Dynamic regulation system for synthesizing l-muscle peptide and application thereof

By constructing a growth-dependent promoter dynamic regulation system in Escherichia coli, the problems of cellular metabolic burden and precursor competition caused by static expression were solved, the production efficiency of L-carnosine was improved, and high-yield L-carnosine synthesis was achieved.

CN121575018BActive Publication Date: 2026-07-03BEIJING KANSENBIO TECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610116285.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-28
Publication Date
2026-07-03
Estimated Expiration
2046-01-28

AI Technical Summary

Technical Problem

In the existing technology for producing L-carnosine using Escherichia coli fermentation with glucose as raw material, the static expression method leads to excessive cellular metabolic burden and competition for precursor supply, which affects the yield.

Method used

A dynamic regulatory system was constructed using naturally occurring growth-dependent promoters or their mutants in Escherichia coli to control the expression of genes related to carnosine synthesis, β-alanine synthesis, and L-histidine synthesis, thereby constructing a dynamic regulatory system for L-carnosine synthesis.

Benefits of technology

It significantly increases L-carnosine production by up to 70.65%, balances strain growth and production, and optimizes metabolic flux.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
Patent Text Reader

Abstract

This application discloses a dynamic regulatory system for L-carnosine synthesis and its applications. The dynamic regulatory system includes a first expression unit containing a first growth-phase-dependent promoter, a second expression unit containing a second growth-phase-dependent promoter, and a third expression unit containing a third growth-phase-dependent promoter. This dynamic regulatory system can significantly increase L-carnosine production, demonstrating yield-enhancing effects on integrated genomes and different carnosine-producing strains.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biochemical technology, and further to a dynamic regulation system for the synthesis of L-carnosine and its application. Background Technology

[0002] L-Carnosine is a dipeptide composed of β-alanine and L-histidine linked by peptide bonds. It possesses various activities including antioxidant, anti-glycation, and anti-inflammatory properties, and is widely used in food, pharmaceuticals, and cosmetics. Microbial fermentation for L-carnosine production offers significant economic and environmental benefits, and increasing the yield of carnosine through fermentation has important research and application value.

[0003] In the process of producing carnosine using Escherichia coli fermentation with glucose as raw material, glucose is first converted into glucose-6-phosphate (G6P). G6P then undergoes multiple reactions to synthesize β-alanine and L-histidine, respectively. β-alanine and L-histidine are then catalyzed by carnosine synthase encoded by the pepD gene to generate L-carnosine.

[0004] The process of G6P synthesizing β-alanine is as follows: G6P produces phosphoenolpyruvate and pyruvate through glycolysis. Pyruvate is catalyzed by pyruvate carboxylase encoded by the pyc gene to produce oxaloacetate. Oxaloacetate is catalyzed by aspartate transaminase encoded by the aspB gene to produce L-aspartate. At the same time, both phosphoenolpyruvate and pyruvate can enter the tricarboxylic acid cycle through catalysis. Fumarate in the tricarboxylic acid cycle can also produce L-aspartate through aspartate aminopyrase encoded by the aspA gene. L-aspartate is then catalyzed by aspartate-α-decarboxylase encoded by the panD gene to produce β-alanine.

[0005] The synthesis of L-histidine from G6P occurs as follows: G6P produces ribose-5-phosphate (R5P) via the pentose phosphate pathway. Key enzymes in this pathway include glucose-6-phosphate dehydrogenase encoded by the zwf gene and 6-phosphate gluconate dehydrogenase encoded by the gnd gene. R5P is then catalyzed by phosphoribosyl pyrophosphate synthase encoded by the prs gene to produce PRPP. PRPP is then catalyzed by an enzyme encoded by the histidine synthesis operon hisGDCBHAFI to generate L-histidine. During L-histidine synthesis in *E. coli*, the protein encoded by the hisL gene inhibits the transcription of the histidine synthesis operon hisGDCBHAFI, the protein encoded by the purR gene inhibits the expression of the prs gene, and the activity of the protein encoded by hisG is subject to feedback inhibition by histidine.

[0006] Currently, the process of producing carnosine using glucose as a raw material and E. coli fermentation generally selects static promoters to express carnosine synthesis genes, β-alanine synthesis-related genes, and L-histidine synthesis-related genes, initiating the synthesis of these three compounds simultaneously. The initiation time is generally fermentation initiation (constitutive expression) or artificial control (induced expression). This static expression method is prone to problems such as excessive cellular metabolic burden and competition for precursor supply, which can adversely affect cell growth and production. For example, at the G6P node mentioned above, β-alanine is produced by G6P through glycolysis, while L-histidine is produced by G6P through the pentose phosphate pathway. That is, there is precursor competition between β-alanine synthesis and L-histidine synthesis, and initiating the synthesis of both simultaneously is not conducive to increasing yield.

[0007] To balance the growth and production of carnosine-synthesizing strains and the metabolic flux of different synthetic pathways, this application utilizes naturally occurring promoters (growth-dependent promoters) or their mutants in *E. coli* that are expressed at different growth stages. These promoters have varying activation times and intensities. They were used to control the expression of carnosine synthesis genes, β-alanine synthesis-related genes, and L-histidine synthesis-related genes, thus constructing a dynamic regulatory system for carnosine synthesis. Effect tests on different promoter combinations showed that, compared to static expression, the dynamic regulatory system can increase L-carnosine yield by up to 70.65%, providing a good foundation for the fermentation production of L-carnosine. Summary of the Invention

[0008] Based on this, this application provides at least one dynamic regulation system for the synthesis of L-carnosine and its application.

[0009] In a first aspect of this application, a dynamic regulation system for the synthesis of L-carnosine is provided, comprising:

[0010] (a) A first expression unit comprising a first growth phase-dependent promoter and a gene encoding carnosine synthase operably linked downstream thereof;

[0011] (b) A second expression unit comprising a second growth phase-dependent promoter and a gene or gene cluster operatively linked downstream thereof encoding at least one key enzyme in the β-alanine synthesis pathway;

[0012] (c) A third expression unit comprising a third growth phase-dependent promoter and a gene or gene cluster operatively linked downstream thereof encoding at least one key enzyme in the L-histidine synthesis pathway.

[0013] The first growth-phase-dependent promoter, the second growth-phase-dependent promoter, and the third growth-phase-dependent promoter are each independently selected from the promoter Prmf of the gene rmf and its variants, the promoter PfliA of the gene fliA and its variants, and the promoter PosmB of the gene osmB and its variants.

[0014] In a second aspect of this application, an isolated polynucleotide is provided, comprising, for example, a first expression unit, a second expression unit, and a third expression unit;

[0015] The first expression unit comprises a first growth phase-dependent promoter and a gene operably linked downstream thereof encoding carnosine synthase; the second expression unit comprises a second growth phase-dependent promoter and a gene or gene cluster operably linked downstream thereof encoding at least one key enzyme in the β-alanine synthesis pathway; the third expression unit comprises a third growth phase-dependent promoter and a gene or gene cluster operably linked downstream thereof encoding at least one key enzyme in the L-histidine synthesis pathway.

[0016] The first growth-phase-dependent promoter, the second growth-phase-dependent promoter, and the third growth-phase-dependent promoter are each independently selected from the promoter Prmf of the gene rmf and its variants, the promoter PfliA of the gene fliA and its variants, and the promoter PosmB of the gene osmB and its variants.

[0017] In a third aspect of this application, a genetically engineered bacterium is provided, comprising the dynamic regulatory system for synthesizing L-carnosine described in the first aspect.

[0018] In a fourth aspect of this application, a method for producing L-carnosine is provided, comprising the steps of:

[0019] The genetically engineered bacteria described in the third aspect are cultured in a culture medium suitable for fermentation to prepare a culture; and,

[0020] L-carnosine was collected from the culture.

[0021] In a fifth aspect of this application, a dynamic regulation system for the synthesis of L-carnosine as described in the first aspect, isolated polynucleotides as described in the second aspect, or the use of genetically engineered bacteria as described in the third aspect in the preparation of L-carnosine are provided.

[0022] The dynamic regulation system provided by this invention can significantly increase L-carnosine production (up to 70.65%). This system has shown yield-enhancing effects on both integrated genomes and different carnosine-producing strains. Detailed Implementation

[0023] To facilitate understanding of this application, a more complete description of the application will be provided below with reference to embodiments. However, this application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of this application.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0025] In this application, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, "one or more" and other instances that otherwise indicate "one or more" shall be understood in the same way unless otherwise specified.

[0026] The terms “combinations thereof,” “any combination thereof,” and “any combination thereof” as used in this application include all suitable combinations of any two or more of the listed items.

[0027] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method" etc., shall be defined as being able to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0028] In this application, terms such as "further," "even more," "particularly," "for example," "like," "example," and "exemplary" are used for descriptive purposes to indicate that different technical solutions preceding and following each other are related in terms of their coverage, but should not be construed as limiting the preceding technical solution or restricting the scope of protection of this application. In this application, unless otherwise specified, A (e.g., B) indicates that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0029] The terms “containing,” “comprising,” and “including” as used in this application are synonyms and are inclusive or open-ended, not excluding additional, uncited members or features. Members or features include, for example, materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions under which actions occur, timing, states, etc.

[0030] In this application, the technical features or solutions described in open-ended language include both closed-ended technical features or solutions consisting of the listed contents and open-ended technical features or solutions that include the listed contents.

[0031] In this application, the exemplary descriptions such as "in some implementations (or embodiments)" and "in one implementation (or embodiment)" may cover, but are not limited to, the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0032] In this application, the terms "first aspect," "second aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first aspect," "second aspect," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0033] In this application, when numerical intervals (i.e., numerical ranges) are involved, unless otherwise specified, the distribution of selectable numerical values ​​within the numerical interval is considered continuous, and includes the two endpoints of the numerical interval (i.e., the minimum and maximum values), as well as every numerical value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that numerical interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints, which is equivalent to directly listing every integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all subranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, percentage, ratio, etc. The term "numerical interval" can be broadly included to include numerical interval types such as percentage intervals, ratio intervals, and proportion intervals.

[0034] In this application, where the method flow involves multiple steps, unless otherwise explicitly stated herein, there is no strict order restriction on the execution of these steps; they can be executed in any order other than those described. Moreover, any step may include multiple sub-steps or multiple stages, which are not necessarily completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be performed alternately or simultaneously with other steps or parts of the sub-steps or stages of other steps.

[0035] To address the issues of excessive cellular metabolic burden and competition for precursor supply caused by static expression, this application constructs a dynamic regulatory system using a growth-dependent promoter or its mutant, which, when applied to carnosine synthesis, can increase L-carnosine production by up to 70.65%.

[0036] One aspect of this application provides a dynamic regulation system for the synthesis of L-carnosine, comprising:

[0037] (a) A first expression unit comprising a first growth phase-dependent promoter and a gene encoding carnosine synthase operably linked downstream thereof;

[0038] (b) A second expression unit comprising a second growth phase-dependent promoter and a gene or gene cluster operatively linked downstream thereof encoding at least one key enzyme in the β-alanine synthesis pathway;

[0039] (c) A third expression unit comprising a third growth phase-dependent promoter and a gene or gene cluster operatively linked downstream thereof encoding at least one key enzyme in the L-histidine synthesis pathway.

[0040] The first growth-phase-dependent promoter, the second growth-phase-dependent promoter, and the third growth-phase-dependent promoter are each independently selected from the promoter Prmf of the gene rmf and its variants (or referred to as the "first variant"), the promoter PfliA of the gene fliA and its variants (or referred to as the "second variant"), and the promoter PosmB of the gene osmB and its variants (or referred to as the "third variant").

[0041] In some embodiments, the sequence of the Prmf includes bases 1 to 500 of the sequence shown in SEQ ID NO:23.

[0042] In some embodiments, the sequence of the first variant includes a nucleic acid fragment as shown in SEQ ID NO:28 or 30. Exemplarily, the sequence of the first variant is as shown in SEQ ID NO:28 (Prmf-M9) or as shown in SEQ ID NO:30 (Prmf-M2).

[0043] In some embodiments, the sequence of PfliA includes bases 1 to 500 of the sequence shown in SEQ ID NO:18.

[0044] In some embodiments, the second variant includes a nucleic acid fragment with the sequence shown in SEQ ID NO:26. Exemplarily, the sequence of the second variant is shown in SEQ ID NO:26 (PfliA-M15).

[0045] In some embodiments, the sequence of PosmB is the first to 500 bases of the sequence shown in SEQ ID NO:22.

[0046] In some embodiments, the third variant comprises a nucleic acid fragment with a sequence as shown in SEQ ID NO:27 or 29. Exemplarily, the sequence of the third variant is as shown in SEQ ID NO:27 (PosmB-M21) or as shown in SEQ ID NO:29 (PosmB-M4).

[0047] The inventors discovered that when the third growth-phase-dependent promoter is PosmB or a variant thereof, and the other two growth-phase-dependent promoters are arbitrarily selected from Prmf or a variant thereof, PosmB or a variant thereof, or PfliA or a variant thereof, the production of L-carnosine can be increased more significantly (see CTZ28, CTZ34, CTZ35, CTZ38, CTZ39, CTZ44, etc. in Table 2).

[0048] In some implementations, the first growth-period-dependent promoter is selected from Prmf or a variant thereof, PosmB or a variant thereof, the second growth-period-dependent promoter is selected from PfliA or a variant thereof, Prmf or a variant thereof, and the third growth-period-dependent promoter is promoter PosmB or a variant thereof.

[0049] For example, the following promoter combinations can be used:

[0050] (1) The first growth phase-dependent promoter is PosmB or a variant thereof, the second growth phase-dependent promoter is PfliA or a variant thereof, and the third growth phase-dependent promoter is PosmB or a variant thereof.

[0051] (2) The first growth-phase dependent promoter is Prmf or a variant thereof, the second growth-phase dependent promoter is PfliA or a variant thereof, and the third growth-phase dependent promoter is PosmB or a variant thereof.

[0052] (3) The first growth phase-dependent promoter is Prmf or a variant thereof, the second growth phase-dependent promoter is Prmf or a variant thereof, and the third growth phase-dependent promoter is PosmB or a variant thereof.

[0053] (4) The first growth phase-dependent promoter is PosmB or a variant thereof, the second growth phase-dependent promoter is Prmf or a variant thereof, and the third growth phase-dependent promoter is PosmB or a variant thereof.

[0054] In some implementations, the sequence of the first variant is as shown in SEQ ID NO:28.

[0055] In some embodiments, the sequence of the third variant is as shown in SEQ ID NO:29.

[0056] In some embodiments, the first growth-phase-dependent promoter is the promoter Prmf of the gene rmf or a first variant; the second growth-phase-dependent promoter is the promoter PfliA of the gene fliA or a second variant; and the third growth-phase-dependent promoter is the promoter PosmB of the gene osmB or a third variant.

[0057] In some embodiments, in the first expression unit, the gene encoding carnosine synthase is selected from the gene SmpepD from Serratia marcescens, the gene CppepD from Clostridium perfringens, or a variant of the gene encoding a functional homologous protein thereof.

[0058] The sequence of the gene SmpepD is, for example, bases 83 to 1543 of the sequence shown in SEQ ID NO:1; the start codon may be, for example, ATG.

[0059] In some embodiments, the sequence of the gene CppepD is exemplarily shown as SEQ ID NO: 37.

[0060] In some embodiments, the gene cluster encoding key enzymes in the β-alanine synthesis pathway in the second expression unit includes the gene panD encoding aspartate-α-decarboxylase, the gene aspA encoding aspartate aminopyrase, and the gene aspB encoding aspartate transaminase. Exemplarily, the second expression unit further includes the gene pyc located downstream of the gene aspB.

[0061] The gene panD is exemplarily derived from Bacillus subtilis, for example, its sequence being bases 63 to 446 of the sequence shown in SEQ ID NO:4.

[0062] The gene aspA is exemplarily derived from Escherichia coli, for example, its sequence being bases 474-1910 of the sequence shown in SEQ ID NO:4.

[0063] The gene aspB is exemplarily derived from Corynebacterium glutamicum, for example, its sequence being bases 1938-3236 of the sequence shown in SEQ ID NO:4.

[0064] The gene pyc is exemplarily derived from Corynebacterium glutamicum, for example, its sequence being bases 28 to 3450 of the sequence shown in SEQ ID NO:38.

[0065] In some embodiments, the gene cluster encoding a key enzyme in the L-histidine synthesis pathway in the third expression unit includes the gene hisG encoding ATP phosphoribosyltransferase, the gene prs encoding phosphoribosyl pyrophosphate synthase, and the gene zwf encoding glucose-6-phosphate dehydrogenase. Exemplarily, the third expression unit further includes the gene gnd located downstream of the gene zwf.

[0066] The gene hisG is exemplarily derived from Corynebacterium glutamicum. It may also carry the S143F mutation and lack a C-terminal regulatory region.

[0067] In some embodiments, the sequence of the gene hisG is bases 82 to 708 of the sequence shown in SEQ ID NO:7.

[0068] In some embodiments, the gene prs is derived from Escherichia coli, and exemplaryly, its sequence is bases 736-1683 of the sequence shown in SEQ ID NO:7. Its start codon may be, for example, ATG.

[0069] In some embodiments, the gene zwf is derived from Escherichia coli, and its sequence is, for example, bases 1711 to 3186 of the sequence shown in SEQ ID NO:7.

[0070] In some embodiments, the gene gnd is derived from Escherichia coli, and its sequence is, for example, bases 28 to 1434 of the sequence shown in SEQ ID NO:39.

[0071] In another aspect of this application, a separable polynucleotide is provided, comprising a first expression unit, a second expression unit, and a third expression unit as defined above.

[0072] It should be understood that the isolated polynucleotides may be combinatorial products, and each may independently contain at least one or more of the first expression unit, the second expression unit, and the third expression unit.

[0073] In some embodiments, the isolated polynucleotide is in the form of a carrier.

[0074] For example, the first expression unit exists in the first recombinant expression vector, the second expression unit exists in the second recombinant expression vector, and the third recombinant unit exists in the third recombinant expression vector.

[0075] In some implementations, the first to third recombinant expression vectors each independently include one or more of the first to third expression units.

[0076] Another aspect of this application provides a genetically engineered bacterium comprising the dynamic regulatory system for synthesizing L-carnosine as described above;

[0077] The substrate bacteria that can be used for the genetically engineered bacteria described in this application may be determined according to requirements (such as bacterial growth rate, culture conditions, etc.), and for example, the substrate bacteria are Escherichia coli.

[0078] In some implementations, at least for the purpose of relieving PurR's repression of the prs gene, transcriptional repression of the histidine synthesis operon in the genome of the chassis bacteria is relieved, and / or the purR gene is knocked out or inactivated.

[0079] In the genetically engineered bacteria, the first expression unit, the second expression unit, and the third expression unit can each be independently located in the recombinant expression vector or the genome.

[0080] For example, the first expression unit is integrated into the yjiV site in the chassis bacterial genome.

[0081] For example, the second expression unit is integrated into the ycdN site in the chassis bacterial genome.

[0082] For example, the third expression unit is integrated into the ilvG site in the chassis bacterial genome.

[0083] The aforementioned expression units can be integrated into specific sites in the genome using conventional techniques in the field (such as CRISPR / Cas9-based genome editing methods).

[0084] Another aspect of this application provides a method for producing L-carnosine, comprising the following steps:

[0085] S100. Culture the genetically engineered bacteria as described above in a culture medium suitable for fermentation to prepare a culture; and,

[0086] S200. Collect L-carnosine from the culture.

[0087] In some embodiments, the culture medium used in step S100 includes:

[0088] Glucose 20 g / L, magnesium sulfate heptahydrate 0.8 g / L, diammonium hydrogen phosphate 4 g / L, potassium dihydrogen phosphate 6.67 g / L, potassium citrate 1.35 g / L, 3-morpholine propanesulfonic acid 20.9 g / L, yeast extract 2.5 g / L, ferrous sulfate heptahydrate 50 mg / L, calcium chloride dihydrate 10 mg / L, zinc sulfate heptahydrate 11 mg / L, manganese sulfate tetrahydrate 2.5 mg / L, copper sulfate pentahydrate 5 mg / L, ammonium molybdate 0.5 mg / L, sodium borate decahydrate 0.1 mg / L. Antibiotics may be added as needed; ampicillin is added at a concentration of 100 mg / L, and streptomycin at a concentration of 50 mg / L.

[0089] Another aspect of this application provides the dynamic regulation system for the synthesis of L-carnosine as described above, the isolated polynucleotide as described above, or the use of the genetically engineered bacteria described above in the preparation of L-carnosine.

[0090] The following are some examples.

[0091] Specific implementation methods include, but are not limited to: (1) construction of carnosine-producing strains; (2) construction and screening of growth-dependent promoters; (3) construction of dynamic regulatory systems based on growth-dependent promoters and testing of their effects; (4) testing of the effect of dynamic regulatory systems on genome integration; and (5) testing of the effect of dynamic regulatory systems on different carnosine-producing strains.

[0092] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where conditions are not specified, reference should be made to the guidelines given in this application, or to experimental manuals or conventional conditions in the art, or to the conditions recommended by the manufacturer, or to experimental methods known in the art.

[0093] Example 1: Construction of carnosine-producing strains

[0094] To catalyze the synthesis of L-carnosine from β-alanine and L-histidine, a carnosine synthase gene expression sequence, Ptrcc-SmpepD (as shown in SEQ ID NO:1), controlled by the Ptrcc promoter, was artificially synthesized. Ptrcc is the promoter, and its sequence is shown in bases 1 to 55 of SEQ ID NO:1. SmpepD is derived from the pepD gene of *Serratia marcescens*, with the start codon changed from GTG to ATG, and its sequence is shown in bases 83 to 1543 of SEQ ID NO:1. The Ptrcc-SmpepD fragment was cloned using Gibson assembly between the aaatattctgaaatgagctg sequence (SEQ ID NO:2) and the aagcttggctgttttggcgg sequence (SEQ ID NO:3) of the pTrc99a plasmid backbone (Addgene plasmid 155179) to obtain the recombinant plasmid pCFN01.

[0095] To enhance the throughput of β-alanine synthesis in *E. coli*, a β-alanine synthesis gene expression module, PJ23100-BspanD-aspA-CgaspB (as shown in SEQ ID NO:4), was artificially synthesized, controlled by the PJ23100 promoter. Here, PJ23100 is the promoter, with a sequence shown in bases 1 to 35 of SEQ ID NO:4; BspanD is the panD gene derived from *Bacillus subtilis*, with a codon-optimized sequence shown in bases 63 to 446 of SEQ ID NO:4; the aspA gene is derived from *E. coli*, with a sequence shown in bases 474 to 1910 of SEQ ID NO:4; and CgaspB is the aspB gene derived from *Corynebacterium glutamicum*, with a codon-optimized sequence shown in bases 1938 to 3236 of SEQ ID NO:4. The PJ23100-BspanD-aspA-CgaspB fragment was cloned into the pCDF vector backbone (Addgene plasmid172718) between the tgcgactcctgcattaggaa sequence (SEQ ID NO:5) and the tgaagcgcatacctgcaggc sequence (SEQ ID NO:6) using Gibson assembly to obtain the recombinant plasmid pCFN02.

[0096] To enhance the throughput of L-histidine synthesis in *E. coli*, a gene expression module Ptc-CghisG, controlled by the Ptc promoter, was artificially synthesized. fbr-prs-zwf (as shown in SEQ ID NO:7), where Ptc is the promoter, and the sequence is shown as bases 1 to 54 of SEQ ID NO:7; CghisG fbr The hisG gene, derived from *Corynebacterium glutamicum*, has the sequence shown in bases 82 to 708 of SEQ ID NO:7. Its encoded protein carries the S143F mutation and has the C-terminal regulatory region (amino acids 209-281) deleted, thus preventing histidine feedback inhibition of protein activity. The prs gene, derived from *E. coli*, has its start codon changed from GTG to ATG, and its sequence is shown in bases 736 to 1683 of SEQ ID NO:7. The zwf gene, derived from *E. coli*, has the sequence shown in bases 1711 to 3186 of SEQ ID NO:7. Ptc-CghisG fbrThe -prs-zwf fragment was cloned between the ccggaagcagtgtgaccgtg sequence (SEQ ID NO:8) and the tgcttctcaaatgcctgagg sequence (SEQ ID NO:9) of the pCFN02 plasmid using Gibson assembly to obtain the recombinant plasmid pCFN03. To relieve the inhibition of the histidine operon by HisL and to knock out the coding gene for HisG (protein activity is inhibited by histidine feedback) in *E. coli*, the hisLG gene sequence on the *E. coli* MG1655 genome was replaced with the Ptrcc-RBS01 sequence (as shown in SEQ ID NO:10), and the downstream hisDCBHAFI gene was expressed, resulting in strain CTZ01. In this strain, Ptrcc is the promoter, with a sequence shown in bases 1 to 55 of SEQ ID NO:10 (identical to the Ptrcc promoter sequence shown in bases 1 to 55 of SEQ ID NO:1); the RBS01 sequence is RBS (ATTACATTGCCAAGGGGAGGACGAGTC, as shown in bases 56 to 82 of SEQ ID NO:10). To relieve the inhibition of the prs gene by PurR, the purR gene was knocked out on the genome of strain CTZ01, resulting in strain CTZ02. The above methods for constructing CTZ01 and CTZ02 strains are CRISPR / Cas9-based genome editing methods. Taking the construction of CTZ01 strain as an example, using the *E. coli* MG1655 genome as a template, the hisLG-U fragment was amplified using primers hisLG-UF (caggctatcgattgagtccatcaatc, SEQ ID NO:11) and hisLG-UR (gtctctgtgaatgtttattcaactgatgtcttttaa, SEQ ID NO:12). The hisLG-D fragment was amplified using primers hisLG-DF (atgagctttaacacaatcattgactggaatag, SEQ ID NO:13) and hisLG-DR (gcataaaggatctcatcggcaatcg, SEQ ID NO:14). A Ptrcc-RBS01-overlap sequence (as shown in SEQ ID NO:14) containing the Ptrcc promoter, RBS01 sequence, and overlap sequence was artificially synthesized. As shown in NO:15, the hisLG-U, Ptrcc-RBS01-overlap and hisLG-D fragments were amplified by overlap PCR to obtain the fragment Ptrcc-RBS01-Donor.Using plasmid pTargeF (Addgene plasmid 62226) as a template, the pTarget-hisLD plasmid was obtained by amplification with primers pTarget-hisLD-F (gacggtccgctctccttaaagttttagagctagaaatagcaagttaaaataaggc, SEQ ID NO:16) and pTarget-hisLD-R (tttaaggagagcggaccgtcactagtattatacctaggactgagctagctg, SEQ ID NO:17). The fragment Ptrcc-RBS01-Donor, plasmid pTarget-hisLD, and plasmid pCas (Addgene plasmid 62225) were transformed into *E. coli* MG1655 to obtain strain CTZ01.

[0097] pCFN01 and pCFN03 plasmids were transformed into strain CTZ02 to obtain carnosine-synthesizing strain CTZ03.

[0098] Example 2: Construction and Screening of Growth-Depth Dependent Promoters

[0099] To obtain growth-phase-dependent promoters with different initiation times and intensities, three growth-phase-dependent promoters were selected from E. coli for mutation. The three promoters were fliA, osmB, and the promoters of the rmf gene, PfliA, PosmB, and Prmf.

[0100] Mutant libraries of the PfliA, PosmB, and Prmf promoters were constructed separately. Taking the construction of the PfliA promoter mutant library as an example, the PfliA-gfp sequence (as shown in SEQ ID NO:18) was artificially synthesized. PfliA is the promoter of the fliA gene in the Escherichia coli genome (using the 500 bp upstream of the fliA gene coding sequence), as shown in bases 1 to 500 of the sequence in SEQ ID NO:18. The gfp sequence includes the RBS sequence of green fluorescent protein GFP (as shown in bases 501 to 527 of the sequence in SEQ ID NO:18) and the coding sequence (as shown in bases 528 to 1247 of the sequence in SEQ ID NO:18). The PfliA-gfp sequence was cloned into the aaatattctgaaatgagctg sequence (SEQ ID NO:2) and aagcttggctgttttggcgg sequence (SEQ ID NO:3) of the pTrc99a plasmid backbone (Addgene plasmid155179) using Gibson assembly to obtain the recombinant plasmid pCFN04. Using plasmid pCFN04 as a template, primers pCFN04-VF (gataactcatataacgcagggctgtttatcgt, SEQ ID NO:19) and pCFN04-VR (cgattagtgggtgaaatgaggggtta, SEQ ID NO:19) were used. The pCFN04 vector backbone fragment pCFN04-V was amplified (NO:20). The PfliA-D sequence (ctcatttcacccactaatcgNccgYttNaaaNWNctYcagaKKDggataatcatgccgataactcatataacgcagggc, SEQ ID NO:21) was artificially synthesized. This sequence includes a degenerate base sequence for mutating the PfliA promoter (bases 21 to 57 of SEQ ID NO:21) and contains sequences that can overlap with the pCFN04-V fragment upstream and downstream (bases 1 to 20 of SEQ ID NO:21; bases 58 to 79 of SEQ ID NO:21). PfliA-D was ligated to pCFN04-V using Gibson assembly. The ligation product was transformed into E. coli BL21(DE3) competent cells. After recovery, the cells were plated on solid medium supplemented with ampicillin. After overnight culture, single colonies on the plates constituted a PfliA promoter mutant library.The same method was used to construct a PosmB promoter mutant library and a Prmf promoter mutant library, respectively. The PosmB-gfp sequence used in the construction process is shown in SEQ ID NO:22. It was cloned between the aaatattctgaaatgagctg sequence (SEQ ID NO:2) and the aagcttggctgttttggcgg sequence (SEQ ID NO:3) of the pTrc99a plasmid backbone (Addgene plasmid 155179), and the resulting recombinant plasmid was named pCFN05. The Prmf-gfp sequence is shown in SEQ ID NO:23. It was cloned between the aaatattctgaaatgagctg sequence (SEQ ID NO:2) and the aagcttggctgttttggcgg sequence (SEQ ID NO:3) of the pTrc99a plasmid backbone (Addgene plasmid 155179), and the resulting recombinant plasmid was named pCFN06. The PosmB-D sequence used to mutate the PosmB promoter is shown in SEQ ID NO:23. As shown in NO:24, it includes a degenerate base sequence for mutating the PosmB promoter (bases 21 to 54 of SEQ ID NO:24), and upstream and downstream sequences that can overlap with the pCFN05 plasmid backbone fragment (bases 1 to 20 of SEQ ID NO:24; bases 55 to 76 of SEQ ID NO:24); the Prmf-D sequence for mutating the Prmf promoter is shown in SEQ ID NO:25, which includes a degenerate base sequence for mutating the Prmf promoter (bases 21 to 63 of SEQ ID NO:25), and upstream and downstream sequences that can overlap with the pCFN06 plasmid backbone fragment (bases 1 to 20 of SEQ ID NO:25; bases 64 to 87 of SEQ ID NO:25).

[0101] The degenerate bases mentioned above are: N = A / T / C / G, Y = C / T, W = A / T, K = G / T, D = G / A / T, B = G / T / C, H = A / T / C, S = G / C, and V = G / A / C.

[0102] Initial screening of PfliA, PosmB, and Prmf promoter mutants. To screen promoters with different start times and intensities from the mutant library, initial screening was performed. Based on the color changes of single colonies on solid culture plates, 24 single colonies exhibiting different color change times and intensities were selected from each of the PfliA, PosmB, and Prmf promoter mutant libraries, for a total of 72 single colonies. These colonies were cultured, and plasmids were extracted and labeled as pMPA01 to pMPA24, pMPB01 to pMPB24, and pMPF01 to pMPF24, for a total of 72 plasmids.

[0103] Rescreening of PfliA, PosmB, and Prmf promoter mutants. 72 plasmids, pMPA01 to pMPA24, pMPB01 to pMPB24, and pMPF01 to pMPF24, were transformed into strain MG1655 to obtain strains MGA01 to MGA24, MGB01 to MGB24, and MGF01 to MGF24, respectively. The pCFN04 plasmid (expressing GFP using the wild-type PfliA promoter) was transformed into strain MG1655 to obtain strain MGA-WT; the pCFN05 plasmid (expressing GFP using the wild-type PosmB promoter) was transformed into strain MG1655 to obtain strain MGB-WT; the pCFN06 plasmid (expressing GFP using the wild-type Prmf promoter) was transformed into strain MG1655 to obtain strain MGF-WT; 75 strains, MGA01 to MGA24, MGB01 to MGB24, MGF01 to MGF24, MGA-WT, MGB-WT, and MGF-WT, were cultured overnight in LB medium supplemented with 100 mg / L ampicillin, and the obtained bacterial cultures were inoculated into carnosine fermentation medium at a 10% inoculum. The carnosine fermentation medium formula (1L) was as follows: glucose 20 g, magnesium sulfate heptahydrate 0.8 g, diammonium hydrogen phosphate 4 g, potassium dihydrogen phosphate 6.67 g, potassium citrate 1.35 g, 3-morpholine propanesulfonic acid 20.9 g, yeast extract 2.5 g, ferrous sulfate heptahydrate 50 mg, calcium chloride dihydrate 10 mg, zinc sulfate heptahydrate 11 mg, manganese sulfate tetrahydrate 2.5 mg, copper sulfate pentahydrate 5 mg, ammonium molybdate 0.5 mg, sodium borate decahydrate 0.1 mg, and ampicillin 100 mg. The inoculated bacterial culture was cultured at 37℃ and 200 rpm for 18 h, with samples taken every 2 h to measure OD. 600And green fluorescence intensity. Based on the detection results, 5 strains were screened: MGA15, MGB21, MGF09, MGB04, and MGF02. These, along with 3 strains expressing GFP using wild-type promoters: MGA-WT, MGB-WT, and MGF-WT, totaled 8 strains. The corresponding 8 GFP promoters exhibited different initiation times, initiation intensities, and post-initiation intensity changes. The specific characterization results of these 8 promoters or promoter mutants are shown in Table 1. Among them, PfliA is the GFP promoter in the MGA-WT strain (the sequence is shown in the first to 500 bases of SEQ ID NO:18), PfliA-M15 is the GFP promoter in the MGA15 strain, PosmB-M21 is the GFP promoter in the MGB21 strain, Prmf-M9 is the GFP promoter in the MGF09 strain, PosmB-M4 is the GFP promoter in the MGB04 strain, PosmB is the GFP promoter in the MGB-WT strain (the sequence is shown in the first to 500 bases of SEQ ID NO:22), Prmf is the GFP promoter in the MGF-WT strain (the sequence is shown in the first to 500 bases of SEQ ID NO:23), and Prmf-M2 is the GFP promoter in the MGF02 strain. The start-up time is the point in time when the maximum fluorescence intensity value is reached (90% or higher). The start-up intensity is the fluorescence intensity value measured at the start-up time point. The fold change in start-up intensity is the ratio of the fluorescence intensity measured at the start-up time to the fluorescence intensity measured at the sampling point prior to the start-up time. The fluorescence intensity values ​​mentioned above refer to the values ​​after the sample has been washed and resuspended with phosphate buffer and the OD value has been adjusted. 600 The fluorescence value is 0.6, and the background fluorescence value is the fluorescence value of the negative control strain. The negative control strain is a strain whose gfp gene does not have a promoter compared with the test strain.

[0104] Table 1. Characterization of growth-dependent promoters and their mutants

[0105]

[0106] Identification of promoter mutant sequences. The sequences of promoter mutants were identified by sequencing. The sequence of PfliA-M15 is shown in SEQ ID NO:26, the sequence of PosmB-M21 is shown in SEQ ID NO:27, the sequence of Prmf-M9 is shown in SEQ ID NO:28, the sequence of PosmB-M4 is shown in SEQ ID NO:29, and the sequence of Prmf-M2 is shown in SEQ ID NO:30.

[0107] Characterization of promoters Ptrcc, PJ23100, and Ptc. The promoters Ptrcc, PJ23100, and Ptc in strain CTZ03 were characterized using the methods described above. The results showed that the fluorescence intensity values ​​corresponding to these three promoters were 3518.24, 3120.03, and 3476.55 at the beginning of strain culture, respectively. The fluorescence intensity values ​​measured at subsequent sampling points deviated by no more than 10% compared to the initial culture values, indicating that the Ptrcc, PJ23100, and Ptc promoters do not exhibit growth-stage dependent characteristics.

[0108] Example 3: Effect of a growth-phase-dependent promoter-based dynamic regulation system on the synthesis of carnosine

[0109] The carnosine-synthesizing strain CTZ03 contains three modules: the carnosine synthesis gene expression module Ptrcc-SmpepD controlled by the Ptrcc promoter, the β-alanine synthesis gene expression module PJ23100-BspanD-aspA-CgaspB controlled by the PJ23100 promoter, and the L-histidine synthesis gene expression module Ptc-CghisG controlled by the Ptc promoter. fbr In this embodiment, eight growth-stage-dependent promoters from Table 1 were selected to replace the promoters in CTZ03 to control the carnosine synthesis gene expression module, β-alanine synthesis gene expression module, or L-histidine synthesis gene expression module. Plasmids were constructed using Gibson assembly and transformed into strain CTZ02 to obtain carnosine synthesis strains CTZ04 to CTZ45 containing a dynamic regulatory system. The overnight culture of strains CTZ04 to CTZ45 was inoculated at a 10% inoculum into 500 mL shake flasks with baffles containing 50 mL of fermentation medium and cultured at 37°C and 200 rpm for 48 h. The carnosine fermentation medium formulation was as described in Example 2, and the required antibiotic concentration and type were 100 mg / L ampicillin and 50 mg / L streptomycin. The yield at 48 h was determined by high-performance liquid chromatography (HPLC). The control strain was CTZ03, which differed from strains CTZ04 to CTZ45 only in the promoters used to control the expression of the carnosine synthesis gene module, the β-alanine synthesis gene module, or the L-histidine synthesis gene module. The fermentation results are shown in Table 2.

[0110] Table 2. Production of carnosine-synthesizing strains using a dynamic regulation system

[0111]

[0112] The results in Table 2 show that among strains CTZ04 to CTZ45, strain CTZ35, which uses a dynamic regulation system, had the highest yield, reaching 1.57 g / L, which is 70.65% higher than the control strain CTZ03. Within strain CTZ35, the expression modules for the carnosine synthesis gene were controlled by the Prmf-M9 promoter, the β-alanine synthesis gene by the PfliA-M15 promoter, and the L-histidine synthesis gene by the PosmB promoter. Compared to strain CTZ07, which only uses the Prmf-M9 promoter to control the carnosine synthesis gene expression module, the yield was increased by 34.19%; compared to strain CTZ13, which only uses the PfliA-M15 promoter to control the β-alanine synthesis gene expression module, the yield was increased by 53.92%; and compared to strain CTZ25, which only uses the PosmB promoter to control the L-histidine synthesis gene expression module, the yield was increased by 29.75%.

[0113] Example 4: The Effect of Dynamic Regulation Systems on Genome Integration

[0114] To test the effect of the dynamic regulatory system on genome integration in strain CTZ35, a CRISPR / Cas9-based genome editing method was used to integrate the carnosine synthesis gene expression module controlled by the Prmf-M9 promoter into the yjiV site on the genome of strain CTZ02, specifically between the sequences aaggctggccctttggctat (SEQ ID NO:31) and tgatgagccgctcccgatgt (SEQ ID NO:32), thus constructing strain CTZ46. The β-alanine synthesis gene expression module controlled by the PfliA-M15 promoter was then integrated into the ycdN site on the genome of strain CTZ46, specifically between the sequences tgaaagtggttccacaatcc (SEQ ID NO:33) and gccacccacccttaaacgtt (SEQ ID NO:32). The CTZ47 strain was constructed between sequences acatctggtgctgccccaca (SEQ ID NO:35) and caccctgtgcccgcaacgca (SEQ ID NO:36). The L-histidine synthesis gene expression module controlled by the PosmB promoter was integrated into the ilvG site on the genome of the CTZ47 strain, specifically between the sequences acatctggtgctgccccaca (SEQ ID NO:35) and caccctgtgcccgcaacgca (SEQ ID NO:36), thus constructing the CTZ48 strain.

[0115] Construction of the control strain. The carnosine synthesis gene expression module controlled by the Ptrcc promoter, the β-alanine synthesis gene expression module controlled by the PJ23100 promoter, and the L-histidine synthesis gene expression module controlled by the Ptc promoter were sequentially integrated into the yjiV, ycdN, and ilvG sites on the genome of strain CTZ02. The integration sites were the same as the corresponding integration sites in strain CTZ48, thus constructing the control strain CTZ49.

[0116] The carnosine yields of strains CTZ48 and CTZ49 were tested by fermentation using the method described in Example 3, and were 0.67 g / L and 0.45 g / L, respectively. This indicates that the dynamic regulatory system has the effect of increasing yield when integrating the genome, and can increase the yield by 48.89%.

[0117] Example 5: Effects of the dynamic regulation system on different carnosine-producing strains

[0118] To test the effectiveness of the dynamic regulation system in different carnosine-producing strains, a carnosine-producing strain CTZ50 and its control strain CTZ51 were constructed using a CRISPR / Cas9-based genome editing method. Specifically, compared with strain CTZ48, the genotype of strain CTZ50 was modified as follows, or compared with strain CTZ49: the SmpepD gene was replaced with the CppepD gene from Clostridium perfringens (codon-optimized sequence shown in SEQ ID NO:37); the Cgpyc gene expression sequence from Corynebacterium glutamicum was inserted after the CgaspB gene (RBS sequence shown in bases 1 to 27 of SEQ ID NO:38, Cgpyc gene sequence shown in bases 28 to 3450 of SEQ ID NO:38 after codon optimization); and the gnd gene expression sequence from Escherichia coli was inserted after the zwf gene (RBS sequence shown in bases 1 to 27 of SEQ ID NO:39, gnd gene coding sequence shown in SEQ ID NO:39). NO:39 (bases 28 to 1434 are shown). Overexpression of the Cgpyc gene aims to enhance β-alanine synthesis, while overexpression of the gnd gene aims to enhance L-histidine synthesis. Fermentation tests using the method described in Example 3 yielded carnosine production of strains CTZ50 and CTZ51 at 0.74 g / L and 0.53 g / L, respectively. This indicates that applying the dynamic regulation system to the carnosine-producing strains in this example effectively increases yield by 39.62%.

[0119] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0120] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims, and the specification can be used to interpret the content of the claims.

Claims

1. A dynamic regulation system for the synthesis of L-carnosine, characterized in that, It includes: (a) A first expression unit comprising a first growth phase-dependent promoter and a gene encoding carnosine synthase operably linked downstream thereof; (b) A second expression unit comprising a second growth phase-dependent promoter and a gene or gene cluster operatively linked downstream thereof encoding at least one key enzyme in the β-alanine synthesis pathway; (c) A third expression unit comprising a third growth phase-dependent promoter and a gene or gene cluster operatively linked downstream thereof encoding at least one key enzyme in the L-histidine synthesis pathway. The first growth-period-dependent promoter is a variant of promoter Prmf; the second growth-period-dependent promoter is a variant of promoter PfliA or a variant of Prmf; and the third growth-period-dependent promoter is promoter PosmB or a variant thereof. The first growth-period-dependent promoter is a first variant of promoter PosmB, the second growth-period-dependent promoter is a variant of promoter PfliA, and the third growth-period-dependent promoter is a second variant of promoter PosmB. The first growth-phase-dependent promoter is a second variant of promoter PosmB, the second growth-phase-dependent promoter is a variant of promoter Prmf, and the third growth-phase-dependent promoter is a second variant of promoter PosmB. The sequence of the variant of Prmf is shown in SEQ ID NO: 30; The sequence of the variant of PfliA is shown in SEQ ID NO:26; The sequence of PosmB is the first to 500 bases of the sequence shown in SEQ ID NO:22, the sequence of the first variant of PosmB is shown in SEQ ID NO:27, and the sequence of the second variant of PosmB is shown in SEQ ID NO:

29. The gene encoding carnosine synthase is selected from the gene SmpepD from Serratia marcescens and the gene CppepD from Clostridium perfringens. The gene cluster encoding key enzymes in the β-alanine synthesis pathway includes the gene panD encoding aspartate-α-decarboxylase, the gene aspA encoding aspartate aminopyrase, and the gene aspB encoding aspartate transaminase. The gene cluster encoding key enzymes in the L-histidine synthesis pathway includes the gene hisG encoding ATP phosphoribosyltransferase, the gene prs encoding phosphoribosyl pyrophosphate synthase, and the gene zwf encoding glucose-6-phosphate dehydrogenase.

2. The dynamic regulation system for synthesizing L-carnosine as described in claim 1, characterized in that, The second expression unit further includes the gene pyc located downstream of the gene aspB; and / or, The third expression unit also includes the gene gnd, which is located downstream of the gene zwf.

3. The dynamic regulation system for synthesizing L-carnosine as described in claim 2, characterized in that, The dynamic control system meets one or more of the following conditions (A1) to (A10): (A1) The sequence of the gene SmpepD includes bases 83 to 1543 of the sequence shown in SEQ ID NO:1; (A2) The sequence of the gene CppepD includes the nucleic acid fragment shown in SEQ ID NO:37; (A3) The gene panD is derived from Bacillus subtilis; (A4) The gene aspA is derived from Escherichia coli; (A5) The gene aspB is derived from Corynebacterium glutamicum; (A6) The gene hisG is derived from Corynebacterium glutamicum, and its encoded protein carries the S143F mutation and does not contain a C-terminal regulatory region. (A7) The gene prs is derived from Escherichia coli; (A8) The zwf gene described is derived from Escherichia coli; (A9) The gene pyc is derived from Corynebacterium glutamicum; (A10) The gene gnd is derived from Escherichia coli.

4. The dynamic regulation system for synthesizing L-carnosine as described in claim 3, characterized in that, The sequence of the gene panD includes bases 63 to 446 as shown in SEQ ID NO:4; The sequence of the gene aspA includes bases 474 to 1910 as shown in SEQ ID NO:4; The sequence of the gene aspB includes bases 1938 to 3236 as shown in SEQ ID NO:4; The sequence of the gene hisG is bases 82 to 708 of the sequence shown in SEQ ID NO:7; The sequence of the gene prs includes bases 736 to 1683 of the sequence shown in SEQ ID NO:7; The sequence of the gene zwf includes bases 1711 to 3186 of the sequence shown in SEQ ID NO:7; The sequence of the gene pyc includes bases 28 to 3450 of the sequence shown in SEQ ID NO:38; and / or, The sequence of the gene gnd includes bases 28 to 1434 of the sequence shown in SEQ ID NO:

39.

5. An isolated polynucleotide, characterized in that, It includes a first expression unit, a second expression unit, and a third expression unit as defined in any one of claims 1 to 4.

6. The isolated polynucleotide as described in claim 5, characterized in that, The isolated polynucleotides are combination products, and each independently contains at least one or more of the first expression unit, the second expression unit, and the third expression unit.

7. A genetically engineered bacterium, characterized in that, It comprises the dynamic regulation system for synthesizing L-carnosine as described in any one of claims 1 to 4; The bacteria on its chassis are Escherichia coli.

8. The genetically engineered bacteria as described in claim 7, characterized in that, In the genome of chassis bacteria, transcriptional repression of the histidine synthesis operon is relieved, and / or the gene purR is knocked out or inactivated.

9. The genetically engineered bacteria as described in claim 8, characterized in that, The first expression unit is integrated into the yjiV site in the chassis bacterial genome; The second expression unit is integrated into the ycdN site in the chassis bacterial genome; and / or, The third expression unit is integrated into the ilvG site in the chassis bacterial genome.

10. A method for producing L-carnosine, characterized in that, Including the following steps: Cultures are prepared by culturing the genetically engineered bacteria according to any one of claims 7-9 in a culture medium suitable for fermentation; and, L-carnosine was collected from the culture.

11. The dynamic regulation system for synthesizing L-carnosine as described in any one of claims 1 to 4, the isolated polynucleotide as described in claim 5 or 6, or the genetically engineered bacteria as described in any one of claims 7 to 9 in the preparation of L-carnosine.

Citation Information

Patent Citations

  • Method for increasing L-carnosine yield of escherichia coli by increasing PRPP supply

    CN119979435A