Application of phytoene dehydrogenase
By introducing a specific phytoene dehydrogenase polynucleotide sequence into plants and combining it with other tolerance proteins, the problem of crop tolerance to phytoene dehydrogenase inhibitor herbicides has been solved, achieving the effects of reducing plant damage and increasing yield, delaying the emergence of resistant weeds, and improving the control efficiency of herbicides and crop safety.
Patent Information
- Application Number
- CN202511776880.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-28
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies are insufficient to effectively acclimate crops to phytoene dehydrogenase inhibitors (PDSi) herbicides, leading to a large number of resistant weeds. Furthermore, the use of glyphosate herbicides alone is insufficient to effectively control weeds in the field.
By introducing polynucleotide sequences encoding phytoene dehydrogenase into the plant genome, especially polynucleotide sequences with at least 99% identity to the amino acid sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, and combining them with other herbicide tolerance proteins, phytoene dehydrogenase inhibitor herbicides such as pyrifluquinazon and fluroxypyr can reduce plant damage and increase yield.
It achieves plant tolerance to phytoene dehydrogenase inhibitor herbicides, reduces plant damage and increases yield, delays the emergence of resistant weeds, and improves the control efficiency of herbicides and crop safety.
Smart Images

Figure CN121667031A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the use of phytoene dehydrogenase (PDS), and more particularly to a method and use of a prokaryotic phytoene dehydrogenase to confer plant tolerance to phytoene dehydrogenase inhibitor (PDSi) herbicides. Background Technology
[0002] Weeds are a key factor affecting crop yield in agricultural production. By competing with crops for nutrients and growing space, weeds hinder normal crop growth and lead to reduced yields. Therefore, weed control is a crucial aspect of agricultural production. Introducing herbicide-tolerant genes into crops through genetic engineering to obtain herbicide-tolerant crops can not only improve weed control efficiency but also enhance the safety of herbicides for crops, while simultaneously reducing production costs, bringing significant economic benefits to agricultural production.
[0003] Currently, glyphosate-tolerant crops have been successfully obtained through transgenic technology and commercially produced. For glyphosate tolerance, the 5-enolpyruvate-3-phosphate synthase (cEPSPS) gene from Agrobacterium tumefaciens CP4 strain is introduced into crops via Agrobacterium-mediated transformation, expressing an EPSPS protease insensitive to glyphosate, thus conferring glyphosate tolerance. However, prolonged use of a single herbicide often leads to the proliferation of resistant weeds, and glyphosate alone is insufficient for effective weed control in the field. Breeding crops tolerant to two or more herbicides allows for flexible weed control and delays the emergence of resistant weeds. Toxicity of phytoene dehydrogenase inhibitors (PDSi) is a novel herbicide-tolerant trait developed in this field.
[0004] Hydroxylenol dehydrogenase (PDS) is a key enzyme in the carotene synthesis pathway. In this pathway, phytoene is successively converted into lycopene by phytoene dehydrogenase and ζ-carotene dehydrogenase, and then further converted into different types of carotene by various cyclases. In plants, PDSi inhibitors inhibit phytoene dehydrogenase activity, blocking carotene synthesis, leading to chlorosis of the leaves and ultimately plant death.
[0005] Methods for conferring tolerance to PDSi herbicides mainly include: 1) using enzymes that can convert herbicides or their active metabolites into non-toxic products to detoxify them. 2) altering the sensitivity of the target crop's PDS to herbicides by increasing the expression level of the target crop's PDS gene or mutating the amino acid sites of the protein. 3) providing a PDS homologous protein that is less sensitive to herbicides or their active metabolites, while also possessing phytoene dehydrogenase activity.
[0006] To date, there has been considerable basic scientific research on conferring tolerance to PDSi herbicides in crops; however, the tolerance effects achieved in these studies have not yet met the requirements for commercial application. Therefore, identifying resistance genes with higher PDSi tolerance levels and using them to create transgenic PDSi-tolerant crops holds significant promise for agricultural applications. Summary of the Invention
[0007] The purpose of this invention is to provide a use for phytoene dehydrogenase (PDS), in which plants transfected with the polynucleotide sequence encoding the phytoene dehydrogenase described in this invention exhibit good tolerance to PDS inhibitor (PDSi) herbicides.
[0008] To achieve the above objectives, the present invention provides a method for controlling weeds, comprising applying a herbicide containing an effective dose of an inhibitor of phytopenic oleoresin dehydrogenase to a field in which at least one transgenic plant is present, said transgenic plant having a genome containing the polynucleotide sequence encoding phytopenic oleoresin dehydrogenase as described in the present invention, said transgenic plant having reduced plant damage and / or increased plant yield compared to other plants that do not have the polynucleotide sequence encoding phytopenic oleoresin dehydrogenase as described in the present invention, wherein said phytopenic oleoresin dehydrogenase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0009] Preferably, the transgenic plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the transgenic plant is oat, wheat, barley, millet, corn, sorghum, short-stalked grass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato, or Arabidopsis thaliana.
[0010] Preferably, the phytoene dehydrogenase inhibitor herbicide includes pyrfluthrin and / or flupyrfluthrin.
[0011] Preferably, the polynucleotide sequence of the phytoene dehydrogenase has:
[0012] (a) A polynucleotide sequence encoding an amino acid sequence having at least 99% sequence identity with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0013] (b) The polynucleotide sequence shown in any one of SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:23; or
[0014] (c) Nucleotide sequences for codon optimization of the polynucleotide sequences SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:23 for use in a particular plant.
[0015] Furthermore, the transgenic plant also includes at least one second polynucleotide encoding a second herbicide tolerance protein, which is different from the polynucleotide sequence encoding the phytoene dehydrogenase.
[0016] The second type of polynucleotide encodes selective marker proteins, synthetic active proteins, degradative active proteins, proteins resistant to biotic stress, proteins resistant to abiotic stress, male sterility proteins, proteins affecting plant yield, and / or proteins affecting plant quality.
[0017] Specifically, the second polynucleotide encodes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, α-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, and / or cytochrome proteins.
[0018] Alternatively, the herbicide containing an effective dose of phytoene dehydrogenase inhibitor may also include glyphosate herbicides, glufosinate herbicides, plant growth regulator herbicides, gramineous herbicides, pre-germination selective herbicides, and / or post-germination selective herbicides.
[0019] To achieve the above objectives, the present invention also provides a planting combination for controlling weed growth, comprising a phytoene dehydrogenase inhibitor herbicide and at least one transgenic plant, wherein an effective dose of the phytoene dehydrogenase inhibitor herbicide is applied to a field containing the at least one transgenic plant, the transgenic plant containing in its genome the polynucleotide sequence encoding phytoene dehydrogenase as described in the present invention, the transgenic plant exhibiting reduced plant damage and / or increased plant yield compared to other plants not possessing the polynucleotide sequence encoding phytoene dehydrogenase as described in the present invention, wherein the phytoene dehydrogenase has at least 99% sequence identity with the amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0020] Preferably, the transgenic plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the transgenic plant is oat, wheat, barley, millet, corn, sorghum, short-stalked grass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato, or Arabidopsis thaliana.
[0021] Preferably, the phytoene dehydrogenase inhibitor herbicide includes pyridazinone herbicides, pyridine-amide herbicides, and other types of phytoene dehydrogenase inhibitor herbicides;
[0022] Preferably, the phytoene dehydrogenase inhibitor herbicide includes fluroxypyr, pyrfluthrin, fluroxypyr, fluroxypyr, flupyrfluthrin, flupyridine, furazolidone and / or flubutyroxypyr.
[0023] More preferably, the phytoene dehydrogenase inhibitor herbicide includes pyrfluthrin and / or flupyrfluthrin.
[0024] Preferably, the polynucleotide sequence of the phytoene dehydrogenase has:
[0025] (a) A polynucleotide sequence encoding an amino acid sequence having at least 99% sequence identity with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0026] (b) The polynucleotide sequence shown in any one of SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:23; or
[0027] (c) Nucleotide sequences for codon optimization of the polynucleotide sequences SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:23 for use in a particular plant.
[0028] Furthermore, the transgenic plant also includes at least one second polynucleotide encoding a second herbicide tolerance protein, which is different from the polynucleotide sequence encoding the phytoene dehydrogenase.
[0029] The second type of polynucleotide encodes selective marker proteins, synthetic active proteins, degradative active proteins, proteins resistant to biotic stress, proteins resistant to abiotic stress, male sterility proteins, proteins affecting plant yield, and / or proteins affecting plant quality.
[0030] Specifically, the second polynucleotide encodes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, α-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, and / or cytochrome proteins.
[0031] Alternatively, the herbicide containing an effective dose of phytoene dehydrogenase inhibitor may also include glyphosate herbicides, glufosinate herbicides, plant growth regulator herbicides, gramineous herbicides, pre-germination selective herbicides, and / or post-germination selective herbicides.
[0032] To achieve the above objectives, the present invention also provides a method for producing plants resistant to phytoene dehydrogenase inhibitor herbicides, comprising introducing the polynucleotide sequence encoding phytoene dehydrogenase as described in the present invention into the genome of a plant, wherein when a herbicide containing an effective dose of phytoene dehydrogenase inhibitor is applied to a field in which at least said plant is present, said plant exhibits reduced plant damage and / or increased plant yield compared to other plants that do not have the polynucleotide sequence encoding phytoene dehydrogenase as described in the present invention, wherein said phytoene dehydrogenase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0033] Preferably, the method of introduction includes genetic transformation, genome editing, or gene mutation.
[0034] Preferably, the plants include monocotyledons and dicotyledons; more preferably, the plants are oats, wheat, barley, millet, corn, sorghum, short-stalked grass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, beet, cucumber, cotton, rapeseed, potato, tomato, or Arabidopsis thaliana.
[0035] Preferably, the phytoene dehydrogenase inhibitor herbicide includes pyridazinone herbicides, pyridine-amide herbicides, and other types of phytoene dehydrogenase inhibitor herbicides;
[0036] Preferably, the phytoene dehydrogenase inhibitor herbicide includes fluroxypyr, pyrfluthrin, fluroxypyr, fluroxypyr, flupyrfluthrin, flupyridine, furazolidone and / or flubutyroxypyr.
[0037] More preferably, the phytoene dehydrogenase inhibitor herbicide includes pyrfluthrin and / or flupyrfluthrin.
[0038] To achieve the above objectives, the present invention also provides a method for cultivating plants tolerant to phytoene dehydrogenase inhibitor herbicides, comprising:
[0039] At least one plant propagation body is planted, the genome of which includes the polynucleotide sequence encoding phytopene dehydrogenase as described in this invention, wherein the phytopene dehydrogenase has at least 99% sequence identity with the amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0040] The plant propagule grows into a plant;
[0041] Applying a herbicide containing an effective dose of phytoene dehydrogenase inhibitor to a field containing at least the plants resulted in the harvesting of plants with reduced plant damage and / or increased plant yield compared to other plants that do not have the polynucleotide sequence encoding phytoene dehydrogenase as described in this invention.
[0042] Preferably, the phytoene dehydrogenase has at least 99% sequence identity with the amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0043] Preferably, the plants include monocotyledons and dicotyledons; more preferably, the plants are oats, wheat, barley, millet, corn, sorghum, short-stalked grass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, beet, cucumber, cotton, rapeseed, potato, tomato, or Arabidopsis thaliana.
[0044] Preferably, the phytoene dehydrogenase inhibitor herbicide includes pyridazinone herbicides, pyridine-amide herbicides, and other types of phytoene dehydrogenase inhibitor herbicides;
[0045] Preferably, the phytoene dehydrogenase inhibitor herbicide includes fluroxypyr, pyrfluthrin, fluroxypyr, fluroxypyr, flupyrfluthrin, flupyridine, furazolidone and / or flubutyroxypyr.
[0046] More preferably, the phytoene dehydrogenase inhibitor herbicide includes pyrfluthrin and / or flupyrfluthrin.
[0047] To achieve the above objectives, the present invention also provides a method for protecting plants from damage caused by phytoene dehydrogenase inhibitor herbicides or for conferring tolerance to phytoene dehydrogenase inhibitor herbicides to plants, comprising applying a herbicide containing an effective dose of phytoene dehydrogenase inhibitor to a field in which at least one transgenic plant is present, said transgenic plant having a polynucleotide sequence encoding phytoene dehydrogenase as described in the present invention in its genome, said transgenic plant having reduced plant damage and / or increased plant yield compared to other plants that do not have the polynucleotide sequence encoding phytoene dehydrogenase as described in the present invention, wherein said phytoene dehydrogenase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0048] Preferably, the transgenic plant includes monocotyledonous plants and dicotyledonous plants; more preferably, the transgenic plant is oat, wheat, barley, millet, corn, sorghum, short-stalked grass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato, or Arabidopsis thaliana.
[0049] Preferably, the phytoene dehydrogenase inhibitor herbicide includes pyridazinone herbicides, pyridine-amide herbicides, and other types of phytoene dehydrogenase inhibitor herbicides;
[0050] Preferably, the phytoene dehydrogenase inhibitor herbicide includes fluroxypyr, pyrfluthrin, fluroxypyr, fluroxypyr, flupyrfluthrin, flupyridine, furazolidone and / or flubutyroxypyr.
[0051] More preferably, the phytoene dehydrogenase inhibitor herbicide includes pyrfluthrin and / or flupyrfluthrin.
[0052] To achieve the above objectives, the present invention also provides the use of phytopene dehydrogenase in conferring tolerance to phytopene dehydrogenase inhibitor herbicides to plants, wherein the phytopene dehydrogenase has at least 99% sequence identity with the amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0053] Preferably, the use of the phytopene dehydrogenase in conferring tolerance to phytopene dehydrogenase inhibitor herbicides to plants includes applying a herbicide containing an effective dose of phytopene dehydrogenase inhibitor to a field in which at least one transgenic plant is present, the transgenic plant having a genome containing the polynucleotide sequence encoding the phytopene dehydrogenase as described in this invention, the transgenic plant exhibiting reduced plant damage and / or increased plant yield compared to other plants that do not have the polynucleotide sequence encoding the phytopene dehydrogenase as described in this invention;
[0054] Preferably, the plants include monocotyledons and dicotyledons; more preferably, the plants are oats, wheat, barley, millet, corn, sorghum, short-stalked grass, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, beet, cucumber, cotton, rapeseed, potato, tomato, or Arabidopsis thaliana.
[0055] Preferably, the phytoene dehydrogenase inhibitor herbicide includes pyridazinone herbicides, pyridine-amide herbicides, and other types of phytoene dehydrogenase inhibitor herbicides;
[0056] Preferably, the phytoene dehydrogenase inhibitor herbicide includes fluroxypyr, pyrfluthrin, fluroxypyr, fluroxypyr, flupyrfluthrin, flupyridine, furazolidone and / or flubutyroxypyr.
[0057] More preferably, the phytoene dehydrogenase inhibitor herbicide includes pyrfluthrin and / or flupyrfluthrin.
[0058] Preferably, the polynucleotide sequence of the phytoene dehydrogenase has:
[0059] (a) A polynucleotide sequence encoding an amino acid sequence having at least 99% sequence identity with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8;
[0060] (b) The polynucleotide sequence shown in any one of SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:23; or
[0061] (c) Nucleotide sequences for codon optimization of the polynucleotide sequences SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:23 for use in a particular plant.
[0062] As a specific implementation method, PDS inhibitor (PDSi) herbicides, also known as "PDS inhibitor herbicides" or "phytoene dehydrogenase inhibitor herbicides", may be selected from one or more of the following groups, but are not limited to: pyridazinones (Norflurazon); pyridine-amides (Diflufenican, Picolinafen); other classes (Flurochloridone, Fluridone, Flurtamone, Beflubutamid)).
[0063] The phrase "at least 99% sequence identity" used in this invention refers to a situation where the sequence undergoes natural mutation. Those skilled in the art can reasonably determine the scope covered and whether the resulting polypeptide possesses the function of phytoene dehydrogenase.
[0064] In this invention, the term "herbicide-insensitive" refers to the ability of phytoene dehydrogenase to maintain at least a portion of its enzymatic activity in the presence of one or more PDS inhibitor herbicides. The enzymatic activity of phytoene dehydrogenase can be measured by any means known in the art, such as determining the amount of phytoene dehydrogenase product generated or the amount of phytoene dehydrogenase substrate consumed by fluorescence, high-performance liquid chromatography (HPLC), or mass spectrometry (MS) in the presence of one or more PDS inhibitor herbicides. "Herbicide-insensitive" can mean complete or partial insensitivity to a particular herbicide and can be expressed as a percentage of tolerance or insensitivity to a particular PDS inhibitor herbicide.
[0065] The "tolerance" or "resistance" described in this invention refers to the ability of PDS proteins or cells, tissues, or plants containing these proteins to withstand herbicides while maintaining enzyme activity, viability, or plant growth. This can generally be characterized by parameters such as the amount or concentration of herbicide used. The optimal level of "tolerance" or "resistance" described in this invention is such that, at the same amount or concentration of herbicide used, it reduces, inhibits, or kills unwanted plants without affecting the growth or survival of plants containing the mutant protein described in this invention.
[0066] In this invention, the terms "herbicide tolerance of plants, seeds, plant tissues, or cells" or "herbicide-resistant plants, seeds, plant tissues, or cells" refer to the ability of plants, seeds, plant tissues, or cells to resist the action of herbicides when applied. For example, herbicide-resistant plants can survive or continue to grow in the presence of herbicides. Herbicide tolerance of plants, seeds, plant tissues, or cells can be measured by comparing plants, seeds, plant tissues, or cells with suitable controls. For example, herbicide tolerance can be measured or assessed by applying a herbicide to a plant containing DNA molecules encoding proteins that confer herbicide tolerance (test plants) and a plant not containing DNA molecules encoding proteins that confer herbicide tolerance (control plants), and then comparing the plant damage of the two types of plants, wherein the herbicide tolerance of the test plants is indicated by a reduction in the damage rate compared to the damage rate of the control plants. Herbicide-resistant plants, seeds, plant tissues, or cells exhibit a reduced response to the toxic effects of herbicides compared to control plants, seeds, plant tissues, or cells.
[0067] The "conferring resistance or tolerance to PDS-inhibiting herbicides" described in this invention includes, for parent plants that do not have resistance or tolerance to PDS-inhibiting herbicides, or parent plants that have a certain or low tolerance to PDS-inhibiting herbicides (at the same herbicide concentration), introducing the mutant polypeptide or nucleotide encoding the mutant polypeptide described in this invention into the plants, thereby conferring a certain degree of herbicide resistance or tolerance to non-resistant plants, and improving the tolerance of plants with a certain or low tolerance to herbicides.
[0068] The term "herbicide tolerance trait" in this invention refers to a transgenic trait that confers improved herbicide tolerance to a plant compared to a wild-type plant. Plants that can produce the herbicide tolerance trait of this invention include, for example, any plant, including crop plants such as oats, wheat, barley, millet, corn, sorghum, *Brachys pubescens*, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rapeseed, potato, tomato, and Arabidopsis thaliana.
[0069] The term "sequence identity percentage" or "sequence identity %" refers to the percentage of identical amino acids in the protein sequence of a reference or query sequence (or its complementary strand) compared to the test sequence (or its complementary strand) when two sequences are aligned.
[0070] The pyrfluthrin described in this invention refers to N-(2,4-difluorophenyl)-2-[3-(trifluoromethyl)phenoxy]pyridine-3-carboxamide, the technical grade of which is a white crystalline powder. Pyrfluthrin belongs to the pyridine-amide class of low-dosage, selective herbicides. It can be formulated as powder, suspension, or water-dispersible granules, and can also be mixed with isoproturon, pendimethalin, fluthiamethoxam, furazolidone, etc. Pyrfluthrin can be used to control annual grass and broadleaf weeds in fields such as wheat, barley, rice, garlic, white hyacinth bean, spring pea, carrot, sunflower, saposhnikovia root, bupleurum root, atractylodes rhizome, and white peony root. The weeds that can be controlled include, but are not limited to, Rubiaceae (cleavers, madder), Scrophulariaceae (veronica), Violaceae (pansy, violet), Amaranthaceae (amaranth, purslane), Caryophyllaceae (chickweed), Lamiaceae (weasel petal), Malvaceae and Polygonaceae (soybean knotweed, pennea knotweed, spring knotweed), etc.
[0071] The effective dosage of pyrifluquinazon mentioned in this invention refers to 225-900 g ai / ha, including 235-890 g ai / ha, 275-850 g ai / ha, 325-800 g ai / ha, or 425-700 g ai / ha.
[0072] The flupyridine described in this invention refers to N-(4-fluorophenyl)-6-[3-(trifluoromethyl)phenoxy]pyridine-2-carboxamide, the technical grade of which is a colorless crystalline solid. Flupyridine belongs to the pyridine-amide class of ultra-low dosage, selective herbicides. It can be formulated as a suspension concentrate or mixed with fluthiamethoxam, pendimethalin, etc. Flupyridine can control annual grasses and broadleaf weeds in wheat and rice fields. The weeds it can control include, but are not limited to, weeds resistant to glyphosate, acetyllactate synthase inhibitors, and acetyl-CoA carboxylase inhibitors.
[0073] The effective dose of flupyridine described in this invention refers to a dosage of 75-300 g ai / ha, including 85-290 g ai / ha, 125-250 g ai / ha, 175-200 g ai / ha, or 180-190 g ai / ha.
[0074] In this invention, the term "resistance" is heritable and allows plants to grow and reproduce even when a given plant is generally herbicide-effective.
[0075] The anti-biological stress proteins described in this invention refer to proteins that resist stresses imposed by other organisms, such as insect resistance proteins, disease resistance proteins (viruses, bacteria, fungi, nematodes), etc.
[0076] The abiotic stress-resistant proteins described in this invention refer to proteins that resist stresses imposed by the external environment, such as proteins that are resistant to herbicides, drought, heat, cold, freezing, salt stress, and oxidative stress.
[0077] The proteins that affect plant quality as described in this invention refer to proteins that affect plant output traits, such as proteins that improve the quality and content of starch, oil, and vitamins, and proteins that improve fiber quality.
[0078] In addition, the expression cassette containing the polynucleotide sequence encoding phytopene dehydrogenase can also be expressed in plants along with at least one protein encoding a herbicide tolerance gene, including but not limited to, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), glyphosate oxidoreductase (GOX), glyphosate-N-acetyltransferase (GAT), glyphosate decarboxylase, glufosinate acetyltransferase (PAT), α-ketoglutarate-dependent dioxygenase (AAD), dicamba monooxygenase (DMO), 4-hydroxyphenylpyruvate dioxygenase (HPPD), acetolactate synthase (ALS), and / or cytochrome protein (P450).
[0079] In this invention, "glyphosate" refers to N-phosphonomethylglycine and its salts, and "treatment with glyphosate herbicide" means treatment with any herbicide formulation containing glyphosate. Commercial formulations of glyphosate include, but are not limited to, (Glyphosate as isopropylamine salt) WEATHERMAX (glyphosate as a potassium salt) DRY and (Glyphosate as an amine salt) GEOFORCE (as a sodium salt of glyphosate) and (Glyphosate as a trimethyl sulfide).
[0080] The effective dose of glyphosate mentioned in this invention refers to a dosage of 200-1600 g ae / ha, including 250-1600 g ae / ha, 300-1600 g ae / ha, 500-1600 g ae / ha, 800-1500 g ae / ha, 1000-1500 g ae / ha, or 1200-1500 g ae / ha.
[0081] The "glufosinate" mentioned in this invention, also known as glufosinate-butanedin, refers to ammonium 2-amino-4-[hydroxy(methyl)phosphono]butyrate. Treatment with "glufosinate herbicide" means treatment with any herbicide formulation containing glufosinate.
[0082] The effective dose of glufosinate mentioned in this invention refers to a dosage of 200-800 g ae / ha, including 200-750 g ae / ha, 250-700 g ae / ha, 300-700 g ae / ha, 350-650 g ae / ha, or 400-600 g ae / ha.
[0083] In this invention, auxin-based herbicides mimic or act like natural plant growth regulators known as auxins, influencing cell wall plasticity and nucleic acid metabolism, thereby leading to uncontrolled cell division and growth. Symptoms of damage caused by auxin-based herbicides include upward bending or twisting of stems and petioles, cupped or curled leaves, and abnormal leaf shape and veins. Auxin-based herbicides include, but are not limited to, phenoxycarboxylic acid compounds, benzoic acid compounds, pyridine carboxylic acid compounds, quinoline carboxylic acid compounds, or ethyl ester compounds of glyphosate. Typically, auxin-based herbicides are dicamba, 2,4-dichlorophenoxyacetic acid (2,4-D), (4-chloro-2-methylphenoxy)acetic acid (MCPA), and / or 4-(2,4-dichlorophenoxy)butyric acid (2,4-DB).
[0084] The pre-germination selective herbicides described in this invention include, but are not limited to, acetanilide, acetochlor, acetolactate synthase inhibitors, and dinitroaniline.
[0085] The post-germination selective herbicides described in this invention include, but are not limited to, nicosulfuron, sulfadiazine, and quizalofop-P-ethyl.
[0086] In this invention, the amount of herbicide applied varies with soil structure, pH value, organic matter content, tillage system and weed size, and is determined by referring to the appropriate amount of herbicide to the herbicide label.
[0087] In this invention, the term "endow" refers to providing a plant with a characteristic or trait, such as herbicide tolerance and / or other desired traits.
[0088] In this invention, the term "heterologous" refers to DNA from another source. In the context of DNA, "heterologous" refers to any foreign, "non-self" DNA, including DNA from another plant of the same species. For example, in this invention, the soybean PDS gene can be expressed in soybean plants using transgenic methods, and this soybean PDS gene is still considered "heterologous" DNA.
[0089] The DNA sequence encoding the phytopene dehydrogenase described in this invention is used to provide the plants, plant cells, and seeds of this invention, which, compared to the same plants (control plants) that do not contain the DNA sequence encoding the phytopene dehydrogenase described in this invention, provide better tolerance to a variety of PDS inhibitor herbicides.
[0090] The gene encoding the phytopene dehydrogenase described in this invention is useful for producing plants resistant to PDS inhibitor herbicides. The gene encoding the phytopene dehydrogenase described in this invention is particularly well-suited for expression in plants to confer herbicide tolerance.
[0091] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably in this invention to refer to polymers of amino acid residues. These terms apply to polymers of amino acid residues, wherein one or more amino acid residues in the polymer are an artificial chemical analog of a corresponding naturally occurring amino acid, and to naturally occurring amino acid polymers.
[0092] The present invention also provides a nucleic acid molecule comprising encoding the phytopene dehydrogenase. Generally, the present invention comprises any polynucleotide sequence encoding a phytopene dehydrogenase having one or more conserved amino acid substitutions relative to the phytopene dehydrogenase. Conserved substitutions of functionally similar amino acids are well known to those skilled in the art, and the following five groups each contain amino acids that are conservedly substituted for each other: aliphatic: glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I); aromatic: phenylalanine (F), tyrosine (Y), tryptophan (W); sulfur-containing: methionine (M), cysteine (C); basic: arginine (I), lysine (K), histidine (H); acidic: aspartic acid (D), glutamic acid (E), asparagine (N), glutamine (Q).
[0093] Therefore, sequences having herbicide-resistant activity against phytoene dehydrogenase inhibitors and hybridizing under stringent conditions with the gene encoding the phytoene dehydrogenase of this invention are included in this invention. Exemplarily, these sequences share at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence homology with the sequences of this invention SEQ ID NO:16-30.
[0094] Due to the abundance of genetic codons, many different DNA sequences can encode the same amino acid sequence. Alternative DNA sequences that generate these proteins encoding the same or substantially the same proteins are within the skill level of those skilled in the art. These different DNA sequences are included within the scope of this invention. The term "substantially the same" means a sequence with amino acid substitutions, deletions, additions, or insertions that do not substantially affect herbicide tolerance activity, and also includes fragments that retain herbicide tolerance activity.
[0095] The terms "functional activity" or "activity" in this invention refer to the ability of the protein / enzyme (alone or in combination with other proteins) used in this invention to degrade or attenuate the activity of herbicides. Plants producing the proteins of this invention preferably produce an "effective amount" of protein, such that when the plant is treated with a herbicide, the level of protein expression is sufficient to give the plant complete or partial tolerance to the herbicide (unless otherwise specified, the normal field application rate). Herbicides can be used at amounts that typically kill target plants, normal field application rates, and concentrations. Preferably, the plant cells and plants of this invention are protected from growth inhibition or damage caused by herbicide treatment. The transformed plants and plant cells of this invention preferably have tolerance to PDS inhibitor herbicides, i.e., the transformed plants and plant cells can grow in the presence of an effective amount of PDS inhibitor herbicide.
[0096] The genes and proteins described in this invention include not only specific example sequences, but also portions and / or fragments (including deletions at the in-line and / or ends compared to the full-length protein), variants, mutants, variant proteins, substitutes (proteins with substituted amino acids), chimeras, and fusion proteins that preserve the active characteristics of the specific example protein.
[0097] In some embodiments, the nucleic acid sequence encoding the phytoene dehydrogenase described in this invention or a variant thereof that retains phytoene dehydrogenase activity can be superimposed with any combination of nucleic acid sequences of interest to produce a plant with a desired trait. The term "trait" refers to a phenotype derived from a specific sequence or set of sequences. For example, the nucleotide sequence encoding the phytoene dehydrogenase described in this invention or a variant thereof that retains phytoene dehydrogenase activity can be superimposed with any other nucleotide sequence encoding a polypeptide that confers a desired trait, including but not limited to: resistance to diseases, insects, and herbicides; tolerance to heat and drought; shortened crop maturity time; improved industrial processing (e.g., for converting starch or biomass into fermentable sugars); and improved agronomic qualities (e.g., high oil and high protein content).
[0098] As is well known to those skilled in the art, the benefits of combining two or more modes of action in enhancing the spectrum of controlled weeds and / or naturally more tolerant or resistant weed species can be extended to chemicals that artificially (transgenic or non-transgenic) induce herbicide tolerance in crops, in addition to those resistant to PDS. In fact, the following resistance traits can be encoded individually or in multiple combinations to provide effective control or prevention of weed succession towards herbicide resistance: glyphosate resistance (e.g., resistant plants or bacteria EPSPS, GOX, GAT), glufosinate resistance (e.g., PAT, Bar), acetolactate synthase (ALS) inhibitory herbicide resistance (e.g., imidazolinone, sulfonylurea, triazine, sulfaniline, pyrimidine thiobenzoic acid, and other chemical resistance genes such as AHAS, Csrl, SurA, etc.), and phenoxy auxins. Herbicide resistance (e.g., aryloxyalkyl ester dioxygenase-AAD), dicamba herbicide resistance (e.g., dicamba monooxygenase-DMO), bromonazine resistance (e.g., Bxn), resistance to protoporphyrinogen oxidase (PPO) inhibitors, resistance to photosystem II inhibitory herbicides (e.g., psbA), resistance to photosystem I inhibitory herbicides, resistance to 4-hydroxyphenylpyruvate dioxygenase inhibitory herbicides (e.g., HPPD), resistance to phenylurea herbicides (e.g., CYP76B1), dichloromethoxybenzoic acid degrading enzyme, etc.
[0099] Glyphosate is widely used because it controls a very broad spectrum of broadleaf and grass weed species. However, repeated use of glyphosate in both glyphosate-tolerant crops and non-crop applications has (and will continue to) selected for weed succession to naturally more tolerant species or glyphosate-resistant biotypes. Most herbicide resistance management strategies recommend using effective doses of tank-mixed herbicide conjugates as a method to delay the emergence of resistant weeds, which provide control of the same species but with different modes of action. Superimposing the gene encoding the phytoene dehydrogenase described in this invention with the glyphosate tolerance trait (and / or other herbicide tolerance traits) can achieve control of glyphosate-resistant weed species (broadleaf weed species controlled by one or more PDS-inhibitor herbicides) in glyphosate-tolerant crops by allowing selective application of glyphosate and PDS inhibitor herbicides (such as pyrifluquinazon, flufenoxuron) to the same crop. These herbicides can be applied simultaneously in a tank mixture containing two or more herbicides with different modes of action, individually in continuous use (e.g., pre-planting, pre-emergence, or post-emergence) with intervals ranging from 2 hours to 3 months, or alternatively, at any time (from 7 months after planting to harvest (or, for a single herbicide, the shortest pre-harvest interval)) in a combination of any number of herbicides representing each applicable class of compounds.
[0100] Flexibility is crucial in broadleaf weed control, encompassing application timing, individual herbicide dosage, and the ability to control stubborn or resistant weeds. Glyphosate applications in crops superimposed with glyphosate resistance genes / genes encoding the phytoene dehydrogenase described in this invention can range from 250 to 2500 g ai / ha; PDS inhibitor herbicides (one or more) can be applied at rates from 10 to 1000 g ai / ha. The optimal combination of these application times depends on specific conditions, species, and environment.
[0101] Herbicide formulations (such as ester, acid, or salt formulations, or soluble concentrates, emulsified concentrates, or soluble liquids) and tank-mixing additives (such as adjuvants or compatibilizers) can significantly affect weed control by a given herbicide or a combination of one or more herbicides. Any chemical combination of any of the aforementioned herbicides is within the scope of this invention.
[0102] Furthermore, the gene encoding the phytopene dehydrogenase described in this invention can be superimposed, either alone or in combination with other herbicide-resistant crop traits, and then superimposed with one or more other input (such as insect resistance, fungal resistance, or stress tolerance) or output (such as increased yield, improved oil content, improved fiber quality, etc.). Therefore, this invention can be used to provide a complete agronomic solution for flexibly and economically controlling any number of agricultural pests and improving crop quality.
[0103] These superimposed combinations can be generated by any method, including but not limited to: hybridization breeding of plants via conventional or top-cross methods or genetic transformation. If the sequences are superimposed by genetically transforming these plants, the polynucleotide sequences of interest can be combined at any time and in any order. For example, a transgenic plant including one or more desired traits can be used as a target for introducing additional traits through subsequent transformations. These traits can be introduced simultaneously with the polynucleotides of interest provided by any combination of expression cassettes in a co-transformation scheme. For example, if two sequences are to be introduced, these sequences can be contained in separate expression cassettes (trans) or in the same expression cassette (cis). Expression of these sequences can be driven by the same promoter or by different promoters. In some cases, it may be desirable to introduce an expression cassette that represses the expression of the polynucleotide of interest. This can be combined with any combination of other repressive or overexpression cassettes to produce the desired combination of traits in the plant. It is further recognized that polynucleotide sequences can be superimposed at a desired genomic location using a site-specific recombination system.
[0104] The gene encoding the phytopene dehydrogenase described in this invention exhibits high tolerance to PDS inhibitor herbicides, which forms the basis for important herbicide-tolerant crops and the potential of selection marker characteristics.
[0105] In this invention, "effective linkage" refers to the connection of nucleic acid sequences, such that one sequence provides the function required by the linked sequences. In this invention, "effective linkage" can refer to linking a promoter to a sequence of interest, such that the transcription of the sequence of interest is controlled and regulated by the promoter.
[0106] The genome of a plant, plant tissue, or plant cell as described in this invention refers to any genetic material within a plant, plant tissue, or plant cell, including the nucleus and plastid genome and the mitochondrial genome.
[0107] In this invention, the term "plant part" or "plant tissue" includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, plant clusters, and complete plant cells in a plant or in parts of a plant such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, spikes, rachis, outer shells, stems, roots, root tips, anthers, etc.
[0108] The PDS protein of this invention can be applied to a variety of plants. The dicotyledonous plants include, but are not limited to, alfalfa, beans, cauliflower, cabbage, carrots, celery, cotton, cucumber, eggplant, lettuce, melon, peas, pepper, zucchini, radish, rapeseed, spinach, soybean, pumpkin, tomato, Arabidopsis thaliana, peanut, or watermelon. Preferably, the dicotyledonous plants refer to cucumber, soybean, Arabidopsis thaliana, tobacco, cotton, peanut, or rapeseed. The monocotyledonous plants include, but are not limited to, corn, rice, sorghum, wheat, barley, rye, millet, sugarcane, oats, or turfgrass. Preferably, the monocotyledonous plants refer to corn, rice, sorghum, wheat, barley, millet, sugarcane, or oats.
[0109] In this invention, the term "plant transformation" refers to the cloning of a nucleic acid molecule encoding the phytoene dehydrogenase described in this invention, either alone or in combination with one or more additional nucleic acid molecules encoding a polypeptide that confers the desired trait, into an expression system, which is then transformed into a plant cell.
[0110] The term "genome editing technology" refers to genome modification technologies that enable precise manipulation of genome sequences to achieve site-directed mutations, insertions, deletions, and other gene operations. Currently, the main genome editing technologies include HE (homingendonuclease), ZFN (zinc-finger nuclease), TALEN (transcription activator-like effector nuclease), and CRISPR (Clustered Regulatory Interspaced Short Palindromic Repeat).
[0111] In this invention, weeds refer to plants that compete with cultivated genetically modified plants in the field.
[0112] In this invention, the terms "control" and / or "prevention" refer to the direct application (e.g., by spraying) of at least an effective dose of a PDS inhibitor herbicide to the field, minimizing and / or stopping weed development. Simultaneously, the cultivated transgenic plants should be morphologically normal and culturable under conventional methods for product consumption and / or generation; preferably, they exhibit reduced plant damage and / or increased plant yield compared to non-transgenic wild-type plants. Reduced plant damage specifically includes, but is not limited to, improved stem resistance and / or increased grain weight. The "control" and / or "prevention" effect of the phytopenic oleoresin dehydrogenase on weeds can exist independently and is not diminished or eliminated by the presence of other substances that can "control" and / or "prevent" weeds. Specifically, if any tissue of the transgenic plant (containing the gene encoding the phytopene dehydrogenase described in this invention) simultaneously and / or asynchronously contains and / or produces the phytopene dehydrogenase and / or another substance that controls weeds, then the presence of the other substance neither affects the “control” and / or “prevention” effect of the phytopene dehydrogenase on weeds, nor causes the “control” and / or “prevention” effect to be achieved entirely and / or partially by the other substance, and is unrelated to the phytopene dehydrogenase.
[0113] The "plant propagule" described in this invention includes, but is not limited to, plant sexual propagules and plant asexual propagules. The plant sexual propagule includes, but is not limited to, plant seeds; the plant asexual propagule refers to a plant's vegetative organ or a specific tissue that can produce new plants under in vitro conditions; the vegetative organ or specific tissue includes, but is not limited to, roots, stems, and leaves. For example, plants that use roots as asexual propagules include strawberries and sweet potatoes; plants that use stems as asexual propagules include sugarcane and potatoes (tuber); and plants that use leaves as asexual propagules include aloe vera and begonias.
[0114] This invention can confer new herbicide resistance traits on plants without observing adverse effects on phenotypes, including yield. Plants in this invention can tolerate common application levels of at least one tested herbicide, such as 2×, 3×, or 4×. These increased levels of tolerance are within the scope of this invention. Various techniques known in the art can be foreseeably optimized and further developed, for example, to increase the expression of a given gene.
[0115] This invention provides a use for phytoene dehydrogenase, which has the following advantages:
[0116] 1. Broad tolerance to herbicides. This invention discloses for the first time that phytoene dehydrogenases PDS1, PDS3, PDS4, PDS5, PDS6, PDS7, and PDS8 exhibit high tolerance to PDS inhibitor herbicides, thus showing broad application prospects in plants.
[0117] 2. Strong tolerance to herbicides. The phytoene dehydrogenases PDS1, PDS3, PDS4, PDS5, PDS6, PDS7 and PDS8 described in this invention have strong tolerance to PDS inhibitor herbicides, and all of them show high tolerance to pyrifluquinazon and fluroxypyr at 4 times the field concentration.
[0118] 3. Minimal impact on yield. There is a direct correlation between a plant's tolerance to herbicides and its yield. Highly resistant plants are generally unaffected by herbicides and therefore their yields are not affected. However, the yields of moderately and lowly resistant plants are significantly reduced compared to highly resistant plants.
[0119] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0120] Figure 1 This is a schematic diagram of the Arabidopsis recombinant expression vector DBN14444 containing the PDS1A nucleotide sequence of the present invention;
[0121] Figure 2 This is a schematic diagram of the structure of the positive control recombinant expression vector DBN13458 of the present invention;
[0122] Figure 3 These are schematic diagrams of the negative control recombinant expression vector DBN13700 and the blank control recombinant expression vector DBN11864 of the present invention.
[0123] Figure 4 This is a diagram showing the experimental effect of soybean T2 plants with high resistance to PDS inhibitor herbicides after the PDS5A-PDS8A nucleotide sequence was introduced into them according to the present invention. Detailed Implementation
[0124] The following specific embodiments further illustrate the technical solution for the use of the phytoene dehydrogenase of the present invention.
[0125] First Example: Obtaining and Verifying Transgenic Arabidopsis Plants
[0126] 1. Obtain the gene encoding phytopene dehydrogenase.
[0127] The amino acid sequences of microbial phytoene dehydrogenases PDS1, PDS2, PDS3, PDS4, PDS5, PDS6, PDS7, PDS8, PDS9, PDS10, PDS11, PDS12, PDS13, PDS14, and PDS15 are shown in Table 1 as SEQ ID NO:1 to SEQ ID NO:15. Based on the common preferred codons of Arabidopsis thaliana or soybean, the nucleotide sequences encoding PDS1A to PDS15A corresponding to the phytoene dehydrogenases PDS1 to PDS15 are obtained as shown in SEQ ID NO:16-30 of the sequence listing.
[0128] Table 1. Amino acid sequences, nucleotide sequences, and vector numbers corresponding to microbial phytoene dehydrogenases PDS1–PDS15
[0129]
[0130]
[0131] 2. Synthesize the above nucleotide sequences containing chloroplast localization signal peptides respectively.
[0132] Based on the codon preferences of Arabidopsis thaliana or soybean, the nucleotide sequence encoding the cyanobacterial chloroplast transport peptide homolog spCpCTP1 (SEQ ID NO:39) was obtained. The nucleotide sequence of the cyanobacterial chloroplast transport peptide homolog spCpCTP1 (SEQ ID NO:39), optimized with Arabidopsis thaliana or soybean codon preferences, was added upstream of the methionine start codon of the lycopene dehydrogenase PDS1A–PDS15A nucleotide sequences (SEQ ID NO:16–30) to obtain the nucleotide sequences spCpCTP1_PDS1A–spCpCTP1_PDS15A containing the chloroplast signal peptide.
[0133] The 5' and 3' ends of the nucleotide sequences spCpCTP1_PDS1A to spCpCTP1_PDS15A are respectively ligated to universal adapter primer 1:
[0134] 5' universal adapter primer 1: 5'-tgagtttttctgattaacagactagt-3' as shown in SEQ ID NO:31 in the sequence listing;
[0135] The 3' universal connector primer 1: 5'-tgccaaatgtttgaacgatcggcgcgcgcc-3' is shown in SEQ ID NO:32 in the sequence listing.
[0136] 3. Construct Arabidopsis recombinant expression vectors containing nucleotide sequences from PDS1A to PDS15A.
[0137] The plant expression vector DBNBC-01 was linearized by double digestion with restriction endonucleases Spe I and Asc I. The digestion products were purified to obtain the linearized DBNBC-01 expression vector backbone (vector backbone: pCAMBIA2301 (available from CAMBIA)). The spCpCTP1_PDS1A nucleotide sequence ligated to the universal adapter primer 1 was then used for recombination with the linearized DBNBC-01 expression vector backbone. The procedure was performed according to the instructions of the Takara In-Fusion Seamless Ligation Kit (Clontech, CA, USA, CAT: 121416) to construct the recombinant expression vector DBN14444, the structure of which is shown in the schematic diagram below. Figure 1(RB: right boundary; eFMV: 34S enhancer of Scrophularia mosaic virus (SEQ ID NO:33); prBrCBP: promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO:34); spAtCTP2: Arabidopsis chloroplast transport peptide (SEQ ID NO:35); cEPSPS: 5-enolpyruvate-shikimate-3-phosphate synthase gene (SEQ ID NO:36); tPsE9: terminator of pea RbcS gene (SEQ ID NO:37); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO:38); spCpCTP1: homologous sequence of cyanobacterial chloroplast transport peptide (SEQ ID NO:39); PDS1A: nucleotide sequence of microbial PDS1 optimized based on codon preference of Arabidopsis or soybean (SEQ ID NO:39)). NO:16); tNos: terminator of carmine synthase gene (SEQ ID NO:40); pr35S: 35S promoter of cauliflower mosaic virus (SEQ ID NO:41); cPAT: N-acetyltransferase gene of phosphinic acid (SEQ ID NO:42); t35S: 35S terminator of cauliflower mosaic virus (SEQ ID NO:43); LB: left border; Spec: spectinomycin gene).
[0138] The recombinant expression vector DBN14444 was transformed into Escherichia coli DH5α competent cells using a heat shock method. The heat shock conditions were as follows: 50 μL of E. coli T1 competent cells, 10 μL of plasmid DNA (recombinant expression vector DBN14444), incubated at 42°C for 30 s; cultured at 37°C with shaking for 1 h (shaking at 100 rpm); then cultured on LB solid plates containing 50 mg / L spectinomycin (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, pH adjusted to 7.5 with NaOH) at 37°C for 12 h. White colonies were picked and cultured overnight at 37°C in LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 50 mg / L spectinomycin, pH adjusted to 7.5 with NaOH). The plasmid was extracted using the alkaline method: the bacterial culture was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the precipitated bacterial cells were resuspended in 100 μl of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH 8.0); 200 μL of freshly prepared solution II (0.2 M... Add NaOH and 1% SDS (sodium dodecyl sulfate), invert the tube four times to mix, and place on ice for 3-5 min; add 150 μL of ice-cold Solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 4℃ and 12000 rpm for 5 min, add 2 volumes of anhydrous ethanol to the supernatant, mix well, and place at room temperature for 5 min; centrifuge at 4℃ and 12000 rpm for 5 min, discard the supernatant, wash the precipitate with 70% ethanol (V / V) and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at 37℃ for 30 min; store at -20℃ for later use. The extracted plasmids were sequenced and identified, and the results showed that the recombinant expression vector DBN14444 containing the PDS1A nucleotide sequence was successfully constructed.
[0139] Following the method described above for constructing the recombinant expression vector DBN14444, the nucleotide sequences spCpCTP1_PDS2A to spCpCTP1_PDS15A, respectively ligated to universal adapter primer 1, were recombinated with the linearized DBNBC-01 expression vector backbone to obtain recombinant expression vectors DBN14445 to DBN14453 and DBN14558 to DBN14562. Sequencing verified the correct insertion of the aforementioned nucleotide sequences in recombinant expression vectors DBN14445 to DBN14453 and DBN14558 to DBN14562.
[0140] 4. Constructing a positive control vector for Arabidopsis thaliana
[0141] Following the same vector recombination construction method as steps 2 and 3 in this embodiment, the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct a positive control vector DBN13458 containing the PDS16 nucleotide sequence (derived from the PDS gene of the microbial Rhodobacter capsulatus, whose nucleotide sequence is shown in SEQ ID NO. 44). Its structural schematic diagram is shown below. Figure 2 (RB: right boundary; eFMV: 34S enhancer of Scrophularia mosaic virus (SEQ ID NO:33); prBrCBP: promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO:34); spAtCTP2: Arabidopsis chloroplast transport peptide (SEQ ID NO:35); cEPSPS: 5-enolpyruvate-shikimate-3-phosphate synthase gene (SEQ ID NO:36); tPsE9: terminator of pea RbcS gene (SEQ ID NO:37); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO:38); spCpCTP1: homologous sequence of cyanobacterial chloroplast transport peptide (SEQ ID NO:39); PDS16A: nucleotide sequence of microbial PDS16 optimized based on codon preference of Arabidopsis or soybean (SEQ ID NO:39)). NO:44); tNos: terminator of carmine synthase gene (SEQ ID NO:40); pr35S: 35S promoter of cauliflower mosaic virus (SEQ ID NO:41); cPAT: N-acetyltransferase gene of phosphinic acid (SEQ ID NO:42); t35S: 35S terminator of cauliflower mosaic virus (SEQ ID NO:43); LB: left border; Spec: spectinomycin gene).
[0142] 5. Constructing Arabidopsis thaliana negative control vector and blank control vector
[0143] Following the same vector recombination construction method as step 3 in this embodiment, the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949). A negative control vector DBN13700 containing the cAtPDS nucleotide sequence (SEQ ID NO: 45) and a blank control vector DBN11864 without any PDS gene were constructed. Their structural diagrams are shown below. Figure 3 As shown. (RB: right border; eFMV: 34S enhancer of Scrophularia mosaic virus (SEQ ID NO:33); prBrCBP: promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO:34); spAtCTP2: Arabidopsis chloroplast transport peptide (SEQ ID NO:35); cEPSPS: 5-enolpyruvate-shikimic acid-3-phosphate synthase gene (SEQ ID NO:36); tPsE9: terminator of pea RbcS gene (SEQ ID NO:37); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO:38); spCpCTP1: homologous sequence of cyanobacterial chloroplast transport peptide (SEQ ID NO:39); cAtPDS: Arabidopsis lycopene dehydrogenase gene (SEQ ID NO:45); cEGFP: green fluorescent protein gene (SEQ ID NO:39). NO:46); tNos: terminator of carmine synthase gene (SEQ ID NO:40); pr35S: 35S promoter of cauliflower mosaic virus (SEQ ID NO:41); cPAT: N-acetyltransferase gene of phosphinic acid (SEQ ID NO:42); t35S: 35S terminator of cauliflower mosaic virus (SEQ ID NO:43); LB: left border; Spec: spectinomycin gene).
[0144] 6. Arabidopsis recombinant expression vector transformed into Agrobacterium
[0145] The correctly constructed recombinant expression vectors DBN14444 to DBN14453, DBN14558 to DBN14562, and the control recombinant expression vectors DBN13458, DBN13700, and DBN11864 were transformed into Agrobacterium GV3101 using liquid nitrogen. The transformation conditions were as follows: 100 μL Agrobacterium GV3101, 3 μL plasmid DNA (recombinant expression vectors DBN13458, DBN14444 to DBN14453, DBN14558 to DBN14562, DBN11864, and DBN13700); incubated in liquid nitrogen for 10 min, 3 Incubate in a 7℃ water bath for 10 min; inoculate the transformed Agrobacterium GV3101 into LB tubes and culture at 28℃ and 200 rpm for 2 h. Spread the culture onto LB solid plates containing 50 mg / L rifampicin and 50 mg / L spectinomycin until positive single colonies grow. Pick single colonies, culture them, and extract their plasmids. Sequencing and identification of the extracted plasmids showed that the recombinant expression vectors DBN13458, DBN14444 to DBN14453, DBN14558 to DBN14562, DBN11864, and DBN13700 had completely correct structures.
[0146] 7. Obtaining transgenic Arabidopsis plants
[0147] Wild-type Arabidopsis seeds were suspended in a 0.1% (w / v) agarose solution. The suspended seeds were stored at 4°C for 2 days to complete the necessary dormancy to ensure synchronous germination. A mixture of vermiculite and horse manure was irrigated with water until moist, and the soil mixture was drained for 24 hours. The pretreated seeds were then sown on the soil mixture and covered with a moisture-retaining cover for 7 days. Germination was then carried out under constant temperature (22°C), constant humidity (40-50%), and light intensity of 120-150 μmol / m². 2 s -1 Plants were cultivated in a greenhouse under long-day conditions (16 hours of light / 8 hours of darkness). Initially, the plants were irrigated with Hogland's nutrient solution, followed by deionized water, keeping the soil moist but not saturated.
[0148] Arabidopsis thaliana was transformed using the flower immersion method. One or more 15-30 mL aliquots of LB medium containing spectinomycin (50 mg / L) and rifampin (10 mg / L) were inoculated with selected Agrobacterium colonies. The pre-cultures were incubated overnight at 28°C with constant shaking at 220 rpm. Each pre-culture was used to inoculate two 500 mL aliquots of YEP medium containing spectinomycin (50 mg / L) and rifampin (10 mg / L), and the cultures were incubated overnight at 28°C with constant shaking. The cells were centrifuged at approximately 4000 rpm for 20 min at room temperature to pellet the cells, and the supernatant was discarded. The cell pellet was gently resuspended in 500 mL of osmotic medium containing 1 / 2 × MS salt / vitamin B5, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μL / L (stock solution in 1 mg / mL DMSO)), and 300 μL / L Silvet L-77. Approximately one-month-old Arabidopsis plants were immersed in the resuspended cell medium for 5 min, ensuring the newest inflorescences were submerged. The plants were then laid sideways and covered, kept moist in the dark for 24 h, and then cultured normally at 22°C with a 16 h light / 8 h dark photoperiod. Seeds were harvested after approximately 4 weeks.
[0149] The newly harvested T1 seeds were dried at room temperature for 7 days. The seeds were planted in 26.5cm×51cm germination trays, with each tray receiving 200mg of T1 seeds (approximately 10,000 seeds). The seeds had been pre-suspended in distilled water and stored at 4°C for 2 days to complete the necessary dormancy and ensure synchronous germination.
[0150] Mix vermiculite with horse manure and irrigate the bottom of the soil with water until moist, then drain by gravity. Using a pipette, evenly sow the pretreated seeds onto the soil mixture and cover with a moisture-retaining cover for 4-5 days. Remove the cover one day before initial transformant selection using a post-emergence spray of glufosinate (selecting the co-transformed cPAT gene).
[0151] Seven days after planting (DAP) and again at 11 DAP, spray T1 plants (cotyledon stage and 2-4 leaf stage, respectively) with a 0.2% solution of Liberty herbicide (200 g ai / L glufosinate) using a DeVilbiss compressed air nozzle at a spray volume of 10 mL / tray (703 L / ha) to provide an effective dose of glufosinate at each application. Four to seven days after the final spray, identify surviving plants (actively growing plants) and transplant them into 7 cm × 7 cm square pots prepared with horse manure and vermiculite (3-5 plants per pot). Cover the transplanted plants with a moisture-retaining cover for 3-4 days and place them in a 22°C incubator as before or directly into a greenhouse. Then, the cover was removed and the plants were planted in a greenhouse (temperature 22±5℃, 50±30% RH, 14h light: 10h dark, minimum 500 μE / m²) for at least one day before testing the ability of DBN14444 to DBN14453, DBN14558 to DBN14562 and control vectors DBN13458, DBN13700, and DBN11864 to provide PDS inhibitor herbicide tolerance) to test. 2 s -1 (Natural + supplemental light).
[0152] 8. Herbicide tolerance test of transgenic Arabidopsis plants
[0153] First, Arabidopsis thaliana T0 plants were selected using glufosinate-ammonia herbicide. Twelve Arabidopsis thaliana T0 plants (18 days after sowing) were transformed with PDS1A-PDS16A nucleotide sequences, cAtPDS nucleotide sequences, and without PDS gene transformation. They were sprayed with three concentrations of pyrifluquinazon (225 g ai / ha (1x field concentration, 1×), 900 g ai / ha (4x field concentration, 4×), and 0 g ai / ha (water, 0×)) to test the herbicide tolerance of Arabidopsis thaliana.
[0154] Seven days after spraying (7DAT), the degree of herbicide damage to each plant was calculated based on the proportion of leaf whitening area (leaf whitening area proportion = leaf whitening area / total leaf area × 100%): Level 0 was defined as virtually no herbicide damage; Level 1 was a leaf whitening area proportion less than 20%; Level 2 was a leaf whitening area proportion greater than 20% but less than 50%; and Level 3 was a leaf whitening area proportion greater than 50%. The resistance performance of each recombinant expression vector was scored using the formula X = [∑(N×S) / (T×M)]×100 (X - herbicide damage score, N - number of plants with the same level of damage, S - number of herbicide damage levels, T - total number of plants, M - highest herbicide damage level). Resistance was evaluated based on the scores: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), low-resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 2.
[0155] Table 2 Results of the experiment on the tolerance of transgenic Arabidopsis thaliana T0 plants to pyrfluthrin.
[0156] Table 2 shows that: Arabidopsis thaliana T0 plants with blank control vector DBN11864 were not resistant to 1-fold and 4-fold concentrations of pyrifluquinazon; Arabidopsis thaliana T0 plants with negative control vector DBN13700 showed low resistance to 0.5-fold concentration of pyrifluquinazon; Arabidopsis thaliana T0 plants with positive control vector DBN13458 showed high resistance to 1-fold and 4-fold concentrations of pyrifluquinazon; and Arabidopsis thaliana T0 plants transformed with PDS1A and PDS3A-PDS8A nucleotide sequences all showed resistance to pyrifluquinazon. The plants exhibited excellent tolerance, showing high resistance to both 1x and 4x concentrations of pyrfluthrin. Arabidopsis T0 plants transformed with the PDS9A nucleotide sequence showed moderate resistance to both 1x and 4x concentrations of pyrfluthrin. Arabidopsis T0 plants transformed with the PDS2A and PDS10A nucleotide sequences showed low resistance to both 1x and 4x concentrations of pyrfluthrin. Arabidopsis T0 plants transformed with the PDS11A–PDS15A nucleotide sequences showed no resistance to either 1x or 4x concentrations of pyrfluthrin. This indicates that PDS1A–PDS10A can confer different levels of tolerance to pyrfluthrin in Arabidopsis, with PDS1A and PDS3A–PDS9A showing significantly increased tolerance.
[0157] Transformed Arabidopsis thaliana T1 plants were selected using glufosinate-ammonia herbicide. Twenty-four Arabidopsis thaliana T1 plants transformed with PDS1A, PDS3A–PDS8A nucleotide sequences, and 24 positive control (DBN13458) and negative control (DBN11864) plants (18 days after sowing) were sprayed with three concentrations of pyrifluquinazon (225 g ai / ha (1x field concentration, 1×), 900 g ai / ha (4x field concentration, 4×), and 0 g ai / ha (water, 0×)) and three concentrations of flurbifluquinazon (75 g ai / ha (1x field concentration, 1×), 300 g ai / ha (4x field concentration, 4×), and 0 g ai / ha (water, 0×)) to test herbicide tolerance in Arabidopsis thaliana. The experimental results are shown in Tables 3 and 4.
[0158] Table 3. Results of the experiment on the tolerance of transgenic Arabidopsis thaliana T1 plants to pyrfluthrin.
[0159]
[0160] Table 3 shows that: the blank control DBN11864 Arabidopsis T1 plants were not resistant to pyrfluthrin; the positive control DBN13458 Arabidopsis T1 plants were highly resistant to pyrfluthrin at 4 times the field concentration; Arabidopsis T1 plants transformed with PDS1A and PDS3A-PDS8A nucleotide sequences all showed excellent tolerance to pyrfluthrin, exhibiting high resistance to both 1 times and 4 times the field concentration, with PDS1A, PDS3A, and PDS5A-PDS8A showing a grade of 0 for both 1 times and 4 times the field concentration. This indicates that PDS1A and PDS3A-PDS8A significantly increase tolerance to pyrfluthrin.
[0161] Table 4. Results of the experiment on the tolerance of transgenic Arabidopsis thaliana T1 plants to flupyridine.
[0162]
[0163] Table 4 shows that: the blank control DBN11864 Arabidopsis T1 plants were not resistant to flupyridine; the positive control DBN13458 Arabidopsis T1 plants were highly resistant to 4 times the field concentration of flupyridine; Arabidopsis T1 plants transformed with PDS1A and PDS3A-PDS8A nucleotide sequences all showed excellent tolerance to flupyridine, exhibiting high resistance to both 1 times and 4 times the field concentration of flupyridine, with PDS1A, PDS3A, and PDS5A-PDS8A showing a grade of 0 for both 1 times and 4 times the field concentration of flupyridine. This indicates that PDS1A and PDS3A-PDS8A significantly increase tolerance to flupyridine.
[0164] In summary, microbial PDS genes can provide Arabidopsis with excellent resistance to pyrfluthrin and flupyridine herbicides. However, not all microbial PDS resistance genes can provide resistance to pyrfluthrin and flupyridine herbicides, especially those that can provide excellent resistance to 4 times the field concentration.
[0165] Second embodiment: Obtaining and verifying transgenic soybean plants
[0166] 1. Obtain soybean recombinant expression vector
[0167] The recombinant expression vectors DBN14448, DBN14449, DBN14450, DBN14451 and the positive control recombinant expression vector DBN13458 described in step 3 of Example 1 above were used for soybean genetic transformation.
[0168] 2. Transformation of Agrobacterium with recombinant expression vector
[0169] The recombinant expression vectors DBN13458, DBN14448, DBN14449, DBN144450, and DBN144451 (containing the nucleotide sequences of PDS16A, PDS5A, PDS6A, PDS7A, and PDS8A genes, respectively) described in step 1 of Example 2 were co-cultured with the above-mentioned Agrobacterium using the conventional Agrobacterium infection method on co-cultured cotyledonary node tissue of the aseptically cultured soybean variety Jack.
[0170] The T-DNA sequences of the constructed soybean recombinant expression vectors DBN13458, DBN14448, DBN14449, DBN144450, and DBN144451 were analyzed (RB: right border; eFMV: 34S enhancer of Scrophularia mosaic virus (SEQ ID NO:33); prBrCBP: promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO:34); spAtCTP2: Arabidopsis chloroplast transport peptide (SEQ ID NO:35); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO:36); tPsE9: terminator of pea RbcS gene (SEQ ID NO:37); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO:38); spCpCTP1: homologous sequence of cyanobacterial chloroplast transport peptide (SEQ ID NO:38). NO:39); PDS5A~PDS8A, PDS16A: microbial PDS genes (SEQ ID NO:20-23, SEQ ID NO:44); tNos: terminator of the carmine synthase gene (SEQ ID NO:40); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO:41); cPAT: phosphinicotinic acid N-acetyltransferase gene (SEQ ID NO:42); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:43); LB: left border; Spec: spectinomycin gene) were transferred into the soybean chromosome, and soybean plants with cEPSPS, PDS and cPAT polynucleotide sequences were obtained.
[0171] 3. Genetic transformation of soybeans using recombinant vectors
[0172] For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salt 3.1 g / L, B5 vitamin, sucrose 20 g / L, agar 8 g / L, pH 5.6). Seeds were inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1℃; photoperiod (light / dark) 16 / 8 h. After 4-6 days of germination, fresh, green, swollen, sterile soybean seedlings were harvested. The hypocotyl was removed 3-4 mm below the cotyledon node, and the cotyledons were longitudinally cut open, removing the terminal bud, lateral buds, and seed roots. The cotyledon node was wounded with the back of a scalpel, and the wounded cotyledon node tissue was contacted with an Agrobacterium suspension. Agrobacterium can deliver the vector T-DNA sequence to the wounded cotyledon node tissue (step 1: infection step). In this step, the cotyledon node tissue was preferably immersed in the Agrobacterium suspension (OD). 660=0.5-0.8, inoculated in infection medium (MS salt 2.15 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 40 mg / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3). Cotyledonary tissue is co-cultured with Agrobacterium for a period (3 days) (Step 2: Co-culture step). Preferably, after the infection step, the cotyledonary tissue is cultured on solid medium (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6). After this co-culture phase, a selective "recovery" step can be performed. In the "recovery" step, the recovery medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, pH 5.6) contains at least one known antibiotic that inhibits the growth of Agrobacterium (cephalosporin 150-250 mg / L), without adding a selector for plant transformants (Step 3: Recovery Step). Preferably, the cotyledonary node regenerated tissue blocks are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the cotyledonary node regenerated tissue blocks are cultured on a medium containing a selector (glyphosate) and the growing transformed callus is selected (Step 4: Selection Step). Preferably, the cotyledonary regenerated tissue blocks are cultured on a selective solid medium containing a selector (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, N-(phosphonocarboxymethyl)glycine 0.25 mol / L, pH 5.6), leading to selective growth of the transformed cells. The transformed cells then regenerate into plants (step 5: regeneration step). Preferably, the cotyledonary regenerated tissue blocks grown on the selective medium are cultured on solid media (B5 differentiation medium and B5 rooting medium) to regenerate plants.
[0173] The selected resistant tissue blocks were transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, N-(phosphocarboxymethyl)glycine 0.25 mol / L, pH 5.6) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured at 25°C until approximately 10 cm tall, then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the plants were cultured at 26°C for 16 hours each day, followed by 8 hours at 20°C.
[0174] 4. Verify transgenic soybean plants using TaqMan
[0175] Approximately 100 mg of leaves from soybean plants transformed with cEPSPS, PDS16A, PDS5A, PDS6A, PDS7A, PDS8A, and cPAT polynucleotide sequences were collected as samples. Genomic DNA was extracted using Qiagen's DNeasy Plant Maxi Kit. The copy number of the cEPSPS gene was determined by Taqman probe-based quantitative PCR to ascertain the copy number of the PDS target gene. Wild-type soybean plants were used as controls, and the same analysis was performed. The experiment was conducted in triplicate, and the average value was used.
[0176] The specific method for detecting the cEPSPS gene copy number is as follows:
[0177] Step 6: Take 100 mg of leaves from soybean plants with cEPSPS, PDS16A, PDS5A, PDS6A, PDS7A and PDS8A polynucleotide sequences and wild-type soybean plants respectively, grind them into homogenates in a mortar with liquid nitrogen, and take 3 replicates for each sample.
[0178] Step 7: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product manual for specific methods.
[0179] Step 8: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);
[0180] Step 9: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;
[0181] Step 10: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type soybean plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:
[0182] The following primers and probes are used to detect the cEPSPS gene sequence:
[0183] Primer _cEPSPS-1: ctggaaggcgaggacgtcatcaata is shown in SEQ ID NO:69 in the sequence listing;
[0184] Primer _cEPSPS_2: tggcggcattgccgaaatcgag is shown as SEQ ID NO:70 in the sequence listing;
[0185] Probe_cEPSPS: atgcaggcgatgggcgcccgcatccgta is shown as SEQ ID NO:71 in the sequence listing;
[0186] The PCR reaction system is as follows:
[0187]
[0188] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.
[0189] The PCR reaction conditions are as follows:
[0190]
[0191] Data were analyzed using the Fast Real-Time PCR System software (Applied Biosystems 7900HT Fast Real-Time PCR System SDS v2.3, Applied Biosystems).
[0192] The experimental results of analyzing the copy number of the cEPSPS gene showed that the cEPSPS, PDS16A, PDS5A, PDS6A, PDS7A, PDS8A and cPAT polynucleotide sequences had been integrated into the chromosomes of the soybean plants tested, and the soybean plants transformed with the cEPSPS, PDS16A, PDS5A, PDS6A, PDS7A, PDS8A and cPAT polynucleotide sequences were transformed into single-copy transgenic soybean plants.
[0193] 5. Results of experiments on the tolerance of genetically modified soybeans to PDSi herbicide
[0194] First, soybean T1 plants (DBN14448, DBN14449, DBN144450, and DBN144451) transformed with PDS5A, PDS6A, PDS7A, and PDS8A genes, respectively, were sprayed with glufosinate-ammonium, and negative-negative seedlings were removed. Soybean T1 plants transformed with PDS5A, PDS6A, PDS7A, and PDS8A genes, as well as the negative control Jack wild-type soybean plants, were sprayed with 4 times the field concentration of flufenoxuron (900 g ai / ha) and 4 times the field concentration of flufenoxuron (300 g ai / ha). Phenotypic behavior was observed 3 and 7 days after spraying to assess soybean herbicide tolerance.
[0195] Characteristics of PDSi herbicide damage: leaves may show signs of chlorosis, white spots, or even leaf drying.
[0196] PDSi herbicide damage typically occurs on the first, second, and third leaves from the top of the leaf, which are trifoliate.
[0197] Grade 0: No difference from the untreated group; leaves showed absolutely no phytotoxicity.
[0198] Grade 1: Leaves show chlorosis, or white spots appear on less than 20% of the area of the first or second leaf from the bottom, while the heart leaves are normal.
[0199] Grade 2: White spots appear on the heart leaves, or on the first and second leaves from the bottom, 20% < of the leaf area with white spots < 50%.
[0200] Level 3: Older leaves and newer leaves are damaged and white spots appear, with the white spot area on the leaves exceeding 50%, and the leaves may even wither.
[0201] The resistance performance of each recombinant expression vector in the transformation event was scored according to the formula X=[Σ(N×S) / (T×M)]×100. (X - herbicide damage score, N - number of plants with the same level of damage, S - number of herbicide damage levels, T - total number of plants, M - highest herbicide damage level). Resistance was evaluated based on the scores: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), low resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Tables 5 to 7.
[0202] Table 5. Results of the experiment on the tolerance of transgenic soybean T1 plants to pyrfluthrin.
[0203]
[0204] Table 5 shows that the negative control, wild-type soybean plants (Jack), were not resistant to pyrflufenican, while soybean T1 plants transformed with the PDS5A–PDS8A nucleotide sequences all exhibited excellent tolerance to pyrflufenican, showing high resistance to both 2x and 4x the field concentrations. Furthermore, PDS5A–PDS8A did not show any phytotoxicity to either 2x or 4x the field concentrations of pyrflufenican. This indicates that PDS5A–PDS8A significantly enhances tolerance to pyrflufenican.
[0205] Table 6. Results of the experiment on the tolerance of transgenic soybean T1 plants to flupyridine.
[0206]
[0207] Table 6 shows that the negative control, Jack wild-type soybean plants, were not resistant to flupyridine. Soybean T1 plants transformed with the PDS5A–PDS8A nucleotide sequences all exhibited excellent tolerance to flupyridine, showing high resistance to both 2x and 4x the field concentrations. Furthermore, PDS5A–PDS8A did not show any phytotoxicity to either 2x or 4x the field concentrations of flupyridine. This indicates that PDS5A–PDS8A significantly increases tolerance to flupyridine.
[0208] Table 7. Results of field experiments on the tolerance of transgenic soybean T2 plants to pyrfluthrin and flupyrfluthrin.
[0209]
[0210]
[0211] Table 7 shows that in the field, the negative control Jack wild-type soybean plants were not resistant to pyrfluthrin and flufenoxuron; the positive control DBN13458 soybean plants transformed with the PDS16A nucleotide sequence were moderately resistant to pyrfluthrin and lowly resistant to flufenoxuron, respectively; soybean T2 plants transformed with the PDS5A–PDS8A nucleotide sequences showed excellent tolerance to both pyrfluthrin and flufenoxuron, exhibiting high resistance to 4 times the field concentration of both pyrfluthrin and flufenoxuron, and PDS5A–PDS8A did not show any phytotoxicity to 4 times the field concentration of pyrfluthrin and flufenoxuron. Figure 4 As shown, this indicates that PDS5A–PDS8A exhibit significantly increased tolerance to pyrfluthrin and flupyrfluthrin.
[0212] In summary, regarding plants, the phytoene dehydrogenases PDS1, PDS3, PDS4, PDS5, PDS6, PDS7, and PDS8 described in this invention can confer excellent resistance to phytoene dehydrogenase inhibitors in Arabidopsis thaliana and soybean. Therefore, these phytoene dehydrogenases PDS1, PDS3, PDS4, PDS5, PDS6, PDS7, and PDS8 can confer excellent resistance to plants. On the other hand, this invention also demonstrates that not all microbial-derived PDS resistance genes can confer universal resistance to phytoene dehydrogenase inhibitors in Arabidopsis thaliana and soybean; that is, not all microbial-derived PDS resistance genes can confer broad-spectrum resistance in plants. Regarding herbicide tolerance, this invention discloses for the first time that phytoene dehydrogenases PDS1, PDS3, PDS4, PDS5, PDS6, PDS7, and PDS8 can confer high tolerance to phytoene dehydrogenase inhibitor herbicides, and can tolerate at least 4 times the field concentration of pyrifluquinazon and fluroxypyr, thus showing broad application prospects in plants.
[0213] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
Claims
1. A method of controlling weeds comprising applying a herbicide comprising an effective amount of a phytoene desaturase inhibitor to a field in which at least one transgenic plant is present, said transgenic plant comprising in its genome a polynucleotide sequence encoding phytoene desaturase, said transgenic plant having attenuated plant damage and / or having increased plant yield as compared to other plants not having said polynucleotide sequence encoding phytoene desaturase, wherein said phytoene desaturase has at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8; Preferably, said transgenic plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, said transgenic plant is oat, wheat, barley, millet, maize, sorghum, brachypodium distachyon, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis thaliana; Preferably, said phytoene desaturase inhibitor herbicide comprises difenzoquat and / or pyridate.
2. The method of controlling weeds according to claim 1, characterized by, The polynucleotide sequence of said phytoene desaturase has: (a) a polynucleotide sequence encoding an amino acid sequence having at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8; (b) a polynucleotide sequence as set forth in any one of SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23; or (c) a nucleotide sequence codon-optimized for use in a particular plant from the polynucleotide sequence of SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO:
23.
3. The method of controlling weeds according to claim 1 or 2, characterized by, Said transgenic plant further comprises at least one second polynucleotide encoding a second herbicide-tolerance protein different from said polynucleotide sequence encoding said phytoene desaturase. Preferably, said second polynucleotide encodes a selection marker protein, a protein with synthetic activity, a protein with degrading activity, an anti-biotic stress protein, an anti- abiotic stress protein, a male sterility protein, a protein affecting plant yield, and / or a protein affecting plant quality. Preferably, the second polynucleotide encodes a 5-enolpyruvylshikimate-3-phosphate synthase, a glyphosate oxidoreductase, a glyphosate-N-acetyltransferase, a glyphosate decarboxylase, a glufosinate acetyltransferase, an a-ketoglutarate-dependent dioxygenase, a dicamba monooxygenase, a 4-hydroxyphenylpyruvate dioxygenase, an acetolactate synthase, and / or a cytochrome-like protein. Further preferably, the herbicide comprising an effective amount of a phytoene desaturase inhibitor further comprises a glyphosate herbicide, a glufosinate herbicide, an auxin herbicide, a graminicide, a pre-emergence selective herbicide, and / or a post-emergence selective herbicide.
4. A planting combination for controlling the growth of weeds, characterized in that A herbicide comprising a phytoene desaturase inhibitor and at least one transgenic plant, applying an effective amount of the herbicide comprising the phytoene desaturase inhibitor to a field in which the at least one transgenic plant is present, the transgenic plant comprising in its genome the polynucleotide sequence encoding the phytoene desaturase, the transgenic plant having attenuated plant damage and / or having increased plant yield as compared to other plants not having the polynucleotide sequence encoding the phytoene desaturase, wherein the phytoene desaturase has at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8; Preferably, the transgenic plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the transgenic plant is oat, wheat, barley, millet, corn, sorghum, brachypodium distachyon, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis thaliana; Preferably, the herbicide comprising a phytoene desaturase inhibitor comprises a pyridazine herbicide, a pyridine-amide herbicide, other phytoene desaturase inhibitor herbicides; Preferably, the herbicide comprising a phytoene desaturase inhibitor comprises norflurazon, difenoxuron, flufiprole, flurochloridone, fluridone, furilazole, and / or butafenacil; Further preferably, the herbicide comprising a phytoene desaturase inhibitor comprises difenoxuron and / or flufiprole.
5. The planting combination for controlling the growth of weeds according to claim 4, wherein The polynucleotide sequence of the phytoene desaturase has: (a) a polynucleotide sequence encoding an amino acid sequence having at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8; (b) a polynucleotide sequence as set forth in any one of SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23; or (c) a codon-optimized nucleotide sequence of the polynucleotide sequence SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23 for use in a particular plant.
6. The planting combination for controlling the growth of weeds according to claim 4 or 5, wherein The transgenic plant further comprises at least one second polynucleotide encoding a second herbicide-tolerance protein different from the polynucleotide sequence encoding the phytoene desaturase. Preferably, the second polynucleotide encodes a selection marker protein, a synthesis- active protein, a decomposition-active protein, an anti-biotic stress protein, an anti- abiotic stress protein, a male sterility protein, a protein affecting plant yield, and / or a protein affecting plant quality. Preferably, the second polynucleotide encodes a 5-enolpyruvylshikimate-3-phosphate synthase, a glyphosate oxidoreductase, a glyphosate-N-acetyltransferase, a glufosinate decarboxylase, a phosphinothricin acetyltransferase, an a-ketoglutarate-dependent dioxygenase, a dicamba monooxygenase, a 4-hydroxyphenylpyruvate dioxygenase, an acetolactate synthase, and / or a cytochrome-like protein. Further preferably, the herbicide containing an effective dose of a phytoene desaturase inhibitor further comprises a glyphosate herbicide, a glufosinate herbicide, an auxin herbicide, a graminicide, a pre-emergence selective herbicide, and / or a post-emergence selective herbicide.
7. A method of producing a plant that is tolerant to a herbicide containing an effective dose of a phytoene desaturase inhibitor, comprising introducing into the genome of a plant a polynucleotide sequence encoding a phytoene desaturase, wherein the plant has attenuated plant damage and / or has increased plant yield as compared to other plants not having the polynucleotide sequence encoding the phytoene desaturase when the herbicide containing an effective dose of a phytoene desaturase inhibitor is applied to a field in which at least the plant is present, wherein the phytoene desaturase has at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8; Preferably, the method of introducing comprises a genetic transformation method, a genome editing method, or a gene mutation method; Preferably, the plants comprise monocots and dicots; more preferably, the plants are oats, wheat, barley, millet, maize, sorghum, brachypodium distachyon, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis thaliana; Preferably, the phytoene desaturase inhibitor herbicides comprise pyridiazinone herbicides, pyridine-amide herbicides, other classes of phytoene desaturase inhibitor herbicides; Preferably, the phytoene desaturase inhibitor herbicides comprise norflurazon, diflufenican, fluridone, flurochloridone, fluridymet, pyrazolate, and / or acifluorfen; Further preferably, the phytoene desaturase inhibitor herbicides comprise diflufenican and / or fluridone.
8. A method of growing a phytoene desaturase inhibitor herbicide tolerant plant, protecting a plant from damage caused by a phytoene desaturase inhibitor herbicide, or conferring phytoene desaturase inhibitor herbicide tolerance to a plant, comprising: planting at least one plant propagule comprising in its genome a polynucleotide sequence encoding a phytoene desaturase having at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8; growing the plant propagule into a plant; applying an effective dose of a phytoene desaturase inhibitor herbicide to a field comprising at least the plant, and harvesting a plant having attenuated plant damage and / or having increased plant yield as compared to a plant not having the polynucleotide sequence encoding a phytoene desaturase; Preferably, the phytoene desaturase has at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8; Preferably, the plants comprise monocots and dicots; more preferably, the plants are oats, wheat, barley, millet, maize, sorghum, brachypodium distachyon, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis thaliana; Preferably, the phytoene desaturase inhibitor herbicides comprise pyridiazinone herbicides, pyridine-amide herbicides, other classes of phytoene desaturase inhibitor herbicides; Preferably, the phytoene desaturase inhibitor herbicides comprise norflurazon, diflufenican, fluridone, flurochloridone, fluridymet, pyrazolate, and / or acifluorfen; Further preferably, the phytoene desaturase inhibitor herbicides comprise diflufenican and / or fluridone. Further preferably, the phytoene desaturase inhibitor herbicide comprises difenzoquat and / or pyridate.
9. Use of a phytoene desaturase in conferring phytoene desaturase inhibitor herbicide tolerance in a plant, the phytoene desaturase having at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8; Preferably, the use of the phytoene desaturase in conferring phytoene desaturase inhibitor herbicide tolerance in a plant comprises applying a herbicide containing an effective dose of a phytoene desaturase inhibitor to a field in which at least one transgenic plant is present, the transgenic plant comprising a polynucleotide sequence encoding the phytoene desaturase in its genome, the transgenic plant having attenuated plant damage and / or having increased plant yield as compared to other plants not having the polynucleotide sequence encoding the phytoene desaturase; Preferably, the plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oat, wheat, barley, millet, maize, sorghum, brachypodium distachyon, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato, or Arabidopsis thaliana; Preferably, the phytoene desaturase inhibitor herbicide comprises pyridazinone herbicides, pyridine-amide herbicides, other phytoene desaturase inhibitor herbicides; Preferably, the phytoene desaturase inhibitor herbicide comprises norflurazon, difenzoquat, pyridate, flurochloridone, fluridone, flurazole, and / or dithiopyr; Further preferably, the phytoene desaturase inhibitor herbicide comprises difenzoquat and / or pyridate.
10. The polynucleotide sequence of the phytoene desaturase according to claim 9 has: (a) a polynucleotide sequence encoding an amino acid sequence having at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8; (b) a polynucleotide sequence as set forth in any one of SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23; or (c) a nucleotide sequence that is codon-optimized for use in a particular plant to the polynucleotide sequence SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO:
23. (c) a nucleotide sequence that is codon-optimized for use in a particular plant to the polynucleotide sequence SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23.