNAc-siASGR1 can alleviate the symptoms of non-alcoholic fatty liver disease. Figures 23-24 Biochemical analysis results showed that LNP-siASGR1 and GalNAc-siASGR1 could reduce hyperlipidemia levels in mice and inhibit or reduce cholesterol levels.
[0154] Histological analysis and Oil Red O staining: After dissecting the mice, formalin-fixed liver samples were embedded in paraffin and then stained with H&E. Simultaneously, formalin-fixed liver samples were embedded in OTC and stained with Oil Red O.
[0155] Histological analysis and Oil Red O staining results showed that ( Figure 25 In the control group, HE staining showed no obvious abnormalities, cells were neatly arranged, and there was no sac-like degeneration. Compared with the control group, the NAFLD group mice had lighter cytoplasm, disordered cell arrangement, and severe fatty degeneration and inflammatory cell infiltration in their stem cell cytoplasm. In contrast, the LNP-siASGR1 and GalNAc-siASGR1c groups showed neatly arranged hepatocytes, improved liver tissue morphology, and significantly reduced fatty degeneration. Oil Red O staining showed that, compared with the NAFLD group, the LNP-siASGR1 and GalNAc-siASGR1 groups had reduced lipid deposition, and LNP-siASGR1 and GalNAc-siASGR1 rescued the histological structure of the mouse liver.
[0156] The detailed descriptions of the above embodiments are merely specific illustrations of feasible implementations of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art can design many other modifications and implementations, which will fall within the scope and spirit of the principles disclosed in this application. More specifically, within the scope of the present invention disclosure, drawings, and claims, various variations and improvements can be made to the components and / or layout of the subject matter combination layout. Besides variations and improvements to the components and / or layout, other uses will be apparent to those skilled in the art.
Claims
1. An siRNA that inhibits the expression of an ASGRl gene, characterized in that, The siRNA is selected from any one of the following (1) - (4): (1) a sense strand as set forth in SEQ. ID. No: 1 and an antisense strand as set forth in SEQ. ID. No: 2; (2) a sense strand as set forth in SEQ. ID. No: 3 and an antisense strand as set forth in SEQ. ID. No: 4; (3) a sense strand as set forth in SEQ. ID. No: 5 and an antisense strand as set forth in SEQ. ID. No: 6; (4) a sense strand as set forth in SEQ. ID. No: 7 and an antisense strand as set forth in SEQ. ID. No:
8.
2. The siRNA of claim 1, wherein The siRNA is selected from any one of the following: (1) a sense strand as set forth in SEQ. ID. No: 1 and an antisense strand as set forth in SEQ. ID. No: 2; (2) a sense strand as set forth in SEQ. ID. No: 3 and an antisense strand as set forth in SEQ. ID. No:
4.
3. The siRNA according to claim 1 or 2, characterized in that, The sense strand of the siRNA is as set forth in SEQ. ID. No: 1 and the antisense strand is as set forth in SEQ. ID. No:
2.
4. An siRNA inhibitor that inhibits the expression of an ASGRl gene, characterized in that, The inhibitor comprises the siRNA of any one of claims 1 - 3.
5. The siRNA inhibitor of claim 4, wherein The siRNA inhibitor further comprises a ligand or a carrier, which comprises a lipid nanoparticle, GalNAc or a GalNAc derivative.
6. The siRNA inhibitor of claim 5, wherein The ligand is conjugated to the 3' end of the sense strand of the siRNA.
7. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the siRNA of any one of claims 1 - 3.
8. The pharmaceutical composition of claim 7, wherein, The pharmaceutical composition further comprises a lipid nanoparticle, GalNAc or a GalNAc derivative.
9. Use of the siRNA of any one of claims 1 - 3, the siRNA inhibitor of any one of claims 4 - 6 or the pharmaceutical composition of any one of claims 7 - 8 in the manufacture of a medicament for preventing or treating lipid disorder, hyperlipidemia, non-alcoholic fatty liver disease or hypercholesterolemia.
10. A method of inhibiting expression of an ASGR1 gene for non-therapeutic purposes, characterized in that, The method comprises administering to a sample the siRNA of any one of claims 1 - 3, the siRNA inhibitor of any one of claims 4 - 6 or the pharmaceutical composition of any one of claims 7 - 8.