Recombinant bacillus subtilis for displaying vibrio parahaemolyticus VP OmpK-MeL on spore surface, construction method and application
By constructing a recombinant Bacillus subtilis strain VPOmpK-MeL displaying Vibrio parahaemolyticus on its spore surface, the problem of the lack of highly effective oral vaccines in aquaculture has been solved. This approach achieves genetic stability and immune enhancement, simplifies the immunization procedure, and is suitable for the development of safe vaccines for small fish.
Patent Information
- Application Number
- CN202511945082.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-22
- Publication Date
- 2026-03-17
AI Technical Summary
There is a lack of highly effective and safe vaccines against Vibrio parahaemolyticus in current aquaculture, especially oral vaccines suitable for small fish. Furthermore, traditional vaccines have stability and safety issues, are difficult to administer, and have unstable protective effects.
A recombinant Bacillus subtilis spore surface displaying Vibrio parahaemolyticus VPOmpK-MeL was constructed. The OmpK antigen and MeL fusion protein were displayed on the surface of Bacillus subtilis spores using genetic engineering methods. Recombination was performed using the integrative plasmid pDG364 to ensure genetic stability. The spores were then transformed into B. subtilis 168 via homologous double cross transformation to achieve direct oral immunization.
This recombinant strain displays the VP OM protein on the spore surface, simplifying the immunization procedure, reducing costs, stimulating a specific immune response, enhancing the immune effect, protecting the intestinal barrier function, and reducing inflammatory response, making it suitable for commercial vaccine development.
Smart Images

Figure CN121674429A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological vaccine genetic engineering technology, and in particular to the display of Vibrio parahaemolyticus on the surface of spores. VPOmpK-MeL Recombinant Bacillus subtilis, its construction method and application. Background Technology
[0002] Vibrio parahaemolyticus ( Vibrio parahaemolyticus VP Vibrio, belonging to the genus Vibrio of the family Vibrioceae, is a Gram-negative, polar flagellated, motile, non-spore-forming, short rod-shaped or slightly curved bacterium. Widely distributed in seawater, it is an important human intestinal pathogen, causing diarrheal gastroenteritis, often resulting from the consumption of unclean or undercooked seafood. This bacterium is also a significant conditional pathogen in farmed aquatic animals, infecting various aquatic animals such as fish, shrimp, and shellfish, causing diseases such as hemotropic diseases in shrimp and skin ulcers in fish, making it one of the major pathogens threatening the marine aquaculture industry. Currently, antibiotics remain irreplaceable as important antibacterial drugs in aquaculture, but the side effects of antibiotic use are a significant concern. Regarding antibiotic-free aquaculture, in February 2019, the Ministry of Agriculture and Rural Affairs and nine other ministries jointly issued the "Several Opinions on Accelerating the Green Development of Aquaculture," which clearly stated that "promoting vaccine immunization and accelerating the reduction of veterinary drug use in aquaculture" is the future direction for healthy aquaculture in my country. Therefore, strengthening the research and development of antibiotic alternatives and gradually reducing antibiotic use with alternatives that are free of drug resistance and residues is key to ensuring the sustainable development of aquaculture.
[0003] A review of current research on vaccines for the prevention of Vibrio parahaemolyticus infection in aquaculture reveals that early research focused primarily on inactivated and live attenuated vaccines. With the rapid development of immunology and genetic engineering technologies, research into next-generation fish vaccines, such as genetically engineered vaccines, has begun. These vaccines are currently among the fastest-growing types for Vibrio prevention in aquaculture. Compared to traditional inactivated or live attenuated vaccines, they offer advantages such as ease of use, low cost, and ease of large-scale production. Furthermore, these vaccines are safe for aquaculture. While genetically engineered fish vaccines do provide effective immune protection, the number of vaccines used in actual production and application is limited. Currently, the few commercially available genetically engineered fish vaccines are mainly subunit vaccines and DNA vaccines; live vector vaccines have not yet been commercialized. Although gene mutation vaccines exhibit good immunogenicity, they face issues with vaccine stability and safety. Live vector vaccines offer good immunization effects, are low-cost, and can induce a broad range of immune responses in the host, including mucosal immunity, humoral immunity, and cellular immunity. However, the lack of stable and consistently high-expression heterologous gene expression systems has limited the development of live vector vaccines. Furthermore, the preservation and administration methods of existing vaccines also limit their development. Traditional Vibrio vaccines are generally administered to fish via injection or immersion. While injection immunization is more effective, it is difficult to perform, labor-intensive, and has significant side effects on fish. It is also only suitable for larger fish and not for juveniles. Immersion immunization suffers from unstable immune protection and a short duration of protection. Oral immunization, on the other hand, is convenient, can stimulate humoral and mucosal immunity, and does not cause stress in fish. Therefore, developing highly effective oral vaccines is a promising research direction. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for displaying Vibrio parahaemolyticus on the surface of spores. VPOmpK- MeL Recombinant Bacillus subtilis, construction method, and application: This recombinant Bacillus subtilis was constructed using genetic engineering methods, based on the integrative plasmid pDG364, to create a surface-displaying Bacillus subtilis strain with the spore capsid protein CotY as an anchor protein. VPOmpK Antigens and bee venom peptides Melittin ( MeL The recombinant vector containing the fusion fragment was used to transform the recombinant protein into wild-type Bacillus subtilis 168 via homologous double crossover. B. subtilisIn gene 168), the recombinant spores expressing OmpK-MeL protein obtained by this method exhibit genetic stability and do not suffer from plasmid loss during passage. This bacterium directly displays the antigen protein on the spore surface without cleavage, allowing for direct mixing with feed or drinking water for animal immunization, avoiding difficulties in protein purification and cumbersome injection immunization procedures. Furthermore, the spores' good stress resistance makes them easy to preserve and transport, significantly reducing costs. Experimental results show that this bacterium can induce specific immune responses, and the fusion-expressed MeL plays a significant role in enhancing immunity, which provides... VP This provides a new approach to prevention and treatment, which can be applied to the development of commercial vaccines.
[0005] To achieve the above technical effects, the following technical solution is adopted: A sort of OM The gene, whose nucleotide sequence is shown in SEQ ID No. 1.
[0006] A recombinant plasmid comprising the aforementioned OM Gene.
[0007] Furthermore, the recombinant plasmid is prepared by... OM The gene was obtained by ligating it into the pMD19-T vector.
[0008] A spore surface displaying Vibrio parahaemolyticus VPOmpK-MeL Recombinant Bacillus subtilis, which is the aforementioned OM Bacillus subtilis genes or the recombinant plasmids mentioned above.
[0009] Vibrio parahaemolyticus is displayed on the surface of spores. VPOmpK-MeL The method for constructing recombinant Bacillus subtilis is as follows: The spore capsid protein CotY is incorporated into the integration vector pDG364. OM Genes are fused, and the resulting fused gene is... CotY-OM It was obtained by transferring it into Bacillus subtilis 168.
[0010] Furthermore, the specific steps include the following: (1) Synthesis OM The gene was extracted and further ligated into the pMD19-T vector, which was then transformed into E. coli competent cells DH5α to obtain the recombinant plasmid pMD19-T-. OM ; (2) The obtained recombinant plasmid pMD19-T- OM With recombinant integration plasmid pDG364- CotY After double digestion with HindIII and EcoRI, the samples were recovered by gel extraction. OM Fragment and pDG364- CotYThe DNA was then ligated using DNA ligase and transformed into E. coli DH5α to obtain the recombinant integrative plasmid pDG364- CotY-OM ; (3) The recombinant plasmid pDG364- CotY - OM Through homologous double cross-transfer B. subtilis 168 Recombinant Bacillus subtilis displaying OM antigen protein on the spore surface was obtained by screening competent cells.
[0011] Vibrio parahaemolyticus is displayed on the surface of spores. VPOmpK-MeL Recombinant Bacillus subtilis was constructed using any of the above methods.
[0012] The aforementioned OM Genes, recombinant plasmids, and spore surface display of Vibrio parahaemolyticus VPOmpK-MeL Application of recombinant Bacillus subtilis and its construction method in the preparation of biological products against Vibrio parahaemolyticus infection.
[0013] The aforementioned OM Genes, recombinant plasmids, and spore surface display of Vibrio parahaemolyticus VPOmpK-MeL Application of recombinant Bacillus subtilis and its construction method in the preparation of anti-Vibrio parahaemolyticus vaccines.
[0014] The aforementioned OM Genes, recombinant plasmids, and spore surface display of Vibrio parahaemolyticus VPOmpK-MeL Application of recombinant Bacillus subtilis and its construction method in the preparation of oral vaccines and probiotic vaccines against Vibrio parahaemolyticus infection.
[0015] The beneficial effects of this invention are as follows: (1) Display of spore surface in an embodiment of the present invention VP The recombinant Bacillus subtilis containing the OM protein was constructed using genetic engineering methods based on the integrative plasmid pDG364, creating a surface display protein anchored by the spore capsid protein CotY. VP The recombinant vector of the OM antigen protein was then transformed into the wild-type antigen using a homologous double crossover method. B. subtilis 168 In this process, it is possible to obtain [something] that can be displayed on the surface of spores. VP Genetically engineered Bacillus subtilis containing the OM antigen protein. That is, this invention uses genetic engineering techniques to... OM Genes and spore cap proteins CotY The coding gene was fused, and the Bacillus subtilis integrative plasmid was used as a vector to transform into... B. subtilis 168 In the strain, thus obtaining the display on the spore surface VP Genetically engineered Bacillus subtilis with OM protein.
[0016] (2) The recombinant Bacillus subtilis of the present invention can directly display antigen proteins on the surface of the spores, and immunize animals by mixing with feed or drinking water without the need for crushing, eliminating the protein purification step, significantly simplifying the immunization procedure, reducing immune stress, and saving labor costs. At the same time, compared with common genetically engineered bacteria such as lactobacilli, lactococci, or enterococci as expression vectors, the spores of recombinant Bacillus subtilis can survive under extreme conditions and still maintain immunogenicity under extreme conditions. Therefore, it avoids the problem of antigen inactivation or degradation caused by production, transportation, or digestive tract environment, ensuring that it induces specific mucosal immunity in the intestine in vivo, reducing consumption in the production and application process, and ensuring economic benefits in each link. Compared with the previous genetically engineered bacteria that display exogenous antigen fragments on the surface of spores, the use of MeL can reduce the amount of antigen required and greatly improve the effect of oral subunit vaccines, especially molecules that can trigger danger signals, such as enterotoxins and pathogen-associated molecular patterns. Meliol (MeL) is the main component of bee venom and has strong immunogenicity. By combining it with antigens through gene fusion and displaying it on the surface of Bacillus subtilis spores, it can enhance the immune response to mucosal surface antigens stimulated by recombinant Bacillus subtilis spores.
[0017] (3) The Bacillus subtilis used in this invention is an internationally recognized edible probiotic with a clear genetic background and non-invasiveness, which can be used to develop commercial vaccines.
[0018] (4) The recombinant spores with surface-displaying antigen proteins constructed in this invention are made by directly integrating the target gene into an integrative recombinant plasmid. B. subtilis 168 The strain genome is genetically stable and will not suffer from plasmid loss during passage.
[0019] (5) The present invention demonstrates through mammalian application experiments, represented by mice, that the recombinant Bacillus subtilis can induce a specific immune response in mice, with serum IgG levels and sIgA levels in intestinal contents significantly increased compared to the blank control. Mice fed with recombinant Bacillus subtilis underwent a challenge test after 42 days. The results of LPS, DAO, and D-LA tests on colonic tissue barrier function-related indicators after challenge showed that feeding recombinant Bacillus subtilis can alleviate... VP The damaging effect of infection on the colonic barrier; the results of serum cytokine and other assays in mice after challenge showed that the BOM group significantly reduced infection in mice. VP The excessive inflammatory response after infection; the detection results of the activities of antioxidant enzymes CAT, SOD, and T-AOC in the colon tissue of mice in each group after challenge showed that the antioxidant enzyme activities in colon 3 of the BOM group were higher than those in the CKg group, indicating that VP Pre-feeding with BOM (Bio-Organic Mucosal) bacteria during infection can alleviate intestinal antioxidant system disorders. This provides... VP This provides a new approach to prevention and control. Attached Figure Description
[0020] Figure 1 This is a schematic diagram of agarose gel electrophoresis of OmpK according to an embodiment of the present invention; Figure 2 This is a schematic diagram of the Western blot (WB) results of prokaryotic expression of OmpK protein in an embodiment of the present invention; Figure 3 The integrative plasmid pDG364- is an embodiment of the present invention. CotY-OmpK, pDG364- CotY-OM A schematic diagram; Figure 4 The integrative plasmid pDG364- is an embodiment of the present invention. CotY-OmpK, pDG364- CotY - OM Schematic diagram of double enzyme digestion verification results; Figure 5 This is an embodiment of the present invention. OM Gene integration B. subtilis 168 A schematic diagram of the genome process; Figure 6 This is a schematic diagram of the amylase activity screening test of BO and BOM in an embodiment of the present invention; Figure 7 This is a schematic diagram of the genomic PCR identification results of BO and BOM in an embodiment of the present invention; Figure 8 This is a schematic diagram of the immunofluorescence assay for BO and BOM in an embodiment of the present invention; Figure 9 This is a schematic diagram showing the serum IgG and sIgA levels in mice induced before and after oral administration of BOM spores according to an embodiment of the present invention. Figure 10 This is a schematic diagram showing the levels of LPS, DAO, and D-LA, indicators of colonic barrier function and permeability, in mice challenged with oral BOM spores according to an embodiment of the present invention. Figure 11 This is a schematic diagram showing the levels of various cytokines in the serum of mice after oral administration of BOM spores in an embodiment of the present invention. Figure 12 This is a schematic diagram of the activity of various antioxidant enzymes in the colon tissue of mice after oral administration of BOM spores in an embodiment of the present invention. Detailed Implementation
[0021] The present invention will be further described below with reference to the accompanying drawings. The scope of protection of the present invention is not limited to the following description: Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.
[0022] I. Biomaterials involved in this invention (1) B. subtilis 168 strains, VP Strains: preserved by the Fermentation Engineering Laboratory of the Microecology Research Center, College of Veterinary Medicine, Sichuan Agricultural University.
[0023] (2) Escherichia coli BL21 ( Escherichia coli BL21), Escherichia coli DH5α ( Escherichia coli DH5α and plasmid pET-32a(+): both were purchased from Takara Bio (Beijing) Co., Ltd. (TaKaRa).
[0024] (3) Recombinant integrated plasmid pDG364-CotY: constructed and preserved by the Fermentation Engineering Laboratory of the Microecology Research Center of the College of Veterinary Medicine, Sichuan Agricultural University.
[0025] II. Construction of Prokaryotic Expression Plasmids (1) Using the genome of Vibrio parahaemolyticus standard strain ATCC 17802 as a template, OmpK -F1 / OmpK -R1 is used as a primer to amplify the gene encoding the outer membrane protein OmpK, thereby obtaining the target gene. OmpK1 . OmpK Gene agarose gel electrophoresis such as Figure 1 As shown.
[0026] The above OmpK The sequences of the primers for gene sequence amplification are as follows: OmpK-F1 (SEQ ID No. 2): CGGCGCCCG GCAGATTACTCTGACGGCGATAT Not I OmpK-R1 (SEQ ID No.3):GGGCTCGAGGAACTTGTAAGTTACTGCGA Xho I.
[0027] (2) Using restriction endonucleases NotⅠ and XhoⅠ to... OmpK The purified gene product and the expression vector pET-32a(+) were subjected to double enzyme digestion and gel extraction, respectively. OmpK The fragment and the linearized plasmid pET-32a were ligated together with DNA ligase and transformed into competent cells of Escherichia coli BL21 strain to obtain recombinant strain BL21 / pET-32a-OmpK. (3) The recombinant strain BL21 / pET-32a-OmpK was streaked overnight on LB solid agar medium (containing 100 μg / mL ampicillin). IPTG was added to a final concentration of 0.5 mmol / L, and the culture was induced at 37 ℃. The bacterial culture was collected 6 h after induction, lysed, and centrifuged to obtain the supernatant for Western blotting. The results are as follows: Figure 2 As shown, the recombinant fusion protein is approximately 49.71 kDa in size, which is consistent with the theoretical value.
[0028] III. Construction of Recombinant Bacillus subtilis (1) Synthesis OM The gene was further ligated into the pMD19-T vector, which was then transformed into E. coli competent cells DH5α to obtain the recombinant plasmid pMD19-T- OM .
[0029] (2) Using the genome of Vibrio parahaemolyticus standard strain ATCC17802 as a template, and OmpK-F2 / OmpK-R2 as primers, the gene encoded by the outer membrane protein OmpK was amplified to obtain the target gene. OmpK2 Purified OmpK2 The gene was ligated into the pMD19-T vector and transformed into E. coli competent cells DH5α to obtain the recombinant plasmid pMD19-T-OmpK2.
[0030] The above OmpK2 The sequences of the primers for gene sequence amplification are as follows: OmpK-F2 (SEQ ID No. 4):CCAAGCTTGCAGATTACTCTGACGGCGATAT HindIII OmpK-R2 (SEQ ID No. 5): CGAATTCGAACTTGTAAGTTACTGCGA EcoRI.
[0031] (3) The obtained recombinant plasmids pMD19-T-OmpK2 and pMD19-T- OM With recombinant integration plasmid pDG364- CotY After double digestion with HindIII and EcoRI, OmpK2 was recovered by gel electrophoresis. OM Fragment and pDG364- CotY Then, they are ligated using DNA ligase, and then ligated separately. OmpK2 Fragment and pDG364- CotY, OM Fragment and pDG364- CotY, The recombinant integrative plasmid pDG364- was obtained by transfecting it into E. coli DH5α. CotY-OmpK2With pDG364- CotY-OmpK2-Mel Its structure is as follows: Figure 3 As shown.
[0032] The double enzyme digestion system (10 μL) consisted of: 3 μL plasmid, 1 μL each of HindIII and EcoRI, 1 μL of 10×QuickCut Buffer, and DNase / RNase-Free H2O to a final volume of 10 μL. The reaction conditions were: 37℃ for 30 min.
[0033] The ligase ligation system consisted of: 4 μL of gel-recovered fragment, pDG364- CotY 1 μL of DNA Ligation Mix, 7.5 μL of DNA Ligation Mix, and 3 μL of ddH2O. Reaction conditions: 16°C overnight.
[0034] pDG364- CotY-OmpK2, pDG364- CotY - OM The results of the double enzyme digestion verification are as follows Figure 4 As shown.
[0035] IV. One-step preparation B. subtilis 168 strains of competent cells (1) Store glycerin B. subtilis 168 μL streak inoculated onto LB medium and cultured until visible colonies are formed.
[0036] (2) Transfer a single colony to 50 mL of TSB solution and incubate overnight at 37 °C with shaking at 160 r / min.
[0037] (3) Take 3 mL of culture medium, centrifuge to remove the supernatant, centrifuge at 8000g for 5 min at room temperature, suspend the precipitate in 20 mL of MB medium, and culture at 37 ℃ and 160 r / min for 2 h with shaking. The bacterial cells at this time become competent cells.
[0038] V. Recombinant pDG364- CotY - OM Conversion B. subtilis 168 competent cells (e.g.) Figure 5 (As shown) (1) For those carrying pDG364- CotY-OmpK2 With pDG364- CotY - OM of E. coli DH5α was cultured to scale up, and the integrative plasmid vector pDG364- was extracted using the SanPrep column-based DNA mini-extraction kit. CotY-OmpK2 With pDG364- CotY - OMThe plasmid fragments were digested with the restriction endonuclease Xba I at 37 °C for 15 min. Then, linearized plasmid fragments were recovered by agarose gel electrophoresis and gel recovery kit.
[0039] (2) In 1 ml B. subtilis Add 20 μL of linearized recombinant plasmid DNA fragment to 168 competent cells, mix gently, and incubate at 37 ℃ for 1 h. Add 2.5 mL of SC solution, centrifuge at room temperature (8000 g, 10 min) to remove supernatant; resuspend in 0.2 mL of SC solution, and spread 100 μL of the transformation product onto LB agar (containing 5 μg / mL chloramphenicol), and incubate at 37 ℃ for 16 h. Pick positive clones and inoculate them into LB liquid medium (containing 5 μg / mL chloramphenicol), and incubate at 37 ℃ and 160 rpm for 16 h.
[0040] (3) Combine positive transformants and B. subtilis Cultures of 168 competent cells were inoculated onto nutrient agar containing 1% soluble starch and incubated at 37 °C for 24 h. Iodine solution was then added to the plates for analysis of the amylase activity of the recombinant bacteria. The results are as follows: Figure 6 As shown.
[0041] (4) Expand the culture of the recombinant bacteria that have been correctly identified by amylase, extract bacterial DNA using a bacterial genomic DNA extraction kit, and use this DNA as a template. B. subtilis Using genome 168 as a control, PCR identification was performed using four primer pairs: amyE-F / amyE-R, amyE-F / OmpK-R2, OmpK-F2 / amyE-R, and OmpK-F2 / OmpK-R2. The PCR identification results are as follows: Figure 7 The above. OmpK2 The sequences of the primers for gene sequence amplification are as follows: OmpK-F2 (SEQ ID No. 4):CCAAGCTTGCAGATTACTCTGACGGCGATAT HindIII OmpK-R2 (SEQ ID No. 5): CGAATTCGAACTTGTAAGTTACTGCGA EcoRI.
[0042] amyE-F (SEQ ID No. 6):CCAATGAGGTTAAGAGTATTCC amyE-R (SEQ ID No.7):CGAGAAGCTATCACCGCCCAGC (5) The recombinant Bacillus subtilis was induced to form spores by the nutrient depletion method, the spores were purified, spore smears were prepared and observed by immunofluorescence microscopy. The primary antibody was mouse anti-OmpK positive serum (working concentration 1:200), and the secondary antibody was fluorescein Cy3-labeled goat anti-mouse IgG (working concentration 1:2000).
[0043] The specific operating steps are as follows: Take an appropriate amount of purified spore-forming solution onto a clean glass slide, dry it with hot air, and fix it to prepare a uniformly concentrated smear. Completely cover the spores with 3% BSA blocking solution, block at room temperature for 30 min, and wash 5 times with PBS. Incubate with mouse anti-OmpK positive serum (3% BSA 1:200 dilution) at room temperature for 1 h, then wash. Add Cy3-labeled goat anti-mouse IgG (1% BSA 1:2000 dilution), incubate at room temperature in the dark for 45 min, then wash. Observe and image under an immunomicroscope. The results are as follows: Figure 8 As shown.
[0044] The above experimental results prove that the recombinant plasmid pDG364- CotY - OmpK pDG364- CotY - OM Transfer to each B. subtilis Double cross-recombination successfully occurred in 168, and the genetically engineered bacteria were successfully constructed. These recombinant bacteria were named BO and BOM, respectively.
[0045] VI. Animal Experiments As shown in Table 1, 180 21-day-old female BALB / c mice (weighing 18.0 ± 2.0 g, purchased from Chengdu Dashuo Experimental Animal Co., Ltd.) were randomly divided into 5 groups (Table 2), with the CK group having n = 44 mice and the other groups having n = 34 mice per group. On days 0, 14, 28, and 42 of the experiment, serum and small intestinal contents were collected from 6 mice in each group. Blood was collected via the retroocular orbital venous plexus. The fresh blood was added to 2 mL sterile centrifuge tubes, incubated at 37 ℃ for 2 h, then at 4 ℃ overnight. Serum was collected by centrifugation (3000 r / min, 10 min, 4 ℃), aliquoted, and stored at -20 ℃. Mice were euthanized by cervical dislocation, and intestinal contents were collected into centrifuge tubes. Sterile, pre-cooled PBS (1:9) was added, and the mixture was thoroughly mixed by shaking. The supernatant was collected by centrifugation (4500 r / min, 10 min, 4 ℃), aliquoted, and stored at -20 ℃.
[0046] Table 1 Immunization Schedule
[0047] At 0, 14, 28, and 42 days of the experiment, six mice were randomly selected from each group. Blood was collected from the mice via the retroocular orbital venous plexus. The collected blood was placed in a 2 mL centrifuge tube, incubated at 37 °C for 1 h, then incubated at 4 °C overnight, and centrifuged at 4 °C, 3000 g for 10 min. Serum was collected into a new centrifuge tube, aliquoted into 20 μL per tube, and stored at -80 °C for later use. After blood collection, the mice were euthanized by dislocation, and the small intestine was aseptically dissected. The contents of the small intestine were collected, and 0.5 g of the contents were weighed into a centrifuge tube. 4.5 mL of pre-chilled PBS was added, and the mixture was thoroughly mixed. The mixture was centrifuged at 4 °C, 3000 g for 10 min, and the supernatant was collected into a new centrifuge tube, aliquoted into 50 μL per tube, and stored at -80 °C for later use.
[0048] At 42 days, 10 mice in each group were challenged with the virus. The remaining 10 mice in the CK group were not treated and served as a negative control group. The mice were fasted for 12 hours before the challenge experiment but allowed free access to water. Blood was collected 72 hours after the challenge to obtain serum for the detection of serum cytokines. The mice in each group were dissected and colon tissue with obvious lesions was collected from 1 cm from the cecum and 2 cm from the anus to ensure sampling consistency. The length of the colon tissue was measured and an appropriate portion was frozen at -80℃ for colon tissue barrier function detection and antioxidant enzyme activity detection.
[0049] (1) Indirect ELISA detection of the levels of anti-OmpK protein IgG and sIgA in mouse serum and intestinal mucosa Antibody levels were detected using an indirect ELISA method that detects antibodies against antigens. The specific steps are as follows: 1) Coating: 0.05 mol / L carbonate buffer (pH 9.6) was used as the coating dilution. The 96-well ELISA plate (Wuhan Saiwei Biotechnology Co., Ltd.) was coated with an appropriate concentration of purified OmpK protein. 100 µL was added to each well. After coating overnight at 4°C, the plate was washed 3 times with 200 µL of PBS for 5 min each time.
[0050] 2) Blocking: Add 150 µL of PBS blocking buffer containing 3% BSA to each well, and block at 37°C for 2 h. After blocking, discard the blocking buffer and wash three times with 200 µL of PBS washing buffer for 5 min each time.
[0051] 3) Primary antibody incubation: The prepared serum and small intestinal contents supernatant were pre-tested to select the optimal dilution. The serum and small intestinal contents supernatant before the test were used as negative controls. 100 µL of diluted serum and small intestinal contents supernatant were added to each well and incubated at 37°C for 1 h. The plate was washed 3 times with 200 µL of PBS for 5 min each time.
[0052] 4) Secondary antibody incubation: Add 100 µL of diluted horseradish peroxidase-labeled rabbit anti-mouse IgG (purchased from Santa Cruz Biotechnology, USA) or goat anti-mouse IgA to each well, incubate at 37°C for 45 min, wash 3 times with 200 µL of PBS for 5 min each time.
[0053] 5) Color development: Prepare the substrate color development solution according to the EL-TMB color development kit instructions. Add 100 µL to each well and develop the color at 37℃ in the dark for 15 min. Then add 50 µL of 2 mol / L H2SO4 stop solution to stop the reaction (purchased from Sangon Biotech (Shanghai) Co., Ltd.).
[0054] 6) OD value: The absorbance of each well was measured at 450 nm using a Thermo Multiskan FC microplate reader. Antibody levels are expressed as P / N values. P / N =Sample well OD 450nm / Negative pore OD 450nm .
[0055] Experimental results are as follows Figure 9 As shown, the detection of immunoglobulin levels in the small intestinal contents of mice revealed that the recombinant bacterial strain treatment group (BOM group) exhibited superior effects in inducing specific antibody production. Compared with the blank control group and the non-recombinant group... B. subtilis 168 groups, reorganized B. subtilis Compared with the BO and VP immunization groups, mice in the BOM group secreted higher levels of specific IgG and sIgA antibodies against the OmpK protein. Indirect enzyme-linked immunosorbent assay (ELISA) confirmed that this recombinant strain could elicit a significant humoral immune response, indicating its excellent antigen delivery and immune enhancement capabilities.
[0056] (2) Colonic tissue barrier function test Follow the instructions for the LPS, DAO, and D-LA test kits to determine the levels of each indicator in the serum.
[0057] Experimental results are as follows Figure 10 As shown, the levels of LPS, DAO, and D-LA in the serum of mice after challenge with Bacillus subtilis were detected. The results showed that the activities of LPS, DAO, and D-LA in the serum of mice in the BOM group after challenge were significantly lower than those in the mice not pre-fed with Bacillus subtilis. The differences between the two groups were statistically significant. P < 0.05 In summary, pre-feeding with recombinant Bacillus subtilis can reduce... VP Infection-induced damage to the colonic barrier in mice reduces the permeation of harmful intestinal metabolites LPS, DAO, and D-LA into the bloodstream.
[0058] (3) Enzyme-linked immunosorbent assay (ELISA) The levels of four cytokines—IL-1β, IL-6, TNF-α, and IL-10—in mouse serum were detected using an enzyme-linked immunosorbent assay (ELISA) kit (purchased from Shanghai Enzyme-Linked Biotechnology Center). The entire assay was performed according to the kit's instructions.
[0059] Test results as follows Figure 11 As shown, analysis of cytokine expression levels in mouse ileum tissue revealed that the concentrations of inflammatory factors IL-1β, IL-6, and TNF-α were significantly decreased in the BO group mice. The differences were statistically significant compared to the CKg group. P < 0.05 IL-10 is a typical Th2-type cytokine with strong anti-inflammatory effects. The results of this experiment showed that the concentration levels of IL-10 anti-inflammatory factors were significantly increased in the BOM group mice. Compared with the CKg group, the difference was statistically significant. P < 0.05 The results suggest that recombinant Bacillus subtilis BOM can effectively activate the host's cellular immune pathways, thereby reducing [the risk of infection] to some extent. VP Infection triggers an inflammatory response in the body.
[0060] (4) Colon tissue antioxidant enzyme activity test The activity of antioxidant enzymes in colon tissue was detected using a catalase (CAT), superoxide dismutase (SOD), and total antioxidant capacity (T-AOC) kit. Sample preparation and specific procedures were performed in accordance with the instructions.
[0061] Experimental results are as follows Figure 12 As shown, the detection of CAT, SOD, and T-AOC levels in mouse tissues revealed that the colonic CAT, SOD, and T-AOC levels in the challenge group were significantly lower than those in the pre-fed recombinant spore group (BOM group). p <0.05), indicating that pre-feeding recombinant spores (BOM group) can reduce VP Infection-induced inflammation alleviates oxidative stress caused by intestinal antioxidant system dysregulation.
[0062] In summary, this invention is the first to construct a recombinant Bacillus subtilis strain displaying OM protein on its spore surface and systematically evaluates its immunomodulatory effect in a mouse model. This invention aims to... B. subtilis Using 168 as the host and CotY, a spore capsid protein, as the anchoring protein, the fused protein was introduced via homologous double crossover recombination technology. CotY - OmpkThe gene was integrated into the host genome, ultimately yielding a recombinant strain stably inherited within Bacillus subtilis and stably expressing the OM protein on the spore surface, named BOM. Animal experiments showed that oral administration of this recombinant strain induced significant specific humoral and mucosal immune responses in vivo, specifically manifested as a significant increase in anti-Ompk protein-specific IgG and sIgA levels, suggesting its good antigen-presenting ability and immune adjuvant effect. Furthermore, serum LPS, DAO, and D-LA levels indicated that this recombinant strain effectively reduced intestinal damage caused by bacterial infection and decreased the leakage of harmful intestinal metabolites, further demonstrating that recombinant Bacillus subtilis has a protective effect on the intestinal barrier. Cytokine detection results showed that the expression levels of relevant inflammatory factors in the colon tissue of BOM-group mice were significantly downregulated, indicating that this strain not only induces humoral immunity but also inhibits the production of inflammatory factors and reduces the inflammatory response caused by infection. Further detection of antioxidant enzyme activity in the mouse colon showed that the recombinant strain could alleviate... VP The excessive inflammation caused by infection and the restoration of antioxidant enzyme activity improve the damage caused by pathogenic bacterial infection. Therefore, this recombinant Bacillus subtilis not only has significant advantages in antigen delivery and immune activation, but also has the potential and application value as a candidate vector for oral vaccines.
[0063] The recombinant Bacillus subtilis BOM constructed in this invention, as an oral subunit vaccine-type microecological immunomodulator, has the following advantages: (1) It can effectively induce the body to produce antibodies against Bacillus subtilis. VP (1) Specific immune response; (2) Oral administration is simple to operate, which can significantly simplify the traditional immunization procedure and comes with its own immune adjuvant, without the need for additional addition; (3) Avoid immune stress caused by injection; (4) It has good intestinal colonization ability and can form an effective immune barrier in the intestinal tract; (5) It helps to reduce the labor cost and management burden in the process of vaccine use; (6) The Bacillus subtilis used is an internationally recognized edible probiotic with a clear genetic background and non-invasiveness, which can be used to develop commercial vaccines; (7) The integrative recombinant plasmid used displays antigen protein on the surface of the spores, which can directly integrate the target gene into the spores. B. subtilis 168 The strain's genome is incorporated to ensure genetic stability, preventing loss during generation.
[0064] SEQ ID No.1 (OmpK-MeL): AAGCTTGCAGATTACTCTGACGGCGATATCCACAAAAACGATTACAAGTGGATGCAATTTAACCTAATGGGTGCATTCAACGAGAAAGGTTATGCTGAATCTTCTCATGATTACCTAGAGATGGAATTCGGCGGTCGCTCTGGTATTTTCGATCTTTACGGTTACGTTGACGTATTCAACCTAGCTTCTGACCCAGGCAGCGACAAAGCTGGCGGCGAGAAAATCTTCATGAAATTCGCACCACGTATGTCTCTAGACGCGCTAACTGGTAAAGACCTATCTTTCGGTCCTGTTCAAGAGCTATACGTTTCTACTCTAATGGAGTGGGGCGGTAACTCTGACGTTAACTCTCAAAAAATCGGTCTAGGTTCTGACGTGATGGTACCTTGGTTAGGCAAAATCGGCCTAAACCTATACGGTACTTACGATGGCAACAAGAAAGATTGGAACGGTTTCCAAGTTTCTACTAACTGGTTCAAACCATTCTTCTTCTTCGAGAACGGTTCATTCATTTCTTACCAAGGTTACATCGATTACCAATTCGGTATGGATGACGACAAAGGTAACAAGTTCAACACTACAGCGTCTAACGGCGGTGCAATGTTCAACGGTATCTACTGGCACTCTGACCGCTTTGCAGTTGGTTACGGTCTAAAACTTTACAAAGACGTGTACGGTTTCAAAGACGGCGAAGCTCTACCATGGGGTCACAAACCAGAATCTTCTGGTGCAGGTCACTACATCGCAGTAACTTACAAGTTCGACGACGACGACAAGGGAATTGGAGCAGTTCTGAAGGTATTAACCACAGGATTGCCCGCCCTCATAAGTTGGATTAAACGTAAGAGGCAACAGCATCATCATCATCATCATTAAGAATTC SEQ ID No.2(OmpK-F1): CGGCGGCCGGCAGATTACTCTGACGGCGATAT SEQ ID No.3(OmpK-R1): GGGCTCGAGGAACTTGTAAGTTACTGCGA SEQ ID No.4 (OmpK-F2): CCAAGCTTGCAGATTACTCTGACGGCGATAT SEQ ID No. 5 (OmpK-R2): CGAATTCGAACTTGTAAGTTACTGCGA SEQ ID No. 6 (amyE-F): CCAATGAGGTTAAGAGTATTCC SEQ ID No. 7 (amyE-R): CGAGAAGCTATCACCGCCCAGC Therefore, those skilled in the art will recognize that although embodiments of the present invention have been shown and described in detail herein, many other variations or modifications conforming to the principles of the present invention can be directly determined or derived from the disclosure of the present invention without departing from the spirit and scope of the invention. Therefore, the scope of the present invention should be understood and recognized as covering all such other variations or modifications.
Claims
1. A kind OM Genes, characterized by, The nucleotide sequence is shown as SEQ ID No.
1.
2. A recombinant plasmid, characterized in that, comprising the compound as claimed in claim 1 OM gene.
3. The recombinant plasmid as claimed in claim 2, wherein, The recombinant plasmid is obtained by ligating the gene into pMD19-T vector. OM The recombinant plasmid is obtained by ligating the gene into pMD19-T vector.
4. A spore surface-displayed Vibrio parahaemolyticus VPOmpK-MeL A recombinant Bacillus subtilis characterized in that, The recombinant Bacillus subtilis comprises the gene in claim 1 or the recombinant plasmid in claims 2-3.
5. A surface display of Vibrio parahaemolyticus as claimed in claim 4 VPOmpK-MeL The method for constructing a recombinant Bacillus subtilis is characterized by, The construction method is as follows: using the integration vector pDG364 to combine the spore cap protein CotY with... OM Genes are fused, and the resulting fused gene is... CotY-OM It was obtained by transferring it into Bacillus subtilis 168.
6. A surface display of Vibrio parahaemolyticus as claimed in claim 5. VPOmpK-MeL The method for constructing a recombinant Bacillus subtilis is characterized by, Specifically comprising the following steps: (1) Synthesis OM The gene was further ligated to pMD19-T vector, and the vector was transformed into E. coli competent cell DH5a to obtain recombinant plasmid pMD19-T- OM ; (2) The obtained recombinant plasmid pMD19-T- OM and the recombinant integration plasmid pDG364- CotY After double enzyme digestion of Hind III and EcoRI, the gel was recovered OM The fragment was ligated with pDG364- CotY by DNA ligase, and the recombinant integration plasmid pDG364- CotY-OM was obtained by transforming E. coli DH5α. (3) The recombinant integration plasmid pDG364- CotY - OM By homologous double cross-over B.subtilis 168 In the competent cells, by screening to obtain the recombinant Bacillus subtilis displaying OM antigen protein on the spore surface.
7. A spore surface-displayed Vibrio parahaemolyticus VPOmpK-MeL A recombinant Bacillus subtilis characterized in that, The recombinant Bacillus subtilis is constructed by the method in any one of claims 5-6.
8. The method of claim 1 OM the recombinant plasmid of claim 2 or 3, the recombinant B. subtilis of claim 4 or 7 VPOmpK-MeL the recombinant B. subtilis and the construction method of claim 5 or 6 for preparing a biological product against Vibrio parahaemolyticus infection.
9. The method of claim 1 OM the gene of claim 2 or 3, the recombinant plasmid of claim 4 or 7, the recombinant B. subtilis of claim 5 or 6 VPOmpK-MeL the recombinant B. subtilis and the construction method of claim 5 or 6 for use in the preparation of a vaccine against V. parahaemolyticus.
10. The composition of claim 1 OM the recombinant plasmid of claim 2 or 3, the recombinant B. subtilis of claim 4 or 7 VPOmpK-MeL the recombinant B. subtilis and the construction method of claim 5 or 6 for preparing oral vaccine and microecological immunization vaccine against Vibrio parahaemolyticus infection.