Application of dsRNA of targeted actin coding gene
By combining dsRNA targeting the actin-encoding gene with layered double hydroxide nanomaterials, the problems of low delivery efficiency and high cost of dsRNA in anthrax control were solved, achieving efficient and targeted anthrax control.
Patent Information
- Application Number
- CN202610165300.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-05
- Publication Date
- 2026-03-13
- Estimated Expiration
- 2046-02-05
AI Technical Summary
When using existing RNA pesticides to control anthracnose, the exposed dsRNA is easily degraded by environmental enzymes, resulting in low delivery efficiency and high cost for large-scale synthesis, leading to poor control effects.
A dsRNA nanocomposite was formed by combining dsRNA targeting the actin-encoding gene with layered double hydroxide (LDH) nanomaterials, which was then sprayed on the fruit to prevent anthracnose.
It improves the targeting and control efficacy of dsRNA, significantly reduces the area of anthracnose lesions, and lowers the risk of disease infection, demonstrating highly efficient and targeted control.
Smart Images

Figure CN121647249A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of RNA biological control technology, specifically involving the application of dsRNA targeting actin encoding genes. Background Technology
[0002] Anthrax ( genus Anthrax) Colletotrichum genus Anthracnose is one of the world's ten most important fungal plant pathogens. The anthracnose it causes severely damages crops, cash crops, and horticultural plants, often leading to leaf death, fruit rot, and sharp yield reduction. In tropical, subtropical, and Mediterranean regions, anthracnose lowers the quality of exported fruits. Mangoes and bananas, as important export fruits in tropical and subtropical regions, are particularly susceptible to anthracnose, severely reducing their commercial value and often causing significant economic losses after harvest, posing a prominent threat to the global mango and banana industries.
[0003] RNA pesticides are novel biological pesticides developed based on RNA interference technology. Essentially, they specifically bind to the mRNA transcribed from specific genes in target organisms. Through the naturally occurring RNAi pathway within the target organism, they cause transcript degradation or inhibit translation, thereby interfering with the normal growth of the target organism and its harm to the host plant, ultimately achieving pest control and plant protection. RNA pesticides are defined as biological pesticides. Compared to traditional chemical pesticides, double-stranded RNA (dsRNA) pesticides have many advantages. First, dsRNA has strong specificity and efficient gene silencing ability without involving transgenic technology. Second, based on target design, dsRNA can inhibit the growth of viruses, bacteria, and fungi, thus controlling the diseases they cause. Furthermore, dsRNA can cross cell membranes and be delivered within the body. Finally, dsRNA is easily degraded in the environment, making it an environmentally friendly pesticide. Based on these advantages, RNA pesticides offer significant benefits for pest and disease control: high specificity, good efficacy, low risk of resistance development, non-toxic, harmless, and residue-free, with low development costs, representing a cutting-edge direction in green agricultural pest control.
[0004] However, the application of RNA pesticides also faces many challenges. For example, naked dsRNA is easily degraded by enzymes and ultraviolet light in the environment, resulting in short-lived efficacy; the epidermis of harmful organisms hinders the absorption of dsRNA, leading to low dsRNA delivery efficiency and affecting the silencing effect of target genes; and large-scale synthesis of dsRNA is costly. Therefore, how to obtain highly efficient and targeted anthrax RNA pesticides is an urgent problem to be solved in this field. Summary of the Invention
[0005] The purpose of this invention is to provide the application of dsRNA targeting actin-encoding genes, which can effectively and specifically control crop anthracnose.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: This invention provides the application of dsRNA targeting the actin-encoding gene in the control of crop anthracnose. The nucleotide sequence of the dsRNA is shown in SEQ ID No. 2, and the dsRNA is produced by *Bacillus anthracnose*. CaACTIN Anthrax bacteria were obtained by transcribing the gene target gene segment. CaACTIN The nucleotide sequence of the gene target gene segment is shown in SEQ ID No. 1.
[0007] Preferably, the crops include: mangoes and bananas.
[0008] Preferably, the pathogen causing anthrax includes: *Anthrax sicca*. Colletotrichum siamense Asian anthrax bacteria Colletotrichum asianum Banana anthrax Colletotrichum musae .
[0009] The present invention also provides products for the prevention and control of crop anthracnose, including the above-mentioned dsRNA targeting the actin encoding gene.
[0010] Preferably, the product further includes layered double hydroxides (LDH) of nanomaterials.
[0011] More preferably, the nanomaterial layered double hydroxide is a magnesium / aluminum layered double hydroxide.
[0012] The present invention also provides a method for controlling crop anthracnose, comprising applying the above-mentioned product to crops.
[0013] More preferably, the product is sprayed onto mango or banana fruits.
[0014] The beneficial effects of this invention are as follows: This invention first obtains segmental dsRNA of the target gene using in vitro dsRNA synthesis technology, then combines it with layered double hydroxide (LDH) nanomaterials to obtain a dsRNA nanocomposite for crop control. The dsRNA nanocomposite is then sprayed onto mango and banana fruits, and *Anthracis chinensis* is inoculated onto the mango and banana fruits respectively. Colletotrichum siamense 28-2, Asian anthrax bacteria Colletotrichum asianum 02-3, Banana anthrax Colletotrichum musae 3-1. Measure the area of lesions to obtain a combination of target gene dsRNA and nano-LDH that can effectively control anthracnose in mango and banana fruits, enabling efficient and targeted control of crop anthracnose. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0016] Figure 1 for CaACTIN The diagram shows the protein domain structure and the electrophoresis diagram of the transcription product provided by the present invention. Figure a shows the schematic diagram of the position of dsCaACTIN on the CaACTIN protein; Figure b shows the electrophoresis diagram of the transcription product, with lane M being the DNADL2000 marker and lane 1 being the electrophoresis result of dsCaACTIN. Figure 2 The diagrams showing the control effect of mango anthracnose (Anthracnose fungus) provided by this invention are as follows: Figure a shows the phenotype of mango anthracnose lesions after spraying with dsRNA; Figure b shows the area of mango anthracnose lesions after spraying with dsRNA. Figure 3 The diagrams show the control effect of anthracnose on mango fruit (Asian anthracnose fungus) provided by this invention. Figure a shows the phenotype of anthracnose lesions on mango fruit after spraying with dsRNA; Figure b shows the area of anthracnose lesions on mango fruit after spraying with dsRNA. Figure 4 The diagrams provided by this invention illustrate the control effect of banana anthracnose (Bacillus anthracnose). Figure a shows the phenotype of anthracnose lesions on banana fruits after spraying with dsRNA; Figure b shows the area of anthracnose lesions on banana fruits after spraying with dsRNA. Detailed Implementation
[0017] In this invention, unless otherwise specified, the materials, reagents and equipment used are all conventional selections.
[0018] This invention provides anthrax bacteria CaACTIN dsCaACTIN, a gene targeting a specific gene region, is used to control anthracnose in crops; Anthracnose fungus. CaACTINThe nucleotide sequence of the gene target gene segment is shown in SEQ ID No. 1, specifically: 5′-ATGGAAGAGGAGGTTGCTGCCCTCGTTATCGACAATGGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCTGTCTTCCCCTCCATCGTCGGTCGCCCTCGCCACCATGGTATCATGA-3′; the nucleotide sequence of dsCaACTIN is shown in SEQ ID No. 2, specifically: 5′-UCAUGAUACCAUGGUGGCGAGGGCGACCGACGAUGGAGGGGAAGACAGCUCUGGGCGCAUCGUCACCGGCGAAACCGGCCUUGCACAUACCCGAACCAUUGUCGAUAACGAGGGCAGCAACCUCCUCUUCCAU-3′; the dsRNA sequence shown in SEQ ID No. 2 is inversely complementary to the nucleotide sequence shown in SEQ ID No. 1.
[0019] To further illustrate the present invention, the solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0020] Example 1. Previous studies have shown that actin CaACTIN Gene( CaACTIN The gene (accessed on NCBI with accession number OP142727.1) is a housekeeping gene essential for the survival of anthrax bacteria, and it may have the potential to serve as a target for anthrax control; according to CaACTIN A pair of specific primers, dsCaACTIN-F (SEQ ID No. 3) and dsCaACTIN-R (SEQ ID No. 4), were designed to extract the highly pathogenic wild-type strain of *Anthracis Asiana*. Colletotrichum asianum Using DNA from mango fruit anthracnose collected in Hainan from the laboratory and isolated and identified as a template, a DNA fragment (SEQ ID No. 1) was amplified for subsequent dsCaACTIN synthesis. Primers were designed based on the first 133 bp of the CaACTIN gene to synthesize dsRNA targeting this actin-encoding gene. Because the ACTIN gene family exhibits high overall homology, designing the full-length sequence could easily lead to off-target effects of non-specific silencing. Selecting the specific first 133 bp region significantly reduces intergene homology, effectively avoiding off-target risks and improving the specificity and experimental safety of dsRNA-mediated gene silencing. The position of dsCaACTIN on the CaACTIN protein is shown below. Figure 1As shown in Figure a. The specific primer sequences are shown in Table 1: Table 1 Primer Information
[0021] 2. Polymerase chain reaction (PCR) amplification was performed using 2× Rapid Taq Master Mix (Nanjing Novizan Biotechnology Co., Ltd., catalog number: P222-03). The reaction system is shown in Table 2. The PCR reaction product was purified and recovered using an agarose gel DNA recovery kit (HiPure Gel Pure DNA Mini Kit, Guangzhou Meiji Biotechnology Co., Ltd., catalog number: D2111-03) to finally obtain the target DNA fragment (SEQ ID No. 1).
[0022] Table 2 50μL reaction system
[0023] Note: After mixing, gently pipette to mix thoroughly, and briefly centrifuge the reagent to the bottom of the tube.
[0024] (1) The PCR reaction procedure is as follows: (a) Pre-denaturation at 95℃ for 5 min.
[0025] (b) Denaturation at 95°C for 30 s.
[0026] (c) Anneal at 58℃ for 30 s.
[0027] (d)72℃ extended for 10 s.
[0028] (e) Repeat steps (b) to (d) 35 times.
[0029] (f) Extend at 72°C for another 10 min.
[0030] (g) Cycle at 4℃.
[0031] (2) Briefly centrifuge the PCR products. Measure the volume with a pipette and transfer it to a sterile 1.5 mL centrifuge tube.
[0032] (3) Add an equal volume of GDP buffer solution and mix by inverting or vortexing.
[0033] (4) Attach the HiPure DNA column to the collection tube. Transfer the mixture to the DNA column. Centrifuge at 12,000 × g for 30 seconds.
[0034] (5) Discard the filtrate and put the column back into the collection tube. Add 600 μL of DW2 buffer to the column. Centrifuge at 12,000 ×g for 30 seconds.
[0035] (6) Discard the filtrate and put the column back into the collection tube. Add 300 μL of DW2 buffer to the column. Centrifuge at 12,000 ×g for 2 minutes.
[0036] (7) Place the column into a 1.5 mL centrifuge tube and add 30 μL of elution buffer to the center of the column membrane. Incubate for 2 minutes. Centrifuge at 12,000 × g for 1 minute. Discard the column and store the DNA at -20°C.
[0037] 3. dsRNA was synthesized in vitro using the T7 RNAi Transcription Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number: TR102-02). T7 RNA polymerase recognizes DNA templates with a T7 promoter and uses four NTPs as substrates to synthesize dsCaACTIN via in vitro transcription. The specific method is as follows: a. Prepare a 20 μL reaction system as shown in Table 3.
[0038] Table 3 20μL reaction system
[0039] b. The PCR product dsCaACTIN (SEQ ID No. 2) was obtained by reacting at 37 ℃ for 6 h in a PCR instrument.
[0040] c. Dilute 100 U / μL RNase T1 to 10 U / μL with RNase T1 dilution buffer, and incubate the transcription product to digest excess template DNA and single-stranded RNA. The incubation system is shown in Table 4.
[0041] Note: RNase T1 specifically degrades single-stranded RNA and the three G bases at the 5′ end. Diluted RNase T1 should be used as soon as possible and should not be stored.
[0042] Table 4 Incubation System
[0043] Note: After mixing, gently pipette to mix thoroughly, and briefly centrifuge the reagent to the bottom of the tube.
[0044] d. Incubate at 37 ℃ for 30 min to obtain pure dsCaACTIN (SEQ ID No.2).
[0045] e. Electrophoresis was used to detect the transcription product (i.e., dsCaACTIN as shown in SEQ ID No. 2), and the results were as follows: Figure 1 As shown in Figure b.
[0046] f. Product purification
[0047] RNA was purified using the magnetic bead method.
[0048] (1) Remove the RNA purification beads from 4°C and allow them to equilibrate at room temperature for 30 min. Invert or vortex to mix before use.
[0049] (2) Add 80 μL of magnetic bead solution to the transcription product and pipette to mix the solution thoroughly more than 10 times.
[0050] (3) Incubate at room temperature for 8 min to allow the RNA to fully bind with the magnetic beads.
[0051] (4) Place the PCR tube on the magnetic rack for 5 minutes. After the solution becomes clear, carefully remove the supernatant. When aspirating the supernatant, be careful not to disturb the magnetic beads.
[0052] (5) Keep the PCR tube on the magnetic rack at all times, add 200 μL of freshly prepared 80% ethanol, being careful not to disturb the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Repeat this step once.
[0053] (6) Open the lid and air dry the magnetic beads for 5-10 minutes. Dry until there is no water on the surface of the magnetic beads. Over-drying will affect the elution of RNA.
[0054] (7) Remove the PCR tube from the magnetic rack, add 40 μL of RNase-free water, use a pipette to blow the magnetic beads off the tube wall, mix thoroughly, and incubate at room temperature for 3 min.
[0055] (8) Place the PCR tube on a magnetic rack. After the solution has clarified, carefully transfer the supernatant to a new RNase-free EP tube, being careful not to pick up the magnetic beads. To avoid the magnetic beads affecting subsequent experiments, reserve 1-2 μL of solution when transferring the product to prevent picking up the magnetic beads.
[0056] (9) Detect the A260 absorbance of the product to determine its concentration, and store the purified product (i.e. dsCaACTIN) at -20℃.
[0057] 4. Preparation of anthrax inoculum: The Asian anthrax bacteria in the preservation tube... Colletotrichum asianum02-3 (obtained from anthracnose-infected mango fruits collected from Hainan by the laboratory and isolated), *Anthracnose sirenus* Colletotrichum siamense 28-2 (obtained from anthracnose-infected mango leaves collected from Hainan during laboratory visits and isolated), Banana anthracnose fungus. Colletotrichum musae 3-1 (obtained from anthracnose-infected banana fruits collected in Hainan by the laboratory) was activated on PDA solid medium. Fresh mycelia were scraped from the edges of the activated strain and cultured in PD liquid medium at 28°C for 4 days. The fresh spore suspension was then filtered and diluted to 1×10⁻⁶. 6 per mL.
[0058] 5. Layered double hydroxide (LDH) nanomaterials loaded with dseGFP (dsRNA targeting enhanced Green Fluorescent Protein, a double-stranded RNA molecule encoding enhanced green fluorescent protein GFP).
[0059] Magnesium / aluminum layered double hydroxide MgAl-LDH (purchased from Nanjing Xianfeng Nanomaterials Technology Co., Ltd., product number: XFL02) was dissolved in DEPC water to obtain LDH working solution (200 μg / mL); dseGFP was diluted with LDH working solution to prepare LDH-dseGFP mixture (final concentration of dseGFP in the mixture was 200 ng / μL); the diluted LDH-dseGFP mixture was placed in a 55℃ water bath and allowed to stand for 1 min, then quickly transferred to a high-speed vortex shaker and shaken for 2 min, and allowed to stand for 2 min. At this time, dseGFP was adsorbed on the LDH surface to form stable LDH-dseGFP nanoparticles. dseGFP is artificially synthesized in the laboratory, and its nucleotide sequence is as SEQ ID As shown in No. 7, specifically: 5′-GCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAG CGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCG-3′. Based on the gene SEQ ID No. 7, a pair of specific primers dseGFP-F (SEQ ID No. 5) and dseGFP-R (SEQ ID No. 6) were designed. The primer sequences are shown in Table 1. The specific synthesis method is the same as that for dsCaACTIN.
[0060] 6. dsCaACTIN supported on layered double hydroxide (LDH) nanomaterials.
[0061] Magnesium / aluminum layered double hydroxide MgAl-LDH was dissolved in DEPC water to obtain LDH working solution (200 μg / mL). dsCaACTIN was diluted with the LDH working solution to prepare an LDH-dsCaACTIN mixture (final concentration of dsCaACTIN in the mixture was 200 ng / μL). The diluted LDH-dsCaACTIN mixture was placed in a 55 ℃ water bath and allowed to stand for 1 min, then quickly transferred to a high-speed vortex shaker and shaken for 2 min, followed by standing for 2 min. At this point, dsCaACTIN was adsorbed onto the LDH surface, forming stable LDH-dsCaACTIN nanoparticles.
[0062] 7. Application of LDH-dsCaACTIN in the prevention and control of mango anthracnose (Asian anthracnose).
[0063] The preventive effect of LDH-dsCaACTIN nano-formulation on *Anthracis aureus* in mango was analyzed, and two treatment groups were designed. The first group was sprayed with LDH-dseGFP as a control; The second group was treated with LDH-dsCaACTIN.
[0064] Mango fruits of uniform growth and size were selected, and two treatment groups (LDH-dsCaACTIN group and control LDH-dseGFP group) were set up, with 5 fruits in each group.
[0065] Two groups of fruits were sprayed separately: each fruit was evenly sprayed with 150 μL of the corresponding treatment solution (LDH-dsCaACTIN or LDH-dseGFP). After treatment and standing for 24 h, six evenly distributed inoculation points were selected on each fruit, and 4 μL of a 1×10⁻⁶ solution was added to each inoculation point. 6 The inoculation procedure was completed using a suspension of Bacillus anthracis 02-3 spores per mL. Results are shown below. Figure 2 .
[0066] The results showed significant differences between the control group LDH-dseGFP and LDH-dsCaACTIN, such as... Figure 2 As shown in Figure a (observation 5 days post-inoculation), the lesion area in the LDH-dsCaACTIN treatment (right) was significantly smaller than that in the control treatment (left). Figure 2 As shown in Figure b, the average lesion area of the control group LDH-dseGFP was 0.2133 cm². 2 The average lesion area in the LDH-dsCaACTIN treatment group was 0.0523 cm². 2Therefore, the dsCaACTIN treatment resulted in a 75.48% reduction in lesion area compared to the control. This indicates that the application of LDH-dsCaACTIN can effectively reduce the infection of mango fruit by Asian anthracnose and has a good protective effect.
[0067] 8. Application of LDH-dsCaACTIN in the prevention and control of mango anthracnose (Anthracnose fungus).
[0068] The preventive effect of LDH-dsCaACTIN nano-formulation on *Anthracis sinensis* in mango was analyzed, and two treatment groups were designed. The first group was sprayed with LDH-dseGFP as a control; The second group was treated with LDH-dsCaACTIN.
[0069] Mango fruits of uniform growth and size were selected, and two treatment groups (LDH-dsCaACTIN group and control LDH-dseGFP group) were set up, with 5 fruits in each group.
[0070] Two groups of fruits were sprayed separately: each fruit was evenly sprayed with 150 μL of the corresponding treatment solution (LDH-dsCaACTIN or LDH-dseGFP). After treatment and standing for 24 h, six evenly distributed inoculation points were selected on each fruit, and 4 μL of a 1×10⁻⁶ solution was added to each inoculation point. 6 The inoculation procedure was completed using a suspension of *Anthrax sicca* 28-2 spores per mL. Results are shown below. Figure 3 .
[0071] The results showed significant differences between the control group LDH-dseGFP and LDH-dsCaACTIN, such as... Figure 3 As shown in Figure a (observation 5 days post-inoculation), the lesion area in the LDH-dsCaACTIN treatment (right) was significantly smaller than that in the control treatment (left). Figure 3 As shown in Figure b, the average lesion area of the control group LDH-dseGFP was 0.1688 cm². 2 The average lesion area in the LDH-dsCaACTIN treatment group was 0.0929 cm². 2 Therefore, the dsCaACTIN treatment resulted in a 44.96% reduction in lesion area compared to the control. This indicates that the application of LDH-dsCaACTIN can effectively reduce the infection of mango fruit by *Anthracis sinensis* and has a good protective effect.
[0072] 9. Application of LDH-dsCaACTIN in the prevention and control of banana anthracnose (Bacillus anthracnose).
[0073] The preventive effect of LDH-dsCaACTIN nano-formulation on banana anthracnose was analyzed, and two treatment groups were designed. The first group was sprayed with LDH-dseGFP as a control; The second group was treated with LDH-dsCaACTIN.
[0074] Banana fruits of uniform growth and size were selected, and two treatment groups (LDH-dsCaACTIN group and control LDH-dseGFP group) were set up, with 5 fruits in each group.
[0075] Two groups of fruits were sprayed separately: each fruit was evenly sprayed with 150 μL of the corresponding treatment solution (LDH-dsCaACTIN or LDH-dseGFP). After treatment and standing for 24 h, six evenly distributed inoculation points were selected on each fruit, and 4 μL of a 1×10⁻⁶ solution was added to each inoculation point. 6 The inoculation procedure was completed using a suspension of 3-1 spores of *Anthracis bananais* at a concentration of 1 spore per mL. Results are shown below. Figure 4 .
[0076] The results showed significant differences between the control group LDH-dseGFP and LDH-dsCaACTIN, such as... Figure 4 As shown in Figure a (observation 5 days post-inoculation), the lesion area in the LDH-dsCaACTIN treatment (right) was significantly smaller than that in the control treatment (left). Figure 4 As shown in Figure b, the average lesion area of the control group LDH-dseGFP was 0.2728 cm². 2 The average lesion area in the LDH-dsCaACTIN treatment group was 0.1110 cm². 2 Therefore, the dsCaACTIN treatment resulted in a 59.31% reduction in lesion area compared to the control. This indicates that applying LDH-dsCaACTIN can effectively reduce the infection of banana fruits by banana anthracnose and has a good protective effect.
[0077] Obviously, the above embodiments of the present invention are merely examples to illustrate the present invention more clearly, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is impossible to exhaustively list all implementation methods here. Any obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.
Claims
1. The application of dsRNA targeting the actin-encoding gene in the control of crop anthracnose, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID No. 2, and the dsRNA is derived from anthrax bacteria. CaACTIN Anthrax bacteria were obtained by transcribing the gene target gene segment. CaACTIN The nucleotide sequence of the gene target gene segment is shown in SEQ ID No.
1.
2. The application according to claim 1, characterized in that, The crops mentioned include: mangoes and bananas.
3. The application according to claim 1, characterized in that, The pathogens causing anthrax include: *Anthrax sicca*. Colletotrichum siamense Asian anthrax bacteria Colletotrichum asianum Banana anthrax Colletotrichum musae .
4. A product for the prevention and control of crop anthracnose, characterized in that, Includes the dsRNA targeting the actin-encoding gene as described in claim 1.
5. The product according to claim 4, characterized in that, The product also includes layered double hydroxides made of nanomaterials.
6. The product according to claim 5, characterized in that, The nanomaterial layered double hydroxide is a magnesium / aluminum layered double hydroxide.
7. A method for controlling crop anthracnose, characterized in that, This includes applying the product according to any one of claims 4 to 6 to crops.
8. The method according to claim 7, characterized in that, This includes spraying the product onto mango or banana fruits.
Citation Information
Patent Citations
Methods of reducing or eliminating expression of genes in filamentous fungal strains by transitive RNA interference
CN101652479A
Method for quantitatively detecting colletotrichum gloeosporioides by utilizing real-time fluorescent PCR (Polymerase Chain Reaction)
CN114540468A
DsRNA for preventing and treating crop anthracnose and application of dsRNA
CN121022845A
Construct for inducing silencing in plants and method for protecting them against anthracnose disease
EP4353740A1