A freeze-drying protective agent for rapid one-step qPCR reagent, a freeze-drying process and application thereof

By combining lyophilization protectants and using a gradient temperature drying process, the problems of enzyme activity loss and morphological instability during the lyophilization of qPCR reagents are solved, achieving efficient and stable lyophilization protection. This method is suitable for room temperature transportation and detection of rapid one-step qPCR reagents.

CN121674538BActive Publication Date: 2026-07-24苏州源启生物科技有限公司
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
苏州源启生物科技有限公司
Filing Date
2026-02-09
Publication Date
2026-07-24

Smart Images

  • Figure CN121674538B_ABST
    Figure CN121674538B_ABST
Patent Text Reader

Abstract

The application discloses a freeze-drying protective agent for a rapid one-step qPCR reagent, a freeze-drying process and application thereof, and belongs to the technical field of molecular diagnosis. The technical problems to be solved are as follows: (1) the CT value is shifted backward, the fluorescence signal value is reduced, and the activity and detection performance are attenuated after the freeze-drying process of the existing product; (2) the high content of glycerol leads to poor shape of the freeze-dried product, easy moisture absorption, and poor batch-to-batch and batch-to-batch stability; (3) some protective agents inhibit the PCR reaction and affect the detection performance; and (4) the conventional detection time is shortened from more than 60 minutes to 30 minutes. The technical scheme is characterized in that the freeze-drying protective agent for the rapid one-step qPCR reagent comprises 0.8-1.5 parts of lauryl alcohol polyoxyethylene ether, 2.5-20 parts of trehalose, 6-7 parts of mannitol, 0.4-1 part of bovine serum albumin and 0.3-1 part of GP32 protein in terms of weight fraction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to a lyophilization protectant, lyophilization process and application of a rapid one-step qPCR reagent. Background Technology

[0002] Quantitative real-time PCR (qPCR) is a technique that monitors DNA amplification in real time during the PCR reaction using fluorescence signals. It combines the high efficiency of traditional PCR with the quantitative ability of fluorescence detection, and has the advantages of high sensitivity, high specificity (such as specific probes binding only to target sequences in probe methods, significantly reducing non-specific amplification), speed and efficiency (no electrophoresis required), and multiplexing. It is widely used in gene expression analysis, pathogen detection, genotyping and other fields.

[0003] Buffer and Mg in qPCR reagents 2+ The components are relatively stable and easy to store, while dNTPs, primers, probes, reverse transcriptase, DNA polymerase, and UDG enzymes are greatly affected by temperature and require low-temperature storage, occupying a large amount of refrigerated space. Transportation also requires specialized cold chain logistics, resulting in high costs and limited transport capacity.

[0004] To maintain reagents at room temperature during storage and transportation, it is necessary to remove moisture from them to reduce inactivation or degradation during storage and transportation. There are two ways to remove moisture from reagents: one method is to use heating to vaporize liquid water into gaseous water, a common reagent treatment method such as air drying. However, this method requires heating to provide a certain amount of heat during the vaporization process, which may lead to the inactivation of bioactive substances (especially enzymes) in the reagents, and the removal of moisture is not thorough.

[0005] Another method is vacuum freeze-drying (referred to as "lyophilization"), which removes solid water by sublimating it into gaseous water under near-vacuum conditions. Because the entire dehydration process is carried out at low temperatures, this method minimizes the loss of biological activity of heat-sensitive substances such as enzymes, making it ideal for the dehydration of qPCR reagents.

[0006] During the freeze-drying stage, the water in the qPCR reagent freezes first. The ice crystals may damage the enzyme protein structure. In addition, as the water sublimates, the concentration of the solvent gradually increases, and the pH value of the solution changes, which can easily lead to protein denaturation.

[0007] Both the lyophilization process and the subsequent storage of reagents can affect enzyme activity. This is where lyophilization protectants play a crucial role. Lyophilization protectants often require a combination of various lyophilization additives to achieve the desired effect. Commonly used lyophilization additives can be categorized by chemical properties into sugars (trehalose, sucrose, raffinose, pullulan, etc.), alcohols (mannitol, sorbitol, inositol, etc.), small molecule amino acids or proteins (glycine, tryptophan, bovine serum albumin, GP32 protein, etc.), and polymers (PEG, polyvinylpyrrolidone, etc.). Finding the right lyophilization protectant for qPCR reagents from such a diverse range of additives is quite challenging.

[0008] Existing freeze-drying processes are primarily designed for enzyme raw materials and cannot be used to freeze-dry other components. This is because: 1) Freeze-drying all components is more complex in practice, and existing processes often result in shifted CT values, reduced fluorescence signals, and decreased activity and detection performance; 2) While glycerol is a commonly used preservative, using high glycerol content leads to poor morphology, hygroscopicity, and poor batch-to-batch and intra-batch stability of the freeze-dried product; and 3) Some preservatives inhibit PCR reactions, affecting detection performance.

[0009] Chinese Patent Publication No. CN114480591B discloses a lyophilization protectant for one-step qPCR reagents. The main components of the protectant include trehalose, mannitol, gelatin, bovine serum albumin, Triton X-100, Biolipidure-103, and water treated with diethyl pyrophosphate. However, the retention rates of reverse transcriptase and Taq DNA polymerase activities after lyophilization using this protectant are low and require further improvement.

[0010] Therefore, there is an urgent need to find a combination of lyophilization protectants and lyophilization process for "premixed" qPCR reagents, which is expected to solve the problems of storage and transportation of nucleic acid testing reagents. Summary of the Invention

[0011] The purpose of this invention is to provide:

[0012] A lyophilization protectant, lyophilization process and application for rapid one-step qPCR reagents, and related technologies are disclosed to address the technical problems of the overly complex operation of full-component lyophilization, the fact that existing lyophilization processes mainly target enzyme raw materials and cannot mix other components before lyophilization, or combinations thereof.

[0013] Terminology Explanation:

[0014] Unless otherwise defined, all technical terms in this document have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent inventions, and publications cited in this document are incorporated herein by reference in their entirety. If multiple definitions exist for terms in this document, the definitions in this chapter shall prevail.

[0015] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.

[0016] The definition of standard chemical terminology can be found in the reference "Molecular Biology, Nanjing University Press, by Yang Rongwu".

[0017] Unless otherwise specified, conventional methods within the scope of the art, such as nucleic acid extraction, primer synthesis, and PCR system preparation, shall be used.

[0018] Unless specifically defined herein, the use of all commercially available products herein employs standard techniques. For example, it may be carried out using the manufacturer's instructions for use with the kit, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein can generally be implemented according to conventional methods well known in the art, based on the descriptions in the various summary and more specific documents cited and discussed in this specification.

[0019] The term "rapid one-step qPCR reagent" used in this article refers to a qPCR detection reagent that integrates reverse transcription (reverse transcription of RNA into cDNA) and qPCR amplification reaction in the same reaction system, eliminating the need for separate reverse transcription operations, and with an overall reaction time (from sample addition to result output) of only 30 minutes.

[0020] The term "lyophilization protectant" used in this article refers to a combination of additives that can protect the active components of qPCR reagents, such as enzymes (reverse transcriptase, DNA polymerase, etc.), primers, and probes, from denaturation or degradation during the vacuum freeze-drying process and storage after freeze-drying, while maintaining the integrity (exfoliation) of the reagents after freeze-drying.

[0021] The term "fully premixed lyophilized qPCR reagent" as used in this article refers to reagents prepared using the buffer, Mg2+, and other premixed lyophilized reagents required for qPCR reactions. 2+ The solid reagent is prepared by pre-mixing all components such as dNTPs, primers, probes, enzymes, and lyophilization protectants, and then freeze-drying it under vacuum. When using it, simply add template and water to reconstitute it before performing qPCR.

[0022] The term "mass-volume ratio" as used in this article refers to the number of grams of each component contained in each milliliter of lyophilization protectant. If expressed as a percentage, it refers to the number of grams of each component contained in each 100 milliliters of lyophilization protectant.

[0023] The term "annealing step" used in this article (in the freeze-drying process) refers to the process in the freeze-drying stage where the frozen reagent is heated to a specific temperature (usually near the eutectic point of the solution) at a certain heating rate and held for a period of time, and then cooled down to the freezing temperature at a certain cooling rate. The purpose is to promote the complete crystallization of the reagent, form a regular crystal structure and a smooth channel for water vapor to escape.

[0024] The term "gradient temperature drying" used in this article refers to a drying method in which the temperature is gradually increased from a low temperature to the target temperature at a fixed rate (e.g., 20 min / 10 °C) during the sublimation drying or desorption drying process of freeze-drying, rather than a direct jump in temperature increase. This method can reduce enzyme activity loss caused by sudden temperature changes.

[0025] The term "enzyme activity retention rate" used in this article refers to the percentage of enzyme activity after freeze-drying compared to enzyme activity before freeze-drying. The reverse transcriptase activity retention rate is calculated by detecting the ΔRn value of the SYBR fluorescence signal (55-cycle Rn value - 15-cycle Rn value), and the Taq DNA polymerase activity retention rate is calculated by detecting the ΔRn value of the SYBR fluorescence signal (22-cycle Rn value - 3-cycle Rn value). A higher value indicates a smaller loss of enzyme activity during freeze-drying.

[0026] The term "GP32 protein" used in this article refers to the protein encoded by T4 phage gene 32, which is a single-stranded DNA (ssDNA) binding protein essential for T4 phage DNA replication and repair, and is often simply referred to as a single-stranded binding protein.

[0027] The term “Brij L23” used in this article refers to a nonionic surfactant, chemically named lauryl alcohol polyoxyethylene ether or polyoxyethylene (23) lauryl ether, with CAS number 9002-92-0.

[0028] In a first aspect, the present invention provides: a freeze-drying protectant.

[0029] This includes technical features such as the composition of the freeze-drying protectant and the amount of each component in the freeze-drying protectant.

[0030] The components of the freeze-drying protectant include: lauryl alcohol polyoxyethylene ether, trehalose, mannitol, bovine serum albumin, and GP32 protein.

[0031] The amount of each component in the freeze-drying protectant, by weight, includes 0.8-1.5 parts lauryl alcohol polyoxyethylene ether, 2.5-20 parts trehalose, 6-7 parts mannitol, 0.4-1 part bovine serum albumin, and 0.3-1 part GP32 protein.

[0032] The preferred amount of lauryl alcohol polyoxyethylene ether is 0.8 parts to 1 part.

[0033] The preferred amount of lauryl alcohol polyoxyethylene ether is 1 part to 1.5 parts.

[0034] The amount of lauryl alcohol polyoxyethylene ether used is further preferably 1 part.

[0035] The preferred amount of trehalose is 2.5 to 10 parts.

[0036] The preferred amount of trehalose is 10-20 parts.

[0037] The amount of trehalose used is further preferably 5-10 parts.

[0038] The preferred amount of mannitol used is 6 to 6.5 parts.

[0039] The preferred dosage of mannitol is 6.5 to 7 parts.

[0040] The amount of mannitol used is further preferably 6.5 parts.

[0041] The preferred amount of bovine serum albumin is 0.4 to 0.6 parts.

[0042] The preferred amount of bovine serum albumin is 0.6 to 1 part.

[0043] The preferred amount of bovine serum albumin is 0.6 parts.

[0044] The preferred amount of GP32 protein is 0.3 to 0.5 parts.

[0045] The preferred amount of GP32 protein is 0.5 to 1 part.

[0046] The preferred amount of GP32 protein is 0.5-0.8 parts.

[0047] The preferred amounts of each component in the freeze-drying protectant are as follows: by weight, 0.8-1.5 parts lauryl alcohol polyoxyethylene ether, 5-10 parts trehalose, 6.5-7 parts mannitol, 0.4-1 part bovine serum albumin, and 0.5-0.8 parts GP32 protein; and when the amount of GP32 protein is 0.8 parts, the amount of trehalose is not 10 parts and / or the amount of mannitol is not 7 parts.

[0048] The freeze-drying protectant is added to the freeze-drying system during use. By mass-volume ratio, the freeze-drying system includes 0.8%-1.5% lauryl alcohol polyoxyethylene ether, 2.5%-20% trehalose, 6%-7% mannitol, 0.4%-1% bovine serum albumin, and 0.3%-1% GP32 protein; that is, each 100ml of the freeze-drying system includes 0.8g-1.5g lauryl alcohol polyoxyethylene ether, 2.5g-20g trehalose, 6g-7g mannitol, 0.4g-1g bovine serum albumin, and 0.3g-1g GP32 protein.

[0049] Preferably, each 100ml of the lyophilized system includes 0.8g-1.5g lauryl polyoxyethylene ether, 5g-10g trehalose, 6.5g-7g mannitol, 0.4g-1g bovine serum albumin, and 0.5g-0.8g GP32 protein; and when the amount of GP32 protein is 0.8g, the amount of trehalose is not 10g and / or the amount of mannitol is not 7g.

[0050] Secondly, the present invention provides a one-step fully premixed lyophilized qPCR reagent containing any of the above-mentioned lyophilization protectants.

[0051] The qPCR reagents include, but are not limited to, any one or more of buffers, enzymes, primers, probes, diluents, and H2O.

[0052] Thirdly, the present invention provides a freeze-drying process in which the above-mentioned freeze-drying protectant or the above-mentioned one-step fully premixed freeze-dried qPCR reagent is used during the freeze-drying process.

[0053] Specifically, any qPCR reagent can be lyophilized using the above-mentioned lyophilization protectant and the lyophilization process, or the above-mentioned one-step fully premixed lyophilized qPCR reagent can be lyophilized using the lyophilization process.

[0054] The freeze-drying process includes four steps: pre-freezing, annealing, sublimation drying, and desorption drying.

[0055] The conditions for the pre-freezing step are: cooling from room temperature to -40°C for 60 minutes; maintaining the temperature at -40°C for 60 minutes.

[0056] The annealing conditions are as follows: heating from -40°C to -20°C for 30 minutes; maintaining the temperature at -20°C for 60 minutes; cooling from -20°C to -40°C for 30 minutes; and maintaining the temperature at -40°C for 120 minutes.

[0057] The conditions for the sublimation drying step are as follows: maintain a pressure of 0.05 mbar throughout the process, maintain -40℃ for 20 min, and apply vacuum; maintain -40℃ for 600 min; increase the temperature from -40℃ to -30℃ for 20 min; maintain -30℃ for 60 min; increase the temperature from -30℃ to -20℃ for 20 min; maintain -20℃ for 60 min; increase the temperature from -20℃ to -10℃ for 20 min; maintain -10℃ for 60 min; increase the temperature from -10℃ to 0℃ for 20 min; and maintain 0℃ for 60 min.

[0058] The conditions for the analytical drying step are as follows: maintain a pressure of 0.05 mbar throughout the process, increase the temperature from 0°C to 4°C for 10 min; maintain 4°C for 20 min; increase the temperature from 4°C to 10°C for 10 min; maintain 10°C for 20 min; increase the temperature from 10°C to 15°C for 10 min; maintain 15°C for 20 min; increase the temperature from 15°C to 20°C for 10 min; maintain 20°C for 20 min; increase the temperature from 20°C to 25°C for 10 min; and maintain 25°C for 240 min.

[0059] Fourthly, the present invention provides the application of the above-mentioned lyophilization protectant or the above-mentioned one-step fully premixed lyophilized qPCR reagent or the qPCR reagent obtained by lyophilization using the above-mentioned lyophilization process or the one-step fully premixed lyophilized qPCR reagent in amplification detection.

[0060] The templates for amplification detection include, but are not limited to, viruses.

[0061] The template for amplification detection is preferably a retrovirus.

[0062] The template for amplification detection is further preferably a respiratory RNA virus.

[0063] The template for amplification detection is more preferably at least one of influenza A virus, influenza B virus, and respiratory syncytial virus.

[0064] Fifthly, the present invention provides an amplification detection kit, the kit comprising the above-mentioned lyophilization protectant, or the above-mentioned one-step fully premixed lyophilized qPCR reagent, or qPCR reagent obtained by lyophilization using the above-mentioned lyophilization process, or one-step fully premixed lyophilized qPCR reagent.

[0065] The present invention has at least the following beneficial effects:

[0066] The lyophilization protectant combination used in this invention has good excipient ability during the lyophilization process, and the performance of the qPCR reagent is consistent with the initial version. In addition, the added annealing process alleviates the irregular crystal structure formed by uneven heating during the pre-freezing stage of the lyophilized reagent and strengthens the crystal structure. Finally, the gradient temperature drying process effectively solves the problem of enzyme activity loss caused by excessive temperature changes and avoids the degradation of qPCR reagent performance. Using the one-step fully premixed lyophilized qPCR reagent provided by this invention, the overall reaction time (from sample addition to result output) is only 30 minutes. Attached Figure Description

[0067] Figure 1 The excipient effect of different concentrations of the freeze-dried additive Tween 20.

[0068] Figure 2 The excipient effect of different concentrations of lauryl alcohol polyoxyethylene ether, a freeze-dried additive.

[0069] Figure 3 The excipient effect of different concentrations of trehalose added for freeze-drying.

[0070] Figure 4 The excipient effect of different concentrations of mannitol, a freeze-drying additive.

[0071] Figure 5 The excipient effects of different concentrations of the freeze-dried additive bovine serum albumin.

[0072] Figure 6 The excipient effect of different concentrations of the freeze-dried additive GP32 protein.

[0073] Figure 7 The excipient effects of different concentrations of freeze-dried additive combinations are shown, where 1-8 correspond to treatment groups 1-8 in Table 4.

[0074] Figure 8 Amplification curves of the CY5 channel in respiratory virus amplification for different combinations of lyophilized additives.

[0075] Figure 9 Amplification curves of FAM channels in respiratory virus amplification by different combinations of lyophilized additives.

[0076] Figure 10 ROX channel amplification curves for different combinations of lyophilized additives in respiratory virus amplification.

[0077] Figure 11 Amplification curves of the VIC channel in respiratory virus amplification by different combinations of lyophilized additives.

[0078] Figure 12Amplification curve of the CY5 channel in respiratory virus amplification after optimization and acceleration of the freeze-drying process.

[0079] Figure 13 Amplification curve of FAM channel in respiratory virus amplification after optimization and acceleration of freeze-drying process.

[0080] Figure 14 ROX channel amplification curves in respiratory virus amplification after optimization and acceleration of freeze-drying process.

[0081] Figure 15 Amplification curve of the VIC channel in respiratory virus amplification after optimization and acceleration of the freeze-drying process.

[0082] Figures 8-11 In the table, the numbers 1-8 correspond to processing groups 1-8 in Table 4.

[0083] Figures 12-15 In the diagram, 1 represents the freeze-drying treatment before optimization, 2 represents the freeze-drying treatment before optimization followed by accelerated treatment at room temperature, 3 represents the freeze-drying treatment after optimization, and 4 represents the freeze-drying treatment after optimization followed by accelerated treatment at room temperature. Detailed Implementation

[0084] Unless otherwise specified, all raw materials and reagents used in this invention were purchased from commercial suppliers, and experiments were conducted in accordance with the operating instructions. Unless otherwise specified, all instruments, equipment, and apparatus used in this invention are conventional instruments, equipment, and apparatus, and experiments were conducted in accordance with the operating instructions and the accompanying reagents.

[0085] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified in the embodiments, conditions are performed under conventional conditions or conditions recommended by the manufacturer. All reagents or instruments without specified manufacturers are commercially available conventional products. Numerous specific details are provided in the following detailed embodiments to better illustrate the invention. The specific embodiments described herein are for illustrative purposes only and are not intended to constitute any limitation on the invention.

[0086] The specific approach of this invention is as follows: First, this invention determines the performance evaluation indicators of lyophilized reagents based on the performance standards of the initial non-lyophilizable version of the qPCR reagent system (see Table 1: catalog number TK016). Then, using this standard, the optimal combination and concentration of lyophilization additives, the optimal lyophilization procedure, and heat-conducting consumables for qPCR reagents targeting RNA detection are explored. Based on the lyophilizable qPCR reagent system (TK016-GF), lyophilization additives are combined to determine the final lyophilization additive formulation and lyophilization process.

[0087] The main reagents, instruments and consumables involved in this invention are shown in Table 1.

[0088] Table 1 Reagents, Consumables and Instruments

[0089]

[0090] The formulation of U+ flash one-step RT-PCR buffer (5×) in Table 1 is as follows: 150mM Tris-HCl (pH=9.0), 150mM KCl, 20mM MgCl2, 25mM ethylene glycol diethyl ether diaminetetraacetic acid (EGTA), 30mM potassium glutamate (Glu-K), 65mM tetramethylammonium acetate (TMAA), 1.5mM dNTPs, 0.375mM dUTP, and the remainder is made up with diethyl pyrocarbonate treated water (DEPC water);

[0091] The U+ flash one-step RT-PCR enzyme mixture (10×) is formulated as follows: 1.2 U / μL RNase inhibitor, 4 U / μL M-MLV reverse transcriptase, 3.5 U / μL double-block hotstart Taq DNA polymerase, 0.04 U / μL heat-labile UDG enzyme (Uracil DNA Glycosylase), with the remainder made up with enzyme dilution buffer.

[0092] The enzyme dilution solution (50×) is formulated as follows: 20mM Tris-HCl pH 7.5, 200mM NaCl, 1mM dithiothreitol (DDT), 0.1mM EDTA, 0.01% Tween 20 (polysorbate-20), and 50% glycerol.

[0093] TK016-GF is the TK016 formula without the glycerin component.

[0094] Example 1: Determination of the initial concentration range for different freeze-drying additives

[0095] Based on a review of relevant literature, this invention initially introduces six commonly used lyophilization additives—Tween 20, Brij L23, trehalose, mannitol, BSA, and GP32 protein—as research subjects. For experimental consistency, the concentration of each lyophilization additive was calculated based on its weight-to-volume ratio (w / v).

[0096] To explore as many different lyophilization additives as possible, this invention prepares the lyophilization additives according to their highest solubility at room temperature. The final concentration (target concentration) is then calculated based on the volume added to a 20µL lyophilization system.

[0097] I. Preparation of different concentrations of lyophilized additives in qPCR systems

[0098] Taking a 25µL reaction system (20µL lyophilized system + 5µL template, the template does not need to be added before lyophilization) as an example, the composition of the lyophilized system is shown in Table 2:

[0099] Table 2. Preparation of freeze-drying systems with different concentrations of freeze-drying additives

[0100]

[0101] The primer and probe information for respiratory influenza A / B and respiratory syncytial virus is as follows:

[0102] ACT-F (SEQ ID NO.1): CTCAATCCCAAGGCCAACCGCGAGA;

[0103] ACT-R (SEQ ID NO.2): AGGCGTAGAGGGACAGCAC;

[0104] Probe 1 (SEQ ID NO.3): CY5-AGATGACCCAGATCATGTTTGA-BHQ3;

[0105] INF AF (SEQ ID NO.4): GTYTTCGAGCTCTCRGACGA;

[0106] INF AR (SEQ ID NO.5): TCTTATTTCTTCGGAGACAATGCAGA;

[0107] Probe 2 (SEQ ID NO. 6): FAM-CGAACCCGATCGTGCC-MGB;

[0108] INF BF (SEQ ID NO.7): AGATGGCCATCGGATCCTCA;

[0109] INF BR (SEQ ID NO.8):CGGTGCCTTGACCAAATTGG;

[0110] Probe 3 (SEQ ID NO.9): ROX-CCAATTCGAGCAGCTGAAACTGCGGTG-BHQ3;

[0111] RSV-F (SEQ ID NO. 10): GGCAAATATGGAAACATACGTGAA;

[0112] RSV-R (SEQ ID NO. 11): TCTTTTTCTAGGACATTGTAYTGAACAG;

[0113] Probe 4 (SEQ ID NO.12): VIC-CTGTGTATGTGGAGCCTTCGTGAAGCT-BHQ2;

[0114] The primers and probes above were synthesized by General Biotech (Anhui) Co., Ltd.

[0115] The target concentrations of the six freeze-drying additives were as follows: Tween 20 (0%, 0.1%, 0.2%, 0.4%, 0.8%, 1.0%, 1.2%, 1.5%), Brij L23 (0%, 0.1%, 0.2%, 0.4%, 0.8%, 1.0%, 1.2%, 1.5%), Trehalose (0%, 2.5%, 5%, 7.5%, 10%, 12.5%, 15%, 20%), Mannitol (0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%), Bovine serum albumin (BSA) (0%, 0.05%, 0.1%, 0.2%, 0.4%, 0.6%, 0.8%, 1.0%), and GP32 protein (0%, 0.05%, 0.1%, 0.2%, 0.4%, 0.6%, 0.8%, 1.0%). The concentrations, as shown in the eight-tube strip, increased sequentially from left to right.

[0116] II. Freeze-drying process

[0117] After preparing the solution to the target concentration as described above, dispense it into eight-tube bundles, place the eight-tube bundles on the tube rack, and then freeze-dry them according to the freeze-drying procedure in Table 3 below:

[0118] Table 3 Freeze-drying process

[0119]

[0120] Note: This stage transitions from the pre-frozen atmospheric pressure state of the previous stage to the vacuum state of sublimation drying. Although both are set to -40℃, the pressure drop in a short period of time will cause the temperature of the closed system to fluctuate. The 60-minute holding time is used to balance the temperature fluctuation.

[0121] III. Improving Effects of Freeze-Drying

[0122] The excipients used in lyophilization ensure that the reagents retain a certain structural support after moisture removal. Since some lyophilization protectants also have excipient effects, and these excipients also provide lyophilization preservation, they are crucial for long-term stability. Therefore, this section did not test their performance; instead, their morphology was used as an important criterion for screening lyophilization additive concentrations.

[0123] like Figures 1-6 It can be seen that the excipient effect significantly improves with increasing lyophilization additive concentration from left to right. However, no excipient effect was observed with Tween 20 even when added up to 1.5%, so it was not added further. The preliminary addition ranges for each lyophilization additive are: lauryl alcohol polyoxyethylene ether (0.8%-1.5% w / v), trehalose (2.5%-20% w / v), mannitol (6%-7% w / v), bovine serum albumin (0.4%-1% w / v), and GP32 protein (0.3%-1% w / v).

[0124] Example 2: Screening for the optimal combination of freeze-dried additives

[0125] Since different additives have different functions, and the components of qPCR reagents are also quite complex, if you want to achieve the effects of low temperature protection during the lyophilization process of qPCR reagents, excipients after lyophilization, and long-term preservation, you often need to use a combination of multiple additives.

[0126] Based on the types and concentration ranges of freeze-drying additives determined in Example 1, two concentrations of each additive were selected for combination addition (1% and 1.2% lauryl alcohol polyoxyethylene ether; 5% and 10% trehalose; 6.5% and 7% mannitol; 0.6% and 0.8% bovine serum albumin; 0.5% and 0.8% GP32 protein). Through cross-combinations of single-component, two-component, three-component, four-component, and five-component formulations, it was found that the combined addition of five additives showed good results. Furthermore, the concentrations of lauryl alcohol polyoxyethylene ether, bovine serum albumin, and GP32 protein should not be too high; initially, the concentrations were set at 1% lauryl alcohol polyoxyethylene ether and 0.6% bovine serum albumin. The concentrations of trehalose, mannitol, and GP32 protein require further experimental determination.

[0127] I. Process for determining the concentration of combined additives

[0128] The preparation system is shown in Table 2 of Example 1.

[0129] Table 4 Formulation of Different Additive Combinations

[0130]

[0131] II. Freeze-drying process and shaping effect

[0132] Prepare the premixed solution according to the formula in Table 4 and dispense it into eight-tube bundles. Then place the eight-tube bundles on the tube rack and freeze-dry them according to the procedure in Table 3 of Example 1.

[0133] like Figure 7As shown in the figure, groups 1-8 in the figure correspond to treatment groups 1-8 in Table 4. It can be found that the freeze-dried forms of treatment groups 1, 2, 3, 4, and 5 are relatively complete, while those of treatment groups 6, 7, and 8 show atrophy after freeze-drying. Subsequently, the performance of treatment groups 1-8 needs to be evaluated.

[0134] III. Performance Testing after Freeze-Drying

[0135] Use the nucleic acid extraction kit (Anhui Medical Device 20220024) of Anhui Tongke Biotechnology Co., Ltd. and its TK3200 fully automatic nucleic acid extractor to extract the nucleic acids of influenza A / B and respiratory syncytial virus samples. Add the freeze-dried reagent to 20 µL of ddH2O for reconstitution, and then add 5 µL of the above-extracted template diluted by a certain multiple to the system. Take the initial non-freeze-dryable (glycerol-containing version TK016) version as the control and perform the reaction on the machine according to the procedure in Table 5.

[0136] Table 5 Reaction Procedure

[0137]

[0138] Note: Set the fast mode on the Quant Studio TM 5 instrument, and set the heating and cooling rate to 3.19 °C / s.

[0139] According to the above procedure, the total running time on the Quant Studio TM 5 instrument is 30 min. The results are as Figures 8-11 shown. It can be found that the performance of treatment group 4 is the best and can meet the performance requirements of the control group, while the amplified signal values and Ct values of the other 7 treatment groups show varying degrees of attenuation and lag.

[0140] Example 3: Optimization of the Freeze-Drying Procedure

[0141] In Examples 1 and 2, the freeze-drying procedure is relatively simple. Especially in the pre-freezing process, no annealing step is added, which is very unfavorable for the crystallization of the reagent. The annealing process is also relatively simple, that is, the frozen reagent is heated to a certain temperature at a certain heating rate and maintained for a period of time, and then the reagent temperature is cooled to the freezing temperature at a certain cooling rate. Adding the annealing step can not only strengthen the crystallization of the reagent and make the reagent that could not crystallize in time during pre-freezing crystallize completely, but also form a smooth water vapor escape channel to provide guarantee for the subsequent drying process; secondly, there is a large temperature difference in the connection between the first and second drying processes, which weakens the "adaptability" of each component in the reagent, especially the enzyme preparation, and will lead to enzyme activity loss.

[0142] Based on the above principles, the present invention adds an annealing and gradient heating process during the first and second drying processes on the basis of the original freeze-drying procedure.

[0143] I. Preparation of the freeze-drying system

[0144] The formulation system is referenced from Table 2 in Example 1. The freeze-drying additive concentrations were added according to the four treatment groups in Table 4 (1% lauryl alcohol polyoxyethylene ether; 0.6% bovine serum albumin; 0.5% GP32 protein; 10% trehalose; 7% mannitol). The freeze-drying was performed according to both the standard freeze-drying procedure (Table 3) and the freeze-drying procedure in Table 6.

[0145] Table 6 Optimized freeze-drying program

[0146]

[0147] Note: This stage transitions from the atmospheric pressure state of the previous annealing stage to the vacuum state of sublimation drying. Although both are set to -40℃, the pressure drop in a short period of time will cause the temperature of the closed system to fluctuate. The 20-minute holding time is used to balance the temperature fluctuation.

[0148] II. Enzyme activity retention under different freeze-drying processes

[0149] The experimental system for measuring the retention rate of reverse transcriptase activity after lyophilization (enzyme activity after lyophilization / enzyme activity before lyophilization) is shown in Table 7; the reaction procedure is shown in Table 8. The Thermo Fisher Scientific Quant Studio real-time quantitative PCR instrument was used. TM 5. Select the SYBR fluorescence signal and set the sample volume to 25 µL.

[0150] Single-stranded RNA:MS2 (manufacturer: Roche, purchased from Merck, catalog number 10165948001) was used as the detection template. The reverse transcriptase activity retention rate was calculated as follows: ROX and SYBR signal values ​​were selected at cycles 15 and 55. Rn = SYBR signal value ÷ ROX signal value; ΔRn = Rn value at cycle 55 - Rn value at cycle 15; transcriptase activity retention rate = ΔRn after lyophilization ÷ ΔRn before lyophilization. A higher value indicates a higher enzyme activity retention rate.

[0151] Table 7 Experimental system for detecting reverse transcriptase activity retention rate

[0152]

[0153] Table 8. Experimental Procedure for Detecting Reverse Transcriptase Activity Retention Rate

[0154]

[0155] The experimental system for retaining Taq DNA polymerase activity (enzyme activity after lyophilization / enzyme activity before lyophilization) after lyophilization is shown in Table 9; the reaction procedure is shown in Table 10. The Thermo Fisher Scientific QuantStudio real-time quantitative PCR instrument was used.TM 5. Select the SYBR fluorescence signal and set the sample volume to 25 µL.

[0156] Single-stranded DNA: M13ssDNA (purchased from BIORULER Biotechnology Co., Ltd., catalog number B3008) was used as the detection template. The Taq DNA polymerase activity retention rate was calculated as follows: The Rn values ​​from cycles 3 and 22 were selected. The ΔRn was obtained by subtracting the Rn value from the Rn value of cycle 3 from the Rn value of cycle 22. The Taq DNA polymerase activity retention rate = ΔRn after lyophilization ÷ ΔRn before lyophilization. A higher value indicates a higher enzyme activity retention rate.

[0157] Table 9 Experimental system for Taq DNA polymerase retention rate detection

[0158]

[0159] Table 10 Experimental Procedure for Taq DNA Polymerase Activity Retention Rate Detection

[0160]

[0161] The results are shown in Table 11. The retention rate of reverse transcriptase activity after freeze-drying optimization was significantly higher than that before optimization, and the retention rate of Taq DNA polymerase activity was also improved. This shows that the addition of annealing and gradient temperature increase process effectively reduced the loss of enzyme activity during freeze-drying.

[0162] Table 11 Retention rates of reverse transcriptase and Taq DNA polymerase activities under different freeze-drying processes

[0163]

[0164] III. Accelerated Stability Test after Freeze-drying

[0165] Sample processing and instrument testing were performed according to the performance testing procedure after freeze-drying in Example 2. Freeze-dried samples before and after freeze-drying program optimization, as well as samples after two months of accelerated freeze-drying at room temperature, were tested, with the initial non-freeze-dryable version (containing glycerol version TK016) as a control.

[0166] Test results are as follows Figures 12-15As shown, treatment 1 (blue) represents the freeze-drying treatment before optimization; treatment 2 (black) represents the freeze-drying treatment before optimization followed by accelerated freezing at room temperature; treatment 3 (orange) represents the freeze-drying treatment after optimization; and treatment 4 (pink) represents the freeze-drying treatment after optimization followed by accelerated freezing at room temperature. The freeze-drying treatment before optimization is shown in Table 3, and the freeze-drying treatment after optimization is shown in Table 6. It can be observed that the amplification performance of treatments 1, 3, and 4 is basically consistent with that of the control group, while the amplification performance of treatment 2 lags behind in the CY5 and FAM channels, indicating that the optimized freeze-drying program is superior to the unoptimized one in terms of accelerated stability. In summary, this invention provides a stable and effective combination of freeze-drying additive and freeze-drying program.

[0167] Comparative Example 1

[0168] The lyophilization protection solution was prepared according to the description of Comparative Example 1 in Example 3 of Chinese Patent Publication No. CN114480591B, and the retention rates of reverse transcriptase and Taq DNA polymerase activities of the lyophilization protectant were tested according to the description of Example 3 of this invention.

[0169] The formulation system is referenced in Table 2 of Example 1. The freeze-drying additive is the freeze-drying protectant formulation of Comparative Example 1 in Example 3 of CN114480591B, and is freeze-dried according to the ordinary freeze-drying procedure (freeze-drying process before optimization, Table 3) and the freeze-drying procedure in Table 6 (freeze-drying process after optimization), respectively.

[0170] The methods for testing the retention rates of reverse transcriptase activity and Taq DNA polymerase activity after lyophilization using different lyophilization programs are as described in Example 3. The results are shown in Table 12. It was found that the optimized lyophilization program improved the retention rate of enzyme activity, but compared with the lyophilization additive combinations of the four groups treated in Example 3, the retention rate of enzyme activity was significantly reduced.

[0171] Table 12 Retention rates of reverse transcriptase and Taq DNA polymerase activities under different freeze-drying processes

[0172]

[0173] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A lyophilization protectant for rapid one-step qPCR reagents, characterized in that, By weight, it consists of the following components: 1 part lauryl polyoxyethylene ether, 10 parts trehalose, 7 parts mannitol, 0.6 parts bovine serum albumin and 0.5 parts GP32 protein.

2. The use of the lyophilization protectant according to claim 1 in the preparation of a one-step fully premixed lyophilized qPCR reagent.

3. A one-step fully premixed lyophilized qPCR reagent, characterized in that, The one-step fully premixed lyophilized qPCR reagent includes the lyophilization protectant as described in claim 1.

4. The one-step fully premixed lyophilized qPCR reagent according to claim 3, characterized in that, The one-step fully premixed lyophilized qPCR reagent also includes buffer, enzyme, primers and probes, diluent, metal ions and H2O.

5. A freeze-drying process, characterized in that, The qPCR reagent is lyophilized using the lyophilization protectant and the lyophilization process described in claim 1, or the one-step fully premixed lyophilized qPCR reagent described in any one of claims 3-4 is lyophilized using the lyophilization process described in claim 1. The freeze-drying process includes a pre-freezing step, an annealing step, a sublimation drying step, and a desorption drying step; The annealing conditions are as follows: heating from -40°C to -20°C for 30 min; maintaining at -20°C for 60 min; cooling from -20°C to -40°C for 30 min; and maintaining at -40°C for 120 min. The conditions for the sublimation drying step are as follows: maintain a pressure of 0.05 mbar throughout the process, maintain -40°C for 20 min under vacuum; maintain -40°C for 600 min; increase the temperature from -40°C to -30°C for 20 min; maintain -30°C for 60 min; increase the temperature from -30°C to -20°C for 20 min; maintain -20°C for 60 min; increase the temperature from -20°C to -10°C for 20 min; maintain -10°C for 60 min; increase the temperature from -10°C to 0°C for 20 min; maintain 0°C for 60 min. The conditions for the analytical drying step are as follows: maintain a pressure of 0.05 mbar throughout the process, increase the temperature from 0°C to 4°C for 10 min; maintain 4°C for 20 min; increase the temperature from 4°C to 10°C for 10 min; maintain 10°C for 20 min; increase the temperature from 10°C to 15°C for 10 min; maintain 15°C for 20 min; increase the temperature from 15°C to 20°C for 10 min. Maintain 20℃ for 20 minutes, increase temperature from 20℃ to 25℃ for 10 minutes, and maintain 25℃ for 240 minutes.

6. The freeze-drying process according to claim 5, characterized in that, The conditions for the pre-freezing step are: room temperature to -40℃, cooling for 60 minutes; maintaining -40℃ for 60 minutes.

7. The application of the lyophilization protectant of claim 1, or the one-step fully premixed lyophilized qPCR reagent of any one of claims 3-4, or the qPCR reagent or one-step fully premixed lyophilized qPCR reagent obtained by lyophilization using the lyophilization process of any one of claims 5-6, in amplification detection.

8. An amplification detection kit, characterized in that, The kit includes the lyophilization protectant of claim 1, or the one-step fully premixed lyophilized qPCR reagent of any one of claims 3-4, or the qPCR reagent or one-step fully premixed lyophilized qPCR reagent obtained by lyophilization using the lyophilization process of any one of claims 5-6.

Citation Information

Patent Citations

  • A lyophilization protectant for one-step qPCR reagents and its application

    CN114480591B

  • Freeze-drying protective agent of nucleic acid amplification reaction reagents and freeze-drying method

    CN103911367A

  • N gene detection primer and probe group, chromatographic test strip, preparation method, detection kit and detection method

    CN115541875A

  • Composition and integrated kit for nucleic acid detection of multiple respiratory pathogens

    CN115992294A

  • Microsphere preparation for nucleic acid amplification, amplification method and application in joint detection

    CN116064746A