Method for improving biosynthesis efficiency of epichlorohydrin

Abstract

The invention discloses a method for improving the biosynthesis efficiency of epichlorohydrin, which utilizes immobilized halohydrin dehalogenase to catalytically synthesize epichlorohydrin, and utilizes modified strong base anion exchange resin to adsorb chloride ions generated in the catalytic synthesis of epichlorohydrin, thereby solving the problem of reaction balance caused by chloride ion accumulation and improving the biosynthesis efficiency of epichlorohydrin. The synthesis efficiency of a target product is improved.

Description

(I) Technical Field

[0002] This invention belongs to the field of biocatalytic transformation, specifically relating to a method for improving the biosynthesis efficiency of epichlorohydrin. (II) Background Technology

[0004] Epichlorohydrin (ECH) is an important three-carbon compound with a simple structure and a reactive three-membered oxygen ring, frequently used as an intermediate in further synthesis. In recent years, ECH enantiomers have found wide application in the chiral pharmaceutical and fine chemical industries, serving as key intermediates in the preparation of atorvastatin, pheromones, L-carnitine, β-adrenergic receptor blockers, and trehalose-inhibiting agents.

[0005] Halohydrin dehalogenases (EC4.5.1.X, HHDH), also known as halohydrin epoxide enzymes or halogen lyases, belong to the short-chain dehydrogenase / reductase family. They catalyze the dehalogenation of adjacent halohydrins, forming epoxides and releasing halides. Simultaneously, they can catalyze ring-opening of epoxides under the mediation of nucleophiles, achieving interconversion between epoxides and halohydrins. Unlike traditional chemical hydrolysis kinetics, the asymmetric catalysis of halohydrin dehalogenases to synthesize optically pure ECH in one step from 1,3-dichloropropanol (1,3-DCP) offers advantages such as high theoretical yield, low cost, low pollution, and environmental friendliness, making it an important method for the current biological synthesis of ECH. However, due to the reactivity of the substrate and product, the reaction system must be carried out in a water-organic solvent system. Organic solvents can affect the stability of the enzyme and generate chloride ions during the catalytic reaction of 1,3-DCP. If these chloride ions cannot be removed in time, the reverse reaction will be aggravated, the catalytic efficiency will be reduced, and the yield will be low even at high substrate concentrations, which limits its industrial application.

[0006] Therefore, the present invention provides a method for developing an immobilized enzyme and using a modified anion exchange resin to adsorb chloride ions generated during the reaction, thereby shifting the chemical equilibrium towards the forward reaction and improving the stability of the enzyme and the yield of the target product in the presence of organic solvents. This method is of great significance. (III) Summary of the Invention

[0008] The purpose of this invention is to provide a method to improve the biosynthesis efficiency of epichlorohydrin. This method utilizes an immobilized halohydrin dehalogenase to catalyze the synthesis of epichlorohydrin, while simultaneously using a modified strong-base anion exchange resin to adsorb chloride ions generated during the catalytic synthesis of epichlorohydrin. This solves the reaction equilibrium problem caused by chloride ion accumulation and improves the synthesis efficiency of the target product.

[0009] The technical solution adopted in this invention is:

[0010] This invention provides a method for improving the biosynthesis efficiency of epichlorohydrin, the method comprising the following steps: (1) adding anion exchange resin to a pH 8.0-11.0 buffer solution, stirring at 25-35°C (preferably at 30°C for 8 h) to form a uniform suspension, filtering, drying the filter cake (preferably at 60°C), washing with deionized water until the washing solution is neutral, and obtaining a pretreated resin; adding the pretreated resin to an ethanol aqueous solution, adding a silane coupling agent under magnetic stirring, heating at 50-70°C for 3-5 h (preferably at 60°C for 2 h), adding graphene oxide, ultrasonically mixing, and then sequentially adding propylene monomers, crosslinking agents, and initiators, heating at 50-70°C for 3-5 h (preferably at 50°C for 3 h). h), freeze-dry (preferably -10℃) to obtain modified resin; (2) use immobilized halohydrin dehalogenase as catalyst, 1,3-dichloropropanol as substrate, add the modified resin of step (1), and use water-organic solvent biphase system as reaction medium to form a reaction system. The reaction is carried out at 300-700 rpm (preferably 600 rpm) and 30℃. After the reaction is completed, a reaction solution containing epichlorohydrin is obtained. The reaction solution is separated and purified to obtain epichlorohydrin. The water-organic solvent biphase system is composed of isobutyl acetate and pH8.0-11.0 buffer solution with a volume ratio of 1:1.

[0011] The reaction formula for the synthesis of epichlorohydrin catalyzed by halohydrin dehalogenase:

[0012]

[0013] Further, in step (1), the anion exchange resin is a strongly basic anion exchange resin, including macroporous adsorption resin or ion exchange resin. The macroporous adsorption resin includes models such as XAD761, HPD750, and H103; the ion exchange resin includes models such as IRA400 and A26-OH; preferably, the strongly basic anion exchange resin IRA400 has a potency in the two-phase system that is approximately 1 g of resin adsorbs 1-10 mM Cl. - .

[0014] Further, in step (1), the volume of buffer solution used is 5-20 mL / g (preferably 10 mL / g) based on the mass of the anion exchange resin; the buffer solution is preferably a 0.2-2 M buffer solution with pH 8-11, more preferably a 1 M sodium carbonate / sodium bicarbonate buffer solution (i.e., carbonate buffer solution) with pH 10.5.

[0015] Further, in step (1), the silane coupling agent comprises aminosilane and double-bonded silane, preferably a mixture of 3-aminopropyltrimethoxysilane and vinyltrimethoxysilane in a molar ratio of 1:0.5-2 (more preferably 1:1); the propylene monomer is a mixture of acrylic acid and acrylamide in a mass ratio of 100:10-50 (preferably 100:40); the crosslinking agent is N,N-methylenebisacrylamide; and the initiator is one of ammonium persulfate, potassium persulfate, or sodium persulfate.

[0016] Further, in step (1), the volume concentration of the ethanol aqueous solution is 10-50% (preferably 10%), and the volume dosage is 5-50 mL / g (preferably 50 mL / g) based on the mass of the anion exchange resin; the mass ratio of the silane coupling agent added to the anion exchange resin is 0.1-1:1 (preferably 0.8:1); the mass ratios of propylene monomers to graphene oxide, anion exchange resin, crosslinking agent, and initiator are 100:1.5-3 (preferably 100:2.5), 100:0.1-1.5 (preferably 100:1), 100:0.3-1.5 (preferably 100:1.5), and 100:0.4-0.8 (preferably 100:0.8), respectively.

[0017] Further, step (1) ultrasonic mixing is performed at 100-200 W for 0.5-1 h (preferably 200 W for 0.6 h).

[0018] Furthermore, in the reaction system of step (2), the amount of catalyst added is 2-20 g / L (preferably 10 g / L); the amount of substrate added is 0.1-2 M (preferably 500 mM); and the amount of modified resin added is 160-640 g / L (preferably 160 g / L).

[0019] Furthermore, step (2) involves immobilizing halohydrin dehalogenase using carrageenan as a carrier, halohydrin dehalogenase solution as the active ingredient, and 0.5-3% KCl aqueous solution (preferably 1.5%) as a curing agent.

[0020] Further, the immobilized halohydrin dehalogenase is prepared according to the following steps: Carrageenan is added to deionized water and heated to 70 °C. After the solution becomes transparent and easily flowable, it is cooled to 42 °C, the enzyme solution of halohydrin dehalogenase is added, and the mixture is thoroughly mixed. The mixture is poured into a plate and left to stand overnight at 4 °C. A hardening agent is added, and the mixture is soaked and hardened at 4 °C for 1 h. Then, the mixture is cut into pieces and washed with deionized water until no enzyme activity is present in the filtrate, thus obtaining the immobilized enzyme. The mass concentration of carrageenan added to deionized water is 0.7-3.2% (preferably 1.7%). The protein concentration of the enzyme solution of halohydrin dehalogenase is 0.5-1.5 mg / mL (preferably 1.1 mg / mL), and the amount added is 50-400 μL / g (preferably 385 μL / g) based on the mass of carrageenan.

[0021] Further, the enzyme solution of the halohydrin dehalogenase is prepared according to the following steps: the engineered halohydrin dehalogenase bacteria are inoculated into LB medium containing 50 μg / mL kanamycin and cultured at 37 ℃ for 12 h to obtain the seed culture; then the seed culture is inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin at a volume concentration of 2% and cultured at 37 ℃ until the bacterial cell concentration reaches OD. 600 The concentration was increased to 0.6-0.8. Then, 0.1 mM isopropyl-β-D-thiopyranoside was added to the culture medium, and the cells were induced and cultured at 28℃ for 12 h. After centrifugation at 4℃ and 12000 rpm for 10 min, the wet cells were collected, dissolved in deionized water, and then resuspended with thorough stirring. The cells were then sonicated in an ice-water bath at 300 W for 1 s, followed by a 2 s pause, for a total disruption time of 5 min. After cell disruption, the cell disruption solution was centrifuged at 8000 rpm and 4℃ for 10 min. The supernatant was collected and filtered sterilized using a sterile filter to obtain a crude enzyme solution, which was then stored on ice for later use. First, the protein purification instrument tubing was rinsed with ultrapure water to remove air bubbles. The Ni-NTA column was then connected to the protein purification instrument at a flow rate of 2.0. Rinse the Ni-NTA column at a flow rate of 1.0 mL / min until conductivity and voltage reach equilibrium. Replace the ultrapure water with the prepared binding buffer and rinse the column until conductivity and voltage reach equilibrium. After the Ni-NTA column reaches equilibrium, adjust the flow rate to 1.0 mL / min and load the crude enzyme solution. Stop loading when the breakthrough peak reaches its maximum value. The loading volume is approximately 10 mL. Rinse again with the equilibration buffer to remove impurities and unadsorbed target proteins until conductivity and voltage re-equilibrate. Finally, elute the protein with the elution buffer. When the system shows an elution peak, collect the eluent flowing out of the tubing. Clean the Ni-NTA column with ultrapure water and 20% ethanol. Remove the Ni-NTA column and store it at 4 °C for future use. Transfer the collected eluent to a dialysis bag and dialyze it in 1 M, pH 10.5 carbonate buffer. The dialysis process should be performed in an ice bath for 2-3 hours. The solution was then replaced with fresh buffer and dialyzed overnight. The retentate obtained after dialyzing was the enzyme solution. LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, solvent: deionized water, pH 8.0; equilibration buffer: pH 8.0, 200 mM PB buffer, prepared by weighing 71.64 g Na2HPO4·12H2O and 31.20 g Na Dissolve PO4·2H2O in distilled water, adjust the pH to 8.0, and add distilled water to a final volume of 1L. Prepare the binding buffer: Weigh 17.6 g NaCl, 7.8 g Na... PO4·2H2O, 3.4 g imidazole, dissolved in a certain amount of deionized water, then adjusted to pH 8.0 and the solution was brought to a final volume of 1 L; Elution buffer preparation: Weigh 17.6 g NaCl, 7.8 g Na PO4·2H2O, 34 g imidazole, were dissolved in a certain amount of deionized water, and then the pH was adjusted to 8.0 and the solution was brought to a final volume of 1 L.

[0022] Furthermore, the halohydrin dehalogenase engineered bacteria were obtained by ligating the gene sequence shown in SEQ ID NO.2 to plasmid pET-28b after TATACCAT (NcoI) and before CTCGAG (XhoI restriction site), transforming it into Escherichia coli BL21(DE3) competent cells, and then screening on LB solid medium containing kanamycin (Kana) resistance.

[0023] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0024] (1) The present invention uses carrageenan to immobilize enzymes, which has good hydrophobicity and good swelling capacity in alkaline environment. It is not only simple to operate and low in cost, but also reduces the influence of organic solvents on enzyme activity and ensures mass transfer efficiency.

[0025] (2) The modified strong base anion exchange resin prepared in this invention has improved mechanical properties and further introduced a porous structure to improve adsorption performance, while reducing the resin alkalinity without affecting the ion exchange efficiency. Using the modified resin for dechlorination also replenishes the system with hydroxide ions to neutralize the hydrogen ions generated in the reaction, maintaining a suitable pH in the system. This results in a 50%~70% increase in yield under high concentrations of 1,3-DCP catalyzed by halohydrin dehalogenase.

[0026] (3) The modified resin of the present invention has simple preparation steps and regeneration operation, and has the characteristics of high recycling rate, low processing cost and environmental friendliness, which is conducive to realizing industrial production. (iv) Description of the attached drawings

[0028] Figure 1 This is a comparison of the relative enzyme activities of immobilized halohydrin dehalogenases at different carrageenan concentrations.

[0029] Figure 2 This is a comparison of the relative enzyme activities of carrageenan-immobilized halohydrin dehalogenases under different KCl concentrations.

[0030] Figure 3 This is a comparison of the loading rates of halohydrin dehalogenases immobilized on carrageenan under different concentrations of KCl.

[0031] Figure 4 This is a schematic diagram comparing the chloride ion adsorption rates of different resins. (V) Detailed Implementation Methods

[0033] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0034] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, solvent: deionized water, pH 8.0. LB plates are prepared by adding 20 g / L agar to LB liquid medium. Unless otherwise specified, all aqueous solutions described in these embodiments are prepared using deionized water.

[0035] SEQ ID NO.2:

[0036] atggcttcta ccgctattgt gactaacgta aagcatttcg gtggcatgggctctgcgctg

[0037] cgtctgtctg aagctggtca cactgttgct tgccatgacg aaagcttcaaacagaaagat

[0038] gaactggaag ctttcgcgga aacttatcct cagctgaaac cgatgtctgaacaggaaccg

[0039] gctgaactga ttgaagctgt gacctctgcc tacggccaag ttgacgtcctggtgtccaac

[0040] gatattttcg cgccggaatt ccagccgatc gataaatatg ctgtggaagattaccgtggt

[0041] gctgtcgaag ctctgcagat ccgcccattt gcactggtta acgcggtggcttcccagatg

[0042] aagaaacgta aatctggcca catcatcttc attacctctg caactccattcgcaccgtgg

[0043] aaagaactgt ccacttatac ttccgcccgt gctggcgctt gcactctggcaaacgcgctg

[0044] tccaaagagc tgggcgaata caacattccg gttttcgcga tcggttcgaactacctgcac

[0045] tctgaagaca gcccgtactt ctacccgacc gaaccgtgga aaactaacccggaacacgtg

[0046] gcgcacgtaa aaaaggttac cgcactgcag cgtctgggta cccaaaaagaactgggcgaa

[0047] ctggttgcgt tcctggcatc tggttcctgt gattacctga ccggtcaagtcttttggctg

[0048] gcaggtggct tcccgatgat cgaacgtccg ccgggtatgc cggaactcga gtga

[0049] Example 1: Construction, induction, expression, isolation, and purification of engineered bacteria for halohydrin dehalogenase

[0050] 1. Construction of engineered bacteria for halohydrin dehalogenase

[0051] The halohydrin dehalogenase gene HheC (ID: 1ZO8) from Agrobacterium radiobacterstrain AD1 in GenBank was synthesized in its entirety (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.2). It was ligated to the plasmid pET-28b after TATACCAT (NcoI) and before CTCGAG (XhoI restriction site), and transformed into Escherichia coli BL21(DE3) competent cells. The cells were plated on LB plates containing kanamycin (50 μg / mL), incubated overnight at 37°C, and positive transformants were picked, identified, and sequenced.

[0052] 2. Culture, induction of expression, and isolation and purification of halohydrin dehalogenases

[0053] The engineered halohydrin dehalogenase bacteria were inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37 ℃ for 12 h to obtain seed culture. The seed culture was then inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin at a volume concentration of 1% and cultured at 37 ℃ until the bacterial cell concentration OD600 reached 0.6~0.8. Isopropyl-β-D-thiopyranogalactopyranoside (IPTG) was added to the culture medium to a final concentration of 0.1 mM and induced culture at 28 ℃ for 12 h. The wet cells were collected by centrifugation at 4 ℃ and 12000 rpm for 10 min.

[0054] The wet bacterial cells were added to deionized water and thoroughly stirred to resuspend the cells. The cells were then subjected to ultrasonic disruption in an ice-water bath to release the target protein from the cells. The specific procedure was as follows: disruption power was 300 W, with a 1-second operation followed by a 2-second pause, for a total disruption time of 5 minutes. After cell disruption, the cell disruption solution was transferred to a 50 mL centrifuge tube and centrifuged at 8000 rpm and 4 °C for 10 minutes. The supernatant was collected and filtered through a sterile filter to obtain a crude enzyme solution, which was then stored on ice for later use.

[0055] First, rinse the tubing of the protein purification instrument (GE AKTA, model PURE) with ultrapure water to remove air bubbles. Connect the Ni-NTA column to the protein purification instrument and rinse with ultrapure water at a flow rate of 2.0 mL / min until conductivity and voltage are balanced. Replace the ultrapure water with the prepared binding buffer and rinse the Ni-NTA column until conductivity and voltage are balanced. After the Ni-NTA column is balanced, adjust the flow rate to 1.0 mL / min and load the crude enzyme solution. Stop loading after the breakthrough peak reaches its maximum value. The loading volume is approximately 10 mL. Rinse again with equilibration buffer to remove impurities and unadsorbed target proteins until conductivity and voltage are re-equilibrated. Finally, elute the protein with elution buffer. When the system shows an elution peak, collect the eluent flowing out of the tubing. Clean the Ni-NTA column with ultrapure water and 20% ethanol. Remove the Ni-NTA column and store it at 4 ℃ for future use. The collected eluent was placed in a dialysis bag (molecular weight cutoff 10 kD) and dialyzed in binding buffer. The entire dialysis process was carried out in an ice bath. After 2-3 hours, the buffer was replaced and dialyzed overnight. The resulting solution was the purified halohydrin dehalogenase. The protein concentration was measured to be 1.1 mg / mL using a BCA kit and microplate reader. The solution was stored at -80°C for subsequent experiments.

[0056] The equilibration buffer is a pH 8.0, 200 mM PB buffer, prepared by weighing 71.64 g of Na₂HPO₄·12H₂O and 31.20 g of Na Dissolve PO4·2H2O in distilled water, adjust the pH to 8.0, and add distilled water to a final volume of 1L. Prepare the binding buffer: Weigh 17.6 g NaCl, 7.8 g Na... Dissolve 3.4 g imidazole in PO4·2H2O and a certain amount of deionized water, then adjust the pH to 8.0 and bring the solution to a final volume of 1 L; prepare the elution buffer by weighing 17.6 g NaCl and 7.8 g Na PO4·2H2O, 34 g imidazole, were dissolved in a certain amount of deionized water, and then the pH was adjusted to 8.0 and the solution was brought to a final volume of 1 L.

[0057] Example 2: Preparation and Condition Optimization of Immobilized Enzymes

[0058] 1. Preparation of immobilized enzymes

[0059] Add 0.52 g of carrageenan to 30 mL of deionized water (carrageenan concentration 1.7%), heat to 70 °C, and after the solution becomes transparent and easily flowable, cool to 42 °C. Add 200 μL of the halohydrin dehalogenase pure enzyme solution prepared by the method in Example 1 (protein concentration 1.1 mg / mL), mix thoroughly, pour into a plate, and incubate overnight at 4 °C. Then, soak in a 1.5% KCl (hardening agent) aqueous solution at 4 °C for 1 h to harden. Remove the gel block and cut it into 5 mm × 5 mm pieces. Wash with deionized water until no enzyme activity is present in the filtrate to obtain the immobilized enzyme. Determine the protein content of the solution after removing the gel block using a BCA kit, and calculate the protein loading rate according to the formula.

[0060] Protein loading rate = Mm / M × 100%

[0061] In the formula: M represents the amount of enzyme added; m is the amount of enzyme in the solution.

[0062] 2. Enzyme activity detection

[0063] Enzyme activity detection standard conditions: In a two-phase system of 20 mL isobutyl acetate and pH 10.5, 1M Na₂CO₃ / NaHCO₃ buffer at a volume ratio of 1:1, 100 mM 1,3-DCP and 23 g of immobilized enzyme were added to a final concentration, and the mixture was reacted in a 30°C water bath for 3 min. After centrifugation at 12000 rpm for 1 min, the supernatant was collected, and anhydrous Na₂SO₄ was added for dehydration treatment. The peak area of ​​ECH was detected by GC as described in Example 5. The ECH content in the sample was calculated based on the standard curve of ECH standard concentration versus peak area detected under the same conditions.

[0064] Under the same conditions, the immobilized enzyme was replaced with 200 μL of pure enzyme solution prepared in Example 1, and the enzyme activity was detected, which is the free enzyme activity.

[0065] Enzyme activity definition: Under standard enzyme activity detection conditions, the amount of enzyme consumed to produce 1 μmol of ECH per minute is defined as one enzyme activity unit.

[0066] Enzyme activity recovery rate = U1 / U2 × 100%

[0067] In the formula: U1 represents the activity of the immobilized enzyme; U2 represents the activity of the free enzyme.

[0068] 3. Effect of carrageenan concentration on the activity of immobilized enzymes

[0069] In step 1, the carrageenan concentrations were set to 0.7%, 1.2%, 1.7%, 2.2%, 2.7%, and 3.2%, respectively, with other operations remaining the same, to prepare immobilized enzymes with different carrageenan concentrations. Enzyme activity was detected using the method in step 2. The relative enzyme activity of the immobilized enzymes prepared with different carrageenan concentrations was calculated with the highest enzyme activity under the test conditions as 100%. The results are shown in [Figure 1]. Figure 1 .Depend on Figure 1 Analysis shows that the immobilized halohydrin dehalogenase exhibits the highest enzyme activity and the best immobilization effect when the carrageenan concentration is 1.7%.

[0070] 4. Effect of hardener concentration on immobilized enzyme activity

[0071] The concentrations of the hardener in step 1 were set to 0.5%, 1%, 1.5%, 2%, 2.5%, and 3%, respectively, with other operations remaining the same, to prepare immobilized enzymes. Enzyme activity was detected using the method in step 2. The relative enzyme activity of the immobilized enzymes prepared with different hardener concentrations was calculated with the highest enzyme activity under the test conditions as 100%. The results are shown in [Figure 1]. Figure 2 The protein loading rate was also detected using the method in step 1, and the results are shown below. Figure 3 As shown.

[0072] Figure 2 , Figure 3 The results show that the immobilized enzyme obtained by curing with 1.5% KCl exhibits the highest enzyme activity, and the loading rate of haloalcohol dehalogenase reaches the highest under the condition of 1.5% KCl concentration as the concentration increases. Considering both enzyme activity and loading rate, 1.5% KCl is determined to be the optimal curing condition for the immobilization process.

[0073] Example 3: Screening of chlorine-removing resins

[0074] Five macroporous adsorption resins and five anion exchange resins were selected respectively. The basic information of each resin is shown in Table 1 below.

[0075] Table 1. Information on dechlorination resins

[0076]

[0077] Add 30 mL of NaCl aqueous solution with a chloride ion concentration of 1000 mg / L to the reaction flask, then add 1 g of each of the resins listed in Table 1 sequentially. Initiate the reaction at 30℃ and 600 rpm. The residual chloride ion concentration in each reaction flask was measured using a chloride meter (manufacturer: Shanghai Haiheng, model YL-2AZ) at 10 min, 30 min, and 60 min to calculate the adsorption rate. The results are shown in the table below. Figure 4 .

[0078] Anion exchange resins IRA400, A26-10, and XDA761 all exhibited chloride ion adsorption rates exceeding 50% after 60 minutes. IRA400 demonstrated the best chloride removal performance, reaching 85.3% at 10 minutes and continuing to rise to nearly 100%. Therefore, the strongly basic anion exchange resin IRA400 (Rohm and Haas, with a resin potency equivalent to approximately 1.12 mM Cl based on the two-phase system) was selected. - (This is used for subsequent experiments.)

[0079] Example 4: Preparation of modified resin 1

[0080] 1. Modified resin 1

[0081] 1 g of strong base anion exchange resin IRA400 was added to 5 mL of 1 M, pH 10.5 carbonate buffer solution. After stirring at 30 °C for 8 h, the solution was filtered, dried at 60 °C, and washed with deionized water until the washing solution was neutral. Then, 50 mL of 10% (v / v) ethanol aqueous solution was added. Under magnetic stirring at 300 rpm, 0.8 g of coupling agent (a mixture of 3-aminopropyltrimethoxysilane and vinyltrimethoxysilane in a molar ratio of 1:1) was added, and the mixture was heated in a water bath at 60 °C for 2 h. Then, 2.5 g of graphene oxide was added, and the mixture was ultrasonically mixed at 200 W for 0.6 h. 100 g of propylene monomer (a mixture of acrylic acid and acrylamide in a mass ratio of 100:40), 1.5 g of N,N-methylenebispropylene, and 0.8 g of initiator (ammonium persulfate) were added sequentially and stirred until homogeneous. After reacting at 50 °C for 3 h, the mixture was freeze-dried at -10 °C to obtain 1.2 g of modified resin, which was designated as modified resin 1.

[0082] 2. Modified resin 2

[0083] Change the volume of the 1 M, pH 10.5 carbonate buffer solution in step 1 to 10 mL, and keep all other operations the same to obtain modified resin 2.

[0084] 3. Modified resin 3

[0085] Change the volume of the 1 M, pH 10.5 carbonate buffer solution in step 1 to 15 mL, and keep all other operations the same to obtain modified resin 3.

[0086] 4. Modified resin 4

[0087] Change the volume of the 1M, pH 10.5 carbonate buffer solution in step 1 to 20mL, and keep all other operations the same to obtain modified resin 4.

[0088] Example 5: Effect of modified resin on the yield of ECH synthesized by halohydrin dehalogenase

[0089] In an alkaline aqueous reaction system, the substrate 1,3-DCP is prone to self-cyclization to generate racemic products, while the product ECH is prone to degradation. Considering industrial production applications, an aqueous-organic two-phase system was used as the reaction medium to alleviate both of these problems.

[0090] 1. Modified resin 1

[0091] The final concentration composition of the 20 mL reaction system was as follows: 500 mM substrate 1,3-DCP, 10 g / L immobilized enzyme prepared by the method in Example 2, 3.2 g modified resin prepared by the method in Example 3, and a 1:1 volume mixture of 1 M, pH 10.5 carbonate buffer, and isobutyl acetate as the reaction medium. The reaction was carried out at 30 °C and 600 rpm for 90 min. 800 μL of the reaction solution was centrifuged at 12000 rpm for 1 min. The organic phase was dried over anhydrous sodium sulfate, and the peak area of ​​the epichlorohydrin product and the peak area of ​​the residual substrate 1,3-DCP were detected by gas chromatography. The product yield and substrate consumption were calculated using the standard curves of the product and substrate, and the yield was calculated.

[0092] GC detection conditions: An Agilent GC-8890A system was used, with a BGB-175 capillary column, nitrogen as the carrier gas, and a flow rate of 14 mL / min. Chromatographic conditions: column temperature 90 ℃, injection chamber temperature 220 ℃, and FID detector 220 ℃. The elution time of the substrate 1,3-DCP was approximately 12.3 min, and the elution time of the product ECH was approximately 4.8 min.

[0093] Under the same conditions, modified resin 1 was replaced with 3.2g of strong base anion exchange resin IRA400 without resin as the unmodified resin control. The results are shown in Table 2. The modified resin can significantly improve the product yield from 31.2% to 83.6%.

[0094] Table 2: Comparison of yields of ECH synthesized by halohydrin dehalogenases

[0095]

[0096] 2. Modified resin 2

[0097] The modified resin 1 in step 1 was replaced with an equal amount of the modified resin 2 prepared by the method in Example 3, and the other operations were the same. The results are shown in Table 3.

[0098] Table 3: Comparison of yields of ECH synthesized by halohydrin dehalogenases

[0099]

[0100] 3. Modified resin 3

[0101] The modified resin 1 in step 1 was replaced with an equal amount of the modified resin 3 prepared by the method in Example 3, and the other operations were the same. The results are shown in Table 4.

[0102] Table 4: Comparison of yields of ECH synthesized by halohydrin dehalogenases

[0103]

[0104] 4. Modified resin 4

[0105] The modified resin 1 in step 1 was replaced with an equal amount of the modified resin 4 prepared by the method in Example 3, and the other operations were the same. The results are shown in Table 5.

[0106] Table 5: Comparison of yields of ECH synthesized by halohydrin dehalogenases

[0107]

[0108] Example 6: Effects of substrate concentration and resin type on the yield of ECH synthesized by halohydrin dehalogenase

[0109] 1. The final concentration composition of the 20 mL reaction system was as follows: 1 M substrate 1,3-DCP, 6.4 g of the modified resin prepared by the method in Example 3, 10 g / L immobilized enzyme prepared by the method in Example 2, and 1 M, pH 10.5 carbonate buffer and isobutyl acetate mixed in a 1:1 volume ratio to form a 20 mL reaction system. The reaction was carried out at 30 °C and 600 rpm for 90 min. 800 μL of the reaction solution was centrifuged at 12000 rpm for 1 min, and the supernatant was collected and analyzed using the method in Example 5.

[0110] Under the same conditions, modified resin 1 was replaced with 6.4g of strong base anion exchange resin IRA400 without resin addition, and the results are shown in Table 6.

[0111] Table 6: Comparison of yields of ECH synthesized by halohydrin dehalogenases

[0112]

[0113] 2. The final concentration composition of the 20 mL reaction system was as follows: 1 M substrate 1,3-DCP, 6.4 g of modified resin 2 prepared by the method in Example 3, 10 g / L immobilized enzyme prepared by the method in Example 2, and a 20 mL reaction system consisting of a 1 M, pH 10.5 carbonate buffer and isobutyl acetate mixture at a volume ratio of 1:1. The reaction was carried out at 30 °C and 600 rpm for 90 min. 800 μL of the reaction solution was centrifuged at 12000 rpm for 1 min, and the supernatant was collected and analyzed using the method in Example 5. Under the same conditions, modified resin 2 was replaced with 6.4 g of strong base anion exchange resin IRA400 without added resin; the results are shown in Table 7.

[0114] Table 7: Comparison of yields of ECH synthesized by halohydrin dehalogenases

[0115]

[0116] 3. The final concentration composition of the 20 mL reaction system was as follows: 2 M of substrate 1,3-DCP, 12.8 g of modified resin 2 prepared by the method in Example 3, 10 g / L of immobilized enzyme prepared by the method in Example 2, and a 20 mL reaction system consisting of a 1 M, pH 10.5 carbonate buffer and isobutyl acetate mixture at a volume ratio of 1:1. The reaction was carried out at 30 °C and 600 rpm for 90 min. 800 μL of the reaction solution was centrifuged at 12000 rpm for 1 min, and the supernatant was collected and analyzed using the method in Example 5. Under the same conditions, modified resin 2 was replaced with 12.8 g of strong base anion exchange resin IRA400 without added resin; the results are shown in Table 8.

[0117] Table 8: Comparison of yields of ECH synthesized by halohydrin dehalogenases

[0118]

[0119] Ultimately, with a substrate concentration of 500 mM, modified resin 2 was the optimal choice.

[0120] This invention is not limited to the specific textual description above. Various modifications can be made to this invention within the scope outlined in the claims, and all such modifications are within the scope of this invention.

Claims

1. A method of improving the biosynthetic efficiency of epichlorohydrin, characterized in that, The method comprises the following steps: (1) adding anion exchange resin into a pH 8.0-11.0 buffer solution, stirring to form a uniform suspension at 25-35°C, filtering, drying the filter cake, and washing with deionized water until the washing liquid is neutral to obtain a pretreated resin; The pretreated resin is added into an ethanol aqueous solution, and under magnetic stirring, a silane coupling agent is added, and after heating at 50-70°C for 3-5 h, graphene oxide is added, and after ultrasonic mixing, a propylene monomer, a crosslinking agent, and an initiator are sequentially added, and after heating at 50-70°C for 3-5 h, freeze-drying is performed to obtain a modified resin; (2) using immobilized halohydrin dehalogenase as a catalyst, 1,3-dichloropropanol as a substrate, and the modified resin of step (1), a water-organic solvent two-phase system as a reaction medium to form a reaction system, and under the conditions of 300-700 rpm and 30°C, the reaction is carried out, and after the reaction is completed, an epichlorohydrin-containing reaction liquid is obtained, and the reaction liquid is separated and purified to obtain epichlorohydrin; the water-organic solvent two-phase system is composed of isobutyl acetate and a pH 8.0-11.0 buffer solution in a volume ratio of 1:

1.

2. The method of claim 1, wherein, In step (1), the anion exchange resin is a strong basic anion exchange resin, including macroporous adsorption resin or ion exchange resin, the type of the macroporous adsorption resin includes XAD761, HPD750, and H103, and the type of the ion exchange resin includes IRA400 and A26-OH.

3. The method of claim 1, wherein, In step (1), the volume of the buffer solution is 5-20 mL / g based on the mass of the anion exchange resin, and the buffer solution is 1 M and pH 10.5 sodium carbonate / sodium bicarbonate buffer solution.

4. The method of claim 1, wherein, In step (1), the silane coupling agent is a mixture of 3-aminopropyltrimethoxysilane and vinyltrimethoxysilane in a molar ratio of 1:0.5-2, the propylene monomer is a mixture of acrylic acid and acrylamide in a mass ratio of 100:10-50, the crosslinking agent is N,N-methylenebisacrylamide, and the initiator is one of ammonium persulfate, potassium persulfate, and sodium persulfate.

5. The method of claim 1, wherein, In step (1), the volume concentration of the ethanol aqueous solution is 10-50%, and the volume is 5-50 mL / g based on the mass of the anion exchange resin; the addition amount of the silane coupling agent is 0.1-1:1 based on the mass of the anion exchange resin; and the mass ratios of the propylene monomer to graphene oxide, the anion exchange resin, the crosslinking agent, and the initiator are 100:1.5-3, 100:0.1-1.5, 100:0.3-1.5, and 100:0.4-0.8, respectively.

6. The method of claim 1, wherein, In step (2), the addition amount of the catalyst in the reaction system is 2-20 g / L, the addition amount of the substrate is 0.1-2 M, and the addition amount of the modified resin is 160-640 g / L.

7. The method of claim 1, wherein, In step (2), the immobilized halohydrin dehalogenase is prepared by using carrageenan as a carrier, an enzyme solution of halohydrin dehalogenase as an active ingredient, and a 0.5-3% KCl aqueous solution as a hardener.

8. The method of claim 7, wherein, The immobilized halogen alcohol dehalogenase is prepared by the following steps: adding carrageenan into deionized water, heating to 70 DEG C, and after the gel solution becomes transparent and easy to flow, cooling to 42 DEG C, adding enzyme solution of halogen alcohol dehalogenase, mixing thoroughly, pouring into a flat plate, standing at 4 DEG C overnight, adding hardener, soaking at 4 DEG C for 1 h, then cutting, washing with deionized water until the filtrate has no enzyme activity, obtaining the immobilized enzyme; the mass concentration of the carrageenan added into deionized water is 0.7-3.2%; the protein concentration of the enzyme solution of halogen alcohol dehalogenase is 0.5-1.5 mg / mL, and the added amount is 50-400 μL / g of the mass of the carrageenan.

9. The method of claim 7, wherein, The enzyme solution of the halogenated alcohol dehalogenase is prepared by the following steps: the halogenated alcohol dehalogenase engineering bacteria are inoculated into LB medium containing 50 μg / mL kanamycin, and cultured at 37 ℃ for 12 h to obtain a seed solution; then the seed solution is inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin at a volume concentration of 2%, and cultured at 37 ℃ until the bacterial concentration OD 600 0.6-0.8; then 0.1 mM isopropyl-beta-D-thiogalactopyranoside is added to the culture medium, and the culture is induced at 28 ℃ for 12 h; the wet bacteria are collected by centrifugation at 4 ℃ and 12000 rpm for 10 min, dissolved in deionized water, resuspended by stirring, and then subjected to ultrasonic disruption at 300 W for 1 s and 2 s pause, for a total disruption time of 5 min; after the cell disruption, the cell disruption solution is centrifuged at 8000 rpm and 4 ℃ for 10 min, and the supernatant is collected, filtered with a sterile filter, and obtained as a crude enzyme solution which is stored on ice; after the Ni-NTA column is balanced, the flow rate is adjusted to 1.0 mL / min, and the crude enzyme solution is loaded; after the breakthrough peak reaches the maximum, the loading is stopped, and the equilibrium buffer is used again to wash, remove impurities and unabsorbed target protein, until the conductivity and voltage are rebalanced; finally, the protein is eluted using the elution buffer, and the eluate is collected when the system appears an elution peak; the collected eluate is placed in a dialysis bag and dialyzed in 1 M, pH 10.5 carbonate buffer; the dialysis process is in an ice bath state, and after 2-3 h, the new buffer is replaced for dialysis overnight; the obtained dialysate is the enzyme solution.

10. The method of claim 9, wherein, The halogen alcohol dehalogenase engineering bacteria are obtained by connecting the gene sequence shown in SEQ ID NO. 2 to the NcoI and XhoI enzyme cutting sites of the plasmid pET-28b, and then transferring into the E. coli BL21 (DE3) competent cells, and screening the obtained on the LB solid culture medium containing kanamycin resistance.

Images