Construction method and application of rahnella aquatica Hcp 0186 gene deleted strain for fish
By constructing a strain of Aquatic Laryn bacterium with the Hcp 0186 gene deletion and preparing polyclonal antibodies, the problem of functional recognition of the T6SS effector protein in Aquatic Laryn bacterium was solved, the virulence of the strain was reduced, the survival rate of immunized animals was improved, and the diagnosis and localization analysis of infection in fish were realized.
Patent Information
- Application Number
- CN202511927077.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-19
- Publication Date
- 2026-03-13
AI Technical Summary
Existing technologies lack effective tools to identify and study the function of the T6SS effector protein Hcp 0186 in Aquatic Lars, and the immune mechanism of Aquatic Lars infection in fish septicemia is unclear, making prevention and control difficult.
A strain of *Laenia aquaticis* with the Hcp 0186 gene deletion was constructed. Recombinant plasmids were constructed using homologous recombination, and Hcp 0186 polyclonal antibodies were prepared to study the function of the Hcp 0186 protein.
This study provides a scientific basis for researching the molecular pathogenic mechanism of aquatic Ranunculosis, reduces the virulence of the strain, improves the survival rate of immunized animals, and prepares specific antibodies for in vivo localization analysis and infection diagnosis in fish.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, specifically to a method for constructing and using a fish-borne aquatic Ranunculus Hcp 0186 gene-deleted strain. Background Technology
[0002] In recent years, emerging infectious diseases in aquatic animals have shown a trend of frequent occurrence and rapid spread, posing serious harm not only to aquaculture but also to the aquatic ecological environment and public health safety. As a newly emerging infectious disease, fish septicemia caused by *Laenia aquaticus* infection remains unclear in its immune mechanism, which is highly detrimental to its prevention and control. It has been reported that the *Laenia aquaticus* type VI secretion system (T6SS) plays a crucial role in bacterial pathogenesis and mediating host cellular immune interactions. Therefore, research on T6SS and its core components (Hcp, vgrG), as well as the pathogenic mechanism it causes, is of paramount importance for the application of *Laenia aquaticus* attenuated live vaccines.
[0003] Hemolysin co-regulatory protein (Hcp), a core protein constituting the tubular structure of the T6SS, plays a crucial role in regulating the secretion of its effector factors and the assembly of the T6SS apparatus. Hcp provides anchoring sites for T6SS effector proteins and assists in their folding; it is also a characteristic effector protein that can be secreted extracellularly. Currently, research on the pathogenic mechanism mediated by T6SS in *Laenia aquaticus* is still in its early stages. There are few reports on the construction of related deletion strains, and there is a lack of effective antibody tools that can specifically recognize this protein and be used for in vitro and in vivo detection. Therefore, functional studies of the *Laenia aquaticus* T6SS effector protein Hcp 0186 are of great significance. This invention constructs a *Laenia aquaticus* Hcp 0186 gene deletion strain using homologous recombination. To further investigate the function of Hcp 0186 protein in *Laenia aquaticus*, this invention subsequently constructs a recombinant prokaryotic expression vector to express the fusion protein and prepares a polyclonal antibody against Hcp 0186, aiming to provide methods and insights for studying the function of pathogenic gene. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides a method for constructing and utilizing a fish-borne aquatic Ranunculus lanceolatus Hcp 0186 gene-deleted strain. The aim is to provide a scientific basis for elucidating the molecular pathogenic mechanism of Ranunculus lanceolatus and the development and application of its mutant strains.
[0005] To achieve the above objectives, the specific technical solution provided by the present invention is as follows: In a first aspect, the present invention provides a method for constructing a fish-derived strain of *Laenia natans* KCL-5 with the Hcp 0186 gene deletion, comprising the following steps: (1) Construction of the Hcp 0186 gene deletion fragment: Genomic DNA was extracted from the aquatic Laenella strain KCL-5 and used as a template. The upstream and downstream homologous arms of Hcp 0186 were amplified using two pairs of primers, Hcp 0186-UF / R and Hcp 0186-DF / R. Using the recovered upstream and downstream homologous arms as templates, amplification was performed using primers Hcp 0186-UF and Hcp 0186-DR. The upstream and downstream homologous arm fragments were then ligated to obtain the Hcp 0186 gene deletion fragment (ΔHcp 0186).
[0006] (2) Construction of suicide recombinant plasmid: The obtained △Hcp 0186 fragment and T vector were ligated, transformed into Escherichia coli DH5α, and positive samples were selected for sequencing.
[0007] The deleted fragment recovered from the plasmid of recombinant *E. coli* DH5α-△Hcp 0186 was ligated with linearized PDM4 using T4 DNA ligase to obtain the suicide recombinant plasmid PDM4-△Hcp 0186. Both plasmids were digested with SacI and SalI. The suicide recombinant plasmid PDM4-△Hcp 0186 was transformed into *E. coli* SM10λpir competent cells by heat shock, resulting in PDM4-△Hcp 0186 / SM10λpir *E. coli*.
[0008] (3) Construction of deletion strains: PDM4-△Hcp 0186 / SM10 λpir Escherichia coli was conjugated with Aquatic Raenella KCL-5 to obtain a recombinant strain containing the suicide recombination plasmid PDM4-△Hcp 0186, which had completed the first homologous recombination. This recombinant strain was then inoculated into sucrose medium for reverse screening to obtain sucrose-tolerant strains. These strains were then inoculated onto ordinary LB agar plates and LB solid plates containing chloramphenicol, respectively. The strains that grew on ordinary LB agar plates but not on chloramphenicol-containing LB agar plates were the KCL-5 deletion strains that had completed the second gene recombination and lacked the Hcp 0186 deletion.
[0009] Preferably, the nucleotide sequence of the primer Hcp 0186-UF in step (1) is shown in SEQ ID NO.1; The nucleotide sequence of primer Hcp 0186-UR is shown in SEQ ID NO.2; The nucleotide sequence of primer Hcp 0186-DF is shown in SEQ ID NO.3; The nucleotide sequence of primer Hcp 0186-DR is shown in SEQ ID NO.4; The nucleotide sequence of the upstream fragment of gene Hcp 0186 is shown in SEQ ID NO.5; The nucleotide sequence of the downstream fragment of gene Hcp 0186 is shown in SEQ ID NO. 6; In a second aspect, the present invention provides a strain of Aquatic Ranunculus KCL-5 with Hcp0186 gene deletion constructed according to the above method, wherein the nucleotide sequence of the gene ΔHcp 0186 contained in its genome is shown in SEQ ID NO.7.
[0010] In a third aspect, this invention provides the application of the *Laenia aquaticis* KCL-5 strain with the Hcp 0186 gene deletion in growth rate, motility, and zebrafish survival tests. It can also be used in the preparation of a live attenuated vaccine for the prevention of aquatic *Laenia aquaticis* disease. This live attenuated vaccine is a bacterial suspension of the *Laenia aquaticis* Hcp 0186 gene deletion strain, with a concentration of 1 × 10⁸ CFU / mL, which can be adjusted according to individual differences in the recipient.
[0011] A fourth aspect of this invention provides a polyclonal antibody for the tissue localization analysis of *Laenia aquaticis* in fish and its clinical diagnostic detection in infected fish. This includes the following aspects: Preferably, Hcp gene cloning and prokaryotic expression: Based on the Hcp 0186 gene sequence of *Laenia aquaticis*, corresponding upstream and downstream primers were designed to amplify the target gene Hcp 0186. Simultaneously, *E. coli* BL21(DE3) containing the recombinant plasmid pET32a-Hcp 0186 was constructed for prokaryotic expression. The nucleotide sequence of primer Hcp 0186-F is shown in SEQ ID NO. 8; The nucleotide sequence of primer Hcp 0186-R is shown in SEQ ID NO. 9; The nucleotide sequence of gene Hcp 0186 is shown in SEQ ID NO.10.
[0012] Preferred preparation of polyclonal antibody against Hcp 0186 protein of Aquatic Laryn bacterium: The purified protein of Hcp 0186 gene expressed in prokaryotes is emulsified with adjuvant and subcutaneously injected into rabbits for immunization. Blood is collected from the heart to successfully prepare polyclonal antibody serum, and rabbit-derived polyclonal antibody is obtained by isolating the antiserum.
[0013] The present invention discloses the following technical effects: (1) The fish-borne aquatic Ransobacterium tumefaciens Hcp 0186 gene deletion strain provided by this invention has reduced growth rate and virulence compared to the original aquatic Ransobacterium tumefaciens KCL-5 strain. The survival rate of immunized animals increased from 0% to 52%. The Hcp 0186 gene deletion strain can provide a basis for the development of attenuated live vaccines of aquatic Ransobacterium tumefaciens.
[0014] (2) The Hcp 0186 protein polyclonal antibody provided by the present invention has a titer of up to 1:23 and can specifically bind to the Hcp protein of aquatic Ranuncula. It can be used for targeted analysis of the localization of aquatic Ranuncula in fish tissues and for clinical diagnosis and detection of infected fish. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0016] Figure 1. Homologous arms of the Hcp 0186 gene in *Laenia aquaticis* and overlap PCR amplification products. (A) Upstream and downstream fragment PCR amplification products, M: 2000 marker, 1: ΔHcp 0186 downstream fragment, size 489 bp, 2: ΔHcp 0186 upstream fragment, size 471 bp; (B) Overlap PCR amplification product, M: 2000 marker, 1: ΔHcp 0186 fusion fragment, size 940 bp.
[0017] Figure 2. Electrophoresis results of the recombinant suicide plasmid of the Aquatic Raenella Hcp 0186 gene. (A) PCR results of Escherichia coli DH5α bacterial culture, M: 2000 marker, 1-2: PMD18-T-△Hcp0186, size 940bp; (B) Electrophoresis results of double enzyme digestion, M: 10000 marker, 1-3: PMD18-T-△Hcp0186 double enzyme digestion results, sizes 2692bp and 940bp, 4-7: PDM4 double enzyme digestion results, size 7104bp, 8: circular PDM4; (C) PCR results of Escherichia coli SM10 λpir bacterial culture, M: 2000 marker, 1-2: PDM4-△Hcp0186, size 1310bp.
[0018] Figure 3. Construction results of the Hcp 0186 gene mutant strain of *Laenia aquaticis*. (A) First homologous recombination PCR identification, M: 10000 marker, 1-3: PDM4-△Hcp0186 failed to be transformed into KCL-5, size 1398bp, 4: PDM4-△Hcp0186 successfully transformed into KCL-5, sizes 940bp and 1398bp; (B) Results of dual antibiotic screening, left: ordinary LB solid medium, right: LB solid medium containing Cm antibiotic; (C) Second homologous recombination PCR identification, M: 2000 marker, 1-2: KCL-5 successfully mutated, size 940bp.
[0019] Figure 4. Growth curves of wild-type KCL-5 and △Hcp 0186 mutant.
[0020] Figure 5. Motility of wild-type KCL-5 and △Hcp 0186 mutant.
[0021] Figure 6. Survival rate of zebrafish infected with the aquatic strain of *Laenia aquaticis* △Hcp 0186 mutant.
[0022] Figure 7. Electrophoresis results of the Hcp gene clone of Aquatic Laryn bacterium.
[0023] Figure 8. Epitope (A) and its domain (B) of the aquatic bacterium Raenella Hcp0186.
[0024] Figure 9. Structural features of Hcp 0186 protein. (A) Secondary structure. The red part is the α-helix, and the yellow part is the β-sheet.
[0025] (B) Tertiary structure. (a) Tertiary structure, the red part is the α-helix, and the yellow part is the β-fold; (b) Electrostatic potential surface diagram.
[0026] Figure 10. Phylogenetic tree of Hcp0186 (A) and sequence alignment analysis (B).
[0027] Figure 11. Amplification results of the Hcp0186 gene and construction of cloning and expression vectors. (A) Double digestion of pET32a and Hcp0186, M: 10000 marker, 1-2: pET32a(+) plasmid, size 5894 bp, 3-4: Hcp0186, size 480 bp; (B) PCR of DH5a bacterial culture, M: 2000 marker, size 1192 bp; (C) PCR of BL21 bacterial culture, M: 2000 marker, size 1192 bp; (D) Double digestion of pET32a-Hcp0186, M: 10000 marker, sizes 5894 bp and 480 bp.
[0028] Figure 12. SDS-PAGE electrophoresis results of Hcp0186 protein expression. (A) Induction temperature, M: 120 kDa marker, 1: Uninduced, 2: 16℃ overnight, 3: 16℃, 4: 28℃, 5: 30℃, 6: 37℃; (B) Induction concentration, M: 120 kDa marker, 1: Uninduced, 2: 0.1 mM, 3: 0.2 mM, 4: 0.4 mM, 5: 0.6 mM, 6: 0.8 mM, 7: 1.0 mM; (C) Induction time, M: 120 kDa marker, 1: Uninduced, 2: 1h, 3: 2h, 4: 3h, 5: 4h, 6: 5h, 7: 6h; (D) Expression identification by supernatant precipitation, M: 120 kDa marker, 1: Supernatant, 2: Inclusion bodies, 3: Uninduced; (E) Protein purification, M: 120 kDa marker 1: Unpurified; markers 2-8: Purified proteins.
[0029] Figure 13. Hcp0186 protein titer and specificity detection. (A) Two-dimensional agar diffusion assay, 1: negative, 2: 1:1, 3: 1:2, 4: 1:22, 5: 1:23, 6: 1:24; (B) Immunoblotting assay, M: 120 kDa marker, 1: pET32a-Hcp protein.
[0030] Figure 14. Immunohistochemical detection of *Laenia aquaticis* infection in crucian carp. (A) Kidney; (B) Liver; (CD) Spleen; (AD) Brown areas indicate positive signals.
[0031] Figure 15 Immunoblot analysis of Hcp0186 protein from *Laenia aquaticis* in infected crucian carp tissues. A: Head kidney tissue; B: Liver tissue. Detailed Implementation
[0032] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. This is for illustrative purposes only and is not intended to limit the scope of the invention.
[0033] Aquatic Laenella KCL-5 and Escherichia coli DH5a were both preserved in our laboratory. Escherichia coli SM10λpir and the suicide plasmid PDM4 were donated by Professor Pei Chao. Both Escherichia coli and aquatic Laenella used in this experiment were grown in LB medium at temperatures of 37℃ and 25℃, respectively. Unless otherwise specified, the shaking speed of the constant temperature shaker was 200 rpm during bacterial culture. Additionally, during bacterial culture, appropriate concentrations of antibiotics were added according to the characteristics of the bacteria and the plasmids they contained. For example, aquatic Laenella was cultured in medium containing ampicillin (Amp) at a final concentration of 100 g / mL, and the strain containing the suicide plasmid PDM4 was cultured with chloramphenicol (Cm) at a final concentration of 34 μg / mL. Unless otherwise specified, the experimental methods used in the following examples are conventional methods; all materials and reagents used, unless otherwise specified, are commercially available.
[0034] Example 1: Construction of the Hcp 0186 gene deletion strain of Aquatic Rahn's bacterium KCL-5. The specific operation steps are as follows: 1. Construction of the Hcp 0186 gene deletion fragment Using primer pairs Hcp 0186-UF / R and Hcp 0186-DF / R, PCR amplification was performed with *Laenia aquaticis* KCL-5 genomic DNA as a template to obtain the upstream and downstream homologous arm gene fragments of Hcp 0186, as shown in Figure 1A. The upstream and downstream homologous arm fragments were recovered using a gel extraction kit. Using the recovered upstream and downstream homologous arms as templates, amplification was performed using primers Hcp0186-UF and Hcp 0186-DR. The upstream and downstream homologous arm fragments were then ligated. After ligation, 25 μL of 2×Taq PCR Master Mix was added, and the mixture was incubated in a 70℃ water bath for 30 min. The fragments were then recovered by 1% agarose gel electrophoresis, as shown in Figure 1B, yielding the Hcp 0186 gene deletion fragment (ΔHcp 0186).
[0035] Primers were designed using Primer Premier 5.0 software and synthesized at Shanghai Sangon Biotech Co., Ltd. Primer sequences are shown in Table 1. PCR amplification systems are shown in Table 2.
[0036] Table 1 Primer Information Primer Name, Primer Sequence (5'-3'), Product Length (bp) Hcp 0186-UF CGAGCTCGCTGATAGGTGGAATGAAAG, as shown in SEQ ID NO.1 455 Hcp 0186-UR GTGCGCCTGCATAAATATGCTGGATTTGAC, as shown in SEQ ID NO.2 Hcp 0186-DF GCATATTTATGCAGGCGCACTCCACTTTATAG, as shown in SEQ ID NO.3 469 Hcp 0186-DR ACGCGTCGACCTTGCTACGGGAGAAT, as shown in SEQ ID NO.4 Sac IF CAGCAACTTAAATAGCCTCTAAGGT 1301 Sac IR GGTGCTCCAGTGGCTTCTGTTTCTA Note: Underlined sites are Sac I and Sal I restriction sites.
[0037] Table 2 PCR reaction system Reagent system (μL) dNTP 4 10×Pfu Buffer 5 Hcp 0186-F 2 Hcp 0186-R 2 Pfu DNA Polymerase 0.25 DNA template 2 ddH2O 34.75 PCR reaction program: 94℃ pre-denaturation for 3 min; 94℃ for 30 s; 65℃ for 30 s; 72℃ for 2 min; 30 cycles followed by 72℃ extension for 10 min.
[0038] The nucleotide sequence of the upstream fragment of gene Hcp 0186 is: GCTGATAGGTGGAATGAAAGaacgctgtatcagaacatcagaagctctcagcatagacgaacctgaaatatatggagagttgcgaaaaaaagattatgacttactctactttatgtttgaaccggcactcaagccctttgtggatgctctgatcgtaagacgacaacagggaatgctagcgtttgataacatactggaacgtgttgaatcaaaattgagtggatctcatggggttaattaaaggctcactaggcgcgtttgccggttcgatagctgtttggctgtctttctatttcattttccatttgacacatggacaatgaggttgatttctatttttactctcaatgcttgtatttatcttgtggcaaaatttttagacaaaaaatttccatgtgattaatacagtcgcttaaattataaggatGTAAAATGTCAAATCCAGCATATTTATG, as shown in SEQ ID NO.5; Nucleotide sequence of the downstream fragment of gene Hcp 0186: GCAGGCGCACTCCACTTTATAGggcaagatgtctatccccactgtggtctctgaacacaatttgtgtacaaagtttattgttccaagacagtggctgttcgtggcagttaaaactatttattccatatcgtcatcatgaggtgctgtttgcgcggtgaattaaaaatccccctgaaggagcaagtgatccttcaggggaaagattaaaaaataccccgtgccgcgttaccgtatccccggtaacacattctcaggacaaaaaacctttcaaattttccagcatgttggtcatcatgccgaaggccatatttacactgtgaatgctgtaatacagcgtaatatcattgcgcatcaggtatgtttcaaaacgcttatctgccagcaccgcctgaacttccagactgcgatcgcgaaaatggcggcagttattaatgtacaaatccagcgaccggTATTCTCCCGTAGCAAG, as shown in SEQ ID NO.6.
[0039] Nucleotide sequence of gene △Hcp 0186: ACGCGTCGACCTTGCTACGGGAGAATACCGGTCGCTGGATTTGTACATTAATAACTGCCGCCATTTTCGCGATCGCAGTCTGGAAGTTCAGGCGGTGCTGGCAGATAAGCGTTTTGAAACATACCTGATGCGCAATGATATTACGCTGTATTACAGCATTCACAGTGTAAATATGGCCTTCGGCATGATGACCAACATGCTGGAAAATTTGAAAGGTTTTTTGTCCTGAGAATGTGTTACCGGGGATACGGTAACGCGGCACGGGGTATTTTTTAATCTTTCCCCTGAAGGATCACTTGCTCCTTCAGGGGGATTTTTAATTCACCGCGCAAACAGCACCTCATGATGACGATATGGAATAAATAGTTTTAACTGCCACGAACAGCCACTGTCTTGGAACAATAAACTTTGTACACAAATTGTGTTCAGAGACCACAGTGGGGATAGACATCTTGCCCTATAAAGTGGAGTGCGCCTGCATAAATATGCTGGATTTGACATTTTACATCCTTATAATTTAAGCGACTGTATTAATCACATGGAAATTTTTTGTCTAAAAATTTTGCCACAAGATAAATACAAGCATTGAGAGTAAAAATAGAAATCAACCTCATTGTCCATGTGTCAAATGGAAAATGAAATAGAAAGACAGCCAAACAGCTATCGAACCGGCAAACGCGCCTAGTGAGCCTTTAATTAACCCCATGAGATCCACTCAATTTTGATTCAACACGTTCCAGTATGTTATCAAACGCTAGCATTCCCTGTTGTCGTCTTACGATCAGAGCATCCACAAAGGGCTTGAGTGCCGGTTCAAACATAAAGTAGAGTAAGTCATAATCTTTTTTTCGCAACTCTCCATATATTTCAGGTTCGTCTATGCTGAGAGCTTCTGATGTTCTGATACAGCGTTCTTTCATTCCACCTATCAGCGAGCTCG, as shown in SEQ ID NO.7.
[0040] 2. Construction of suicide recombinant plasmid: The obtained △Hcp 0186 fragment was ligated to the T vector. The ligation system is shown in Table 3. Ligation was performed overnight at 4℃ and the resulting fragment was transformed into *E. coli* DH5α. Positive samples were selected for sequencing in a medium containing 100 μg / mL Amp. The results are shown in Figure 2A. Correct fragments were recovered by gel excision. The recombinant plasmid PMD18-T-△Hcp 0186 and the suicide plasmid PDM4 were digested with Sac I and Sal I. The results are shown in Figure 2B. The reaction was performed at 37℃ for 15 min. The recovered deletion fragment was ligated to linearized PDM4 using T4 DNA ligase to obtain the recombinant plasmid PDM4-△Hcp 0186. The digestion system is shown in Table 4, and the ligation system is shown in Table 5.
[0041] The suicide recombinant plasmid PDM4-△Hcp 0186 was transformed into Escherichia coli SM10 λpir competent cells. Positive samples were selected and screened in chloramphenicol-resistant medium with a final concentration of 34 μg / mL. The results are shown in Figure 2C, and PDM4-△Hcp 0186 / SM10 λpir Escherichia coli were obtained.
[0042] Table 3 TA Cloning System Reagent system (μL) Solution I 2.5 PDM18-T carrier 0.25 △Hcp 0186 2.25 Table 4 Enzyme digestion system Reagent system 10×Q Green Buffer 5 μL PDM4 1 ug Sac I 1 μL Sal I 1 μL dd H2O to 50 μL Table 5 Connection System Reagent system 10xT4 DNA Ligase Buffer 2 μL T4 DNA Ligase 1 μL PDM4 50 ng △Hcp 0.186 4 μL Nuclease-free water to 20 μL 3. Construction of deletion strains: First homologous recombination: Single colonies of *E. coli* SM10 λpir containing the pDM4-ΔHcp 0186 plasmid were picked and inoculated into 34 μg / mL chloramphenicol LB medium and cultured at 37°C. Simultaneously, single colonies of *Laenia aquaticis* KCL-5 were picked and inoculated into 100 μg / mL ampicillin LB medium and cultured overnight at 25°C. The next day, the two cultures were transferred to the corresponding antibiotic LB medium at a 1:100 ratio. SM10 λpir was cultured with shaking until mid-logarithmic growth, and KCL-5 was cultured until late-logarithmic growth. 1 mL of each culture was centrifuged at 8000 rpm for 2 min at room temperature, the supernatant was discarded, and the cultures were washed twice with antibiotic-free LB liquid medium, then resuspended in 1 mL of antibiotic-free LB liquid. 600 μL of each culture was mixed thoroughly, centrifuged at 8000 rpm for 2 min at room temperature, and the supernatant was discarded. The bacterial cells were resuspended in 60 μL of antibiotic-free LB medium and spotted onto LB solid medium containing a sterile hydrophilic filter membrane. The medium was placed upright in a 25°C incubator and incubated for 12 h. The filter membrane was then placed in a new sterile centrifuge tube, and 1 mL of antibiotic-free LB medium was added to wash away the bacteria. The bacteria were serially diluted with sterile PBS. 100 μL of the appropriate dilution was spread onto a double-antibiotic LB solid plate containing ampicillin and chloramphenicol and incubated upside down at 25°C for 12 h. Single colonies were picked and placed into LB medium containing double-antibiotics and incubated at 25°C for 12 h. Then, bacterial PCR was performed using primers Hcp 0186-UF and Hcp 0186-DR. The presence of two bands of different sizes indicates that the strain has completed the first homologous recombination, as shown in Figure 3A.
[0043] Second homologous recombination: The target strain was inoculated into LB liquid medium containing 10% (w / v) sucrose and free of NaCl, and cultured overnight at 25°C. The cultured bacterial suspension was then streaked onto LB agar plates containing 10% (w / v) sucrose using an inoculation loop and incubated upside down at 25°C for 12 h. Single colonies exhibiting sucrose tolerance were picked and inoculated into LB medium, and incubated at 25°C for 12 h. The bacterial suspension was then spotted onto both ordinary LB agar plates and LB solid plates containing chloramphenicol, and incubated at 25°C for 12 h. As shown in Figure 3B, strains that grew on ordinary LB agar plates but not on chloramphenicol-containing LB agar plates are likely gene-deleted strains that have completed the second gene recombination. Next, the chloramphenicol-free strain was identified by PCR using Hcp 0186-UF and Hcp 0186-DR bacterial suspensions, and the results are shown in Figure 3C. A 940 bp fragment was amplified, and the band size was consistent with expectations, indicating that the Hcp 0186-deleted aquatic Rahn bacterium KCL-5 was successfully constructed. The qualified strains were sent to the company for sequencing to ensure that the target gene was missing, resulting in a KCL-5 deletion strain with Hcp 0186 missing.
[0044] Example 2: Determination of bacterial strain growth characteristics and bacterial infection experiment 1. Growth curve determination Single colonies of the *Laenia aquaticis* KCL-5 Hcp 0186 mutant and wild-type strains were picked and cultured in LB broth at 25°C with shaking at 200 rpm. The OD values of each strain were adjusted to 1.0, and the bacterial culture was transferred to a new 30 mL LB broth at a ratio of 1:100 for further culture. Three parallel samples were taken every 2 hours to measure the OD600 value, and bacterial growth curves were plotted. As shown in Figure 4, the growth rate of the *Laenia aquaticis* KCL-5 ΔHcp 0186 mutant strain at 25°C was lower than that of the wild-type strain, indicating that the Hcp 0186 gene reduces the growth rate of *Laenia aquaticis* KCL-5 itself.
[0045] 2. Mobility test Single colonies of the *Laenia aquaticis* KCL-5 Hcp 0186 mutant and wild-type strains were picked and cultured overnight at 25°C and 200 rpm. The bacterial cultures were then transferred to fresh LB broth at a 1:100 ratio and cultured until the logarithmic growth phase. The OD600 values of each culture were adjusted to 1.0 using LB broth. 2 μL of each culture was then added to LB plates containing 0.3% (w / v) agar. The plates were incubated upright at 25°C for 24 h, and the diffusion diameter of bacteria on the plate surface was measured. The experiment was repeated three times. The results are shown in Figure 5. The motility of the *Laenia aquaticis* KCL-5 wild-type strain and the ΔHcp 0186 mutant strain decreased at 25°C, indicating that the deletion of the Hcp 0186 gene does not affect the motility of *Laenia aquaticis* KCL-5 itself.
[0046] 3. Zebrafish survival experiment Healthy zebrafish of similar size purchased from a seafood market in Tianjin were randomly divided into three groups: an experimental group infected with a deletion strain, a control group infected with a wild-type strain, and a blank group infected with sterile PBS, with 10 fish in each group. Each fish was challenged with a pre-prepared suspension of *Laenia natans* KCL-5 at a concentration of 10⁸ CFU / mL, including both wild-type and deletion strains, by intraperitoneal injection of 20 μL. The blank group was injected with 20 μL of PBS buffer. The survival rate of the fish was observed and recorded for one week.
[0047] No fish in the PBS-injected control group died. The survival rate of the PBS-injected control group was 100%, the survival rate of the wild-type control group was 0%, and the survival rate of the experimental group injected with the ΔHcp 0186 mutant was 52%. Notably, as shown in Figure 6, the survival rate of the ΔHcp 0186 mutant was lower than that of the wild-type mutant at 1 day, but significantly higher at 2 days.
[0048] In summary, survival experiments in zebrafish confirmed that the fish-borne aquatic Raenella Hcp 0186 gene-deleted strain constructed in this invention has weak virulence and the potential to be prepared into an attenuated live vaccine for the prevention and treatment of aquatic Raenella disease.
[0049] Example 3: The methods for cloning and prokaryotic expression of the Hcp gene in the aquatic Raenella KCL-5 strain, based on Examples 1 and 2, are as follows: 1. Bioinformatics prediction of Hcp gene Based on the complete nucleotide sequence of *Laenia aquaticis* previously sequenced by our research group, we used bioinformatics methods to predict the signal peptide (PrediSi), transmembrane region (TMHMM2.0), hydrophilicity (ProtScale), antigenic epitope (BepiPred2.0), domain (SMART http: / / smart.embl-heidelberg.de / ), and tertiary structure (SWISSMODEL) of the *Laenia aquaticis* Hcp protein. The prediction is that the Hcp protein is a hydrophilic protein with two antigenic epitopes (65-84; 124-143 aa). Figure 8 A) Hcp 0186 lacks transmembrane structures and contains one domain, T6SS_Hcp (PF05638, 6~142 aa) (Fig. 8B). Secondary structure prediction indicates that Hcp 0186 is predominantly β-sheet, with the T6SS_Hcp region mainly composed of β-sheets (Fig. 9A). Tertiary structure prediction shows that the red portion is an α-helix, the yellow portion is a β-sheet, and the green portion is a random coil, which is basically consistent with the secondary structure prediction results (Fig. 9B). Multiple sequence alignment of protein sequences from different species and strains was performed using DNAman software, as shown in Fig. 10B. A phylogenetic tree was constructed using MEGA 5.0, as shown in Fig. 10A.
[0050] 2. Hcp gene cloning Primers were designed using Primer 5.0. The target gene was amplified using *Laenia aquaticis* KCL-5 genomic DNA as a template. The primers are shown in Table 6. The PCR reaction system is shown in Table 7. The PCR products were detected by 1% agarose gel electrophoresis and then recovered using a gel extraction kit. The results are shown in Figure 7.
[0051] Table 6 Primer Information Primer Name, Primer Sequence (5'-3'), Product Length (bp) Hcp 0186-F CCGGAATTCATGTCAAATCCAGCATATTT 480 Hcp 0186-R CCCAAGCTTTTTATGCAACCCAGCGGTTAT Note: Underlined sites are Hind III and EcoRI restriction sites.
[0052] Table 7 PCR Reaction System Reagent system (μL) dNTP 4 10×Pfu Buffer 5 Hcp 0186-F 2 Hcp 0186-R 2 Pfu DNA Polymerase 0.25 DNA template 2 ddH2O 34.75 PCR reaction program: 94℃ pre-denaturation for 3 min; 94℃ for 30 s; 58℃ for 30 s; 72℃ for 2 min; 30 cycles followed by 72℃ extension for 10 min.
[0053] 2. Construction and identification of prokaryotic expression vectors The pET32a(+) and Hcp0186 gene sequences were double-digested using restriction endonucleases EocRI and HindIII, as shown in Figure 11A. The pET32a(+) vector was ligated to form the recombinant plasmid pET32a-Hcp0186 (ligation system shown in Table 8). This plasmid was transformed into DH5α competent cells, and liquid PCR (Figure 11B), sequencing, and double-enzyme digestion were performed using primers T7 and T7-TER (Figure 11D). The recombinant plasmid was extracted and transformed into BL21 expression cells to construct the Hcp0186 expression vector (Figure 11C). This vector was then validated using bacterial PCR and gene sequencing using primers T7 and T7-TER. BLAST results showed that the target sequence had 100% homology with the Hcp gene of *Laenia aquaticis*.
[0054] Table 8 Connection System Reagent system 10xT4 DNA Ligase Buffer 2μL T4 DNA Ligase 1μL pET32a 50ng Hcp 0186 4μL Nuclease-free water to 20 μL 3. Induction and purification of recombinant proteins The engineered bacteria were cultured to a scale-up level of 0.6. One mL of the bacterial culture was used as an uninduced control. Different induction temperatures, IPTG concentrations, and induction times were set to induce the expression of recombinant Hcp protein. The results (Figure 12 A, B, C) showed that the relative molecular mass of the target protein was close to the predicted size (35.86 kDa). Induction at 28℃ and 0.2 mM IPTG for 6 h was the optimal induction condition for Hcp 0186 protein expression. Solubility analysis of the target protein and SDS-PAGE analysis of the protein expression levels in the supernatant and inclusion bodies after sonication revealed a distinct specific band at 35.86 kDa, and the expression level of Hcp 0186 protein in the inclusion bodies was higher than that in the supernatant (Figure 12 D).
[0055] Hcp 0186 protein was purified according to the Beyotime His-Tagged Protein Purification Kit (denaturing formulation) instructions. The purified protein was placed in a pre-treated dialysis bag and dialyzed sequentially with 6 M, 4 M, 2 M, and 0 M PBS. The dialysis bag was then coated with sucrose for protein concentration. The concentration of the purified protein was determined using the Beyotime Bradford Protein Assay Kit. The results are shown in Figure 12E.
[0056] 4. Preparation of polyclonal antibodies Prior to immunization, an equal volume of purified Hcp 0186 protein (1 mg / mL) was emulsified with Freund's complete adjuvant. Then, each New Zealand white rabbit weighing 1.5-2 kg was subcutaneously injected with a mixture of Hcp 0186 protein and Freund's complete adjuvant. A second immunization was administered 14 days later with an equal volume of a mixture of recombinant Hcp 0186 protein and Freund's incomplete adjuvant, followed by a third immunization 28 days later. Ten days after the final immunization, the Hcp 0186 antibody titer was determined using a double-sided agar diffusion assay. When the titer reached 1:8, blood was collected from the immunized rabbits' hearts, and antiserum was separated. As shown in Figure 13A, a precipitation line appeared at a 1:8 antigen-antibody ratio, indicating a serum titer of 1:23.
[0057] 5. Western blot (WB) analysis The total Hcp 0186 protein after induction was transferred to a polyvinylidene fluoride (PVDF) membrane after 12% SDS-PAGE. The membrane was blocked with 5% skim milk at 37°C for 2 h, washed four times with TBST for 7 min each time, and then incubated overnight at 4°C with 1:300 diluted anti-Hcp0186 antiserum. After four TBST washes, the membrane was incubated with 1:5000 diluted HRP-conjugated goat anti-rabbit IgG at 37°C for 50 min. After washing the PVDF membrane, TMB showed protein bands. The specificity of the polyclonal antibody was detected by Western blotting, and the results are shown in Figure 13B.
[0058] 6. Immunohistochemical (IHC) analysis of KCL-5-infected crucian carp Crucian carp tissue infected with *Laenia aquaticis* was paraffin-embedded and sectioned. After antigen retrieval, the dewaxed tissue sections were mounted with blocking goat serum at 37°C for 30 min. The tissue sections were washed three times with PBS and incubated overnight at 4°C with anti-Hcp 0186 antiserum (1:20 dilution). After washing three times with PBS and drying, the tissue sections were incubated with HRP-conjugated goat anti-rabbit IgG (1:500 dilution) at 37°C for 30 min. The tissue sections were washed three times with PBS, stained with TMB working solution at room temperature in the dark for 10 min, washed with distilled water to terminate the reaction, washed three times with PBS, dried, counterstained with hematoxylin for 15 min, washed with hot distilled water, fixed with graded alcohols, cleared with xylene, and finally mounted with resin. The tissue sections were examined and photographed under a microscope.
[0059] As shown in Figure 14, the immunohistochemical results indicate that the prepared Hcp 0186 antibody can be used for targeted analysis of the localization of aquatic Ranunculosis in fish tissues and for clinical diagnosis of infected fish. Brown positive signals were observed in the kidneys, livers, and spleens of crucian carp, indicating that the kidneys, livers, and spleens are the main sites of invasion by aquatic Ranunculosis.
[0060] 7. Western blot (WB) analysis of Hcp protein in tissue protein of crucian carp infected with Aquatic Ransobacterium arachnoides Proteins were detected by SDS-PAGE electrophoresis, and the antibody specificity of Hcp was detected by Western blotting. Total Hcp protein after induction was transferred to a polyvinylidene fluoride (PVDF) membrane after 12% SDS-PAGE. The membrane was blocked with 5% skim milk at 37 °C for 2 h, washed four times with TBST for 7 min each time, and then incubated overnight at 4 °C with 1:300 diluted anti-Hcp antiserum. After incubation with 1:5000 diluted β-actin monoclonal antibody for 2 h, and washing four times with TBST, the membrane was incubated with 1:5000 diluted HRP-conjugated goat anti-rabbit IgG at 37 °C for 50 min. After washing the PVDF membrane, TMB showed protein bands. Simultaneously, β-actin in infected crucian carp liver tissue was detected as a control. Figure 15 As shown, Western blot (WB) analysis of Hcp protein from *Laenia aquaticis* revealed significant changes in Hcp protein expression levels in crucian carp head kidney and liver tissues from 0 to 48 hours after infection. Hcp expression was significantly elevated in head kidney after 12 hours of infection, while the highest expression level was observed in liver after 24 hours. A target Hcp band was detected at a position of 17 kDa in both head kidney and liver tissues, and its size was consistent with the expected molecular weight.
[0061] The embodiments described above are merely examples of implementation methods of the present invention. Their detailed descriptions are not intended to limit the scope of the present invention. Various designs and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention are all within the protection scope of the present invention.
Claims
1. A method for constructing the Hcp 0186 gene deletion fragment of *L. arachnoides* for fish and the design of upstream and downstream homologous arm primer sequences, characterized in that... Includes the following steps: Construction of the Hcp 0186 gene deletion fragment in *Laenia aquaticis*: Genomic DNA from *Laenia aquaticis* strain KCL-5 was extracted and used as a template. The upstream and downstream homologous arms of Hcp0186 were amplified using primer pairs Hcp 0186-UF / R and Hcp 0186-DF / R. Using the recovered upstream and downstream homologous arms as templates, amplification was performed using primers Hcp 0186-UF and Hcp0186-DR. The upstream and downstream homologous arm fragments were then ligated to obtain the Hcp 0186 gene deletion fragment (ΔHcp0186).
2. The construction method according to claim 2, characterized in that, The nucleotide sequence of the primer Hcp 0186-UF is shown in SEQ ID NO.1; The nucleotide sequence of primer Hcp 0186-UR is shown in SEQ ID NO.2; The nucleotide sequence of primer Hcp 0186-DF is shown in SEQ ID NO.3; The nucleotide sequence of primer Hcp 0186-DR is shown in SEQ ID NO.4; The nucleotide sequence of the upstream fragment of gene Hcp 0186 is shown in SEQ ID NO.5; The nucleotide sequence of the downstream fragment of gene Hcp 0186 is shown in SEQ ID NO. 6; The nucleotide sequence of the gene △Hcp 0186 contained in the deletion strain is shown in SEQ ID NO.
7.
3. The method for constructing a fish-derived aquatic Raenella KCL-5 strain with the Hcp 0186 gene deletion according to claim 1, characterized in that: The suicide recombinant plasmid and the deletion strain were constructed. The obtained △Hcp 0186 fragment was ligated with the T vector, transformed into E. coli DH5α, and positive samples were selected for sequencing.
4. The construction method of the suicide recombinant plasmid is as follows: The deleted fragment recovered from the plasmid of recombinant *E. coli* DH5α-△Hcp0186 was ligated with linearized PDM4 using T4 DNA ligase to obtain the suicide recombinant plasmid PDM4-△Hcp0186. Both plasmids were digested with Sac I and Sal I enzymes. The suicide recombinant plasmid PDM4-△Hcp0186 was transformed into *E. coli* SM10 λpir competent cells by heat shock to obtain PDM4-△Hcp0186 / SM10 λpir *E. coli*.
5. The construction method of the deletion strain is as follows: PDM4-△Hcp 0186 / SM10 λpir Escherichia coli was conjugated with Aquatic Raenella KCL-5 strain to obtain a recombinant strain containing the suicide recombination plasmid PDM4-△Hcp 0186 that has completed the first homologous recombination. The strain was then inoculated into sucrose medium for reverse screening to obtain sucrose-tolerant strains. These strains were then inoculated into ordinary LB plates and LB solid plates containing chloramphenicol, respectively. The strains that could grow on ordinary LB plates but not on LB plates containing chloramphenicol were the KCL-5 deletion strains that had completed the second gene recombination and deleted Hcp 0186.
6. The cloning and prokaryotic expression of the Hcp 0186 gene of *Laenia aquaticis* according to claim 1, characterized in that, Based on the gene sequence of *Laenia aquaticis* Hcp 0186, corresponding upstream and downstream primers were designed to amplify the target gene Hcp 0186. Simultaneously, *E. coli* BL21(DE3) containing the recombinant plasmid pET32a-Hcp 0186 was constructed for prokaryotic expression. The nucleotide sequence of the primer Hcp 0186-F is shown in SEQ ID NO.
8. The nucleotide sequence of primer Hcp 0186-R is shown in SEQ ID NO. 9; The nucleotide sequence of gene Hcp 0186 is shown in SEQ ID NO.
10.
7. A polyclonal antibody against the Hcp 0186 protein of *Laenia natans* (aquatic bacterium) prepared from the prokaryotically expressed protein according to claim 5, characterized in that... Purified protein of Hcp 0186 gene expressed in prokaryotes was emulsified with adjuvant and subcutaneously injected into rabbits for immunization. Blood was collected from the heart to successfully prepare polyclonal antibody, and rabbit-derived polyclonal antibody was obtained by isolating the antiserum.
8. The construction and use of a fish-borne aquatic Raenella Hcp 0186 gene-deleted strain according to claim 6, characterized in that: Polyclonal antibodies were prepared for the analysis of tissue localization and expression of *Laenia aquaticis* in fish and for clinical diagnostic detection of infected fish.