Application of resistance gene haplotype CHS1-mut2 in accurate monitoring of etoxazole resistance

Abstract

The invention relates to the technical field of etoxazole resistance monitoring, in particular to application of a resistance gene haplotype CHS1-mut2 to accurate monitoring of etoxazole resistance. The nucleotide sequence table of the haplotype CHS1-mut2 is as shown in SEQ ID No 1. According to the application of the resistance gene haplotype CHS1-mut2 in accurately monitoring the etoxazole resistance provided by the invention, whether etoxazole has a good mite killing effect when facing tetranychus urticae or not can be detected by detecting the resistance mutation frequency of a medicament to etoxazole.

Description

Technical Field

[0001] This invention relates to the field of etoxazole monitoring technology, and in particular to the application of the resistance gene haplotype CHS1-mut2 in the accurate monitoring of etoxazole resistance. Background Technology

[0002] In agricultural production, arthropod pests (mites) have always been an important target for pest control. The carmine spider mite (Tetranychus cinnabarinus) and the two-spotted spider mite (Tetranychus urticae) are important arthropod mites. Both belong to the class Arachnida, subclass Acari, order Acariformes, family Tetranychoidea, and genus Tetranychus. They are widely distributed throughout the world and mainly damage various important economic crops such as vegetables, cotton, fruit trees, and flowers. Both carmine and two-spotted spider mites primarily damage host plants as adults and nymphs. They typically congregate on the undersides of leaves to suck sap, starting from the lower leaves and gradually spreading upwards. When the mite population density is high, they gather at the top of the plant, spin webs, and disperse with the help of wind. After plants are damaged, the leaves gradually turn pale green, resulting in red leaves in mild cases and leaf drop and stem collapse in severe cases, resembling a fire. This causes large-scale yield reduction or even crop failure, seriously affecting crop quality and yield. These two types of spider mites are characterized by their small size, rapid growth and development, strong reproductive capacity, short generation cycle, and parthenogenesis. Therefore, they can adapt to the selective pressure of pesticides in a short period of time, leading to rapid development of pesticide resistance and posing significant challenges to chemical control.

[0003] Chemical control is an important means of controlling mites and insects. However, with the increasing prominence of pesticide resistance in mites and insects, the control efficacy of more and more insecticides and acaricides is declining rapidly year by year. On the other hand, due to the increasing costs of research, development, registration, and market launch of new insecticides and acaricides, as well as public concerns about environmental safety and human health, the research and development of new drugs is becoming increasingly difficult and challenging. Therefore, strengthening the investigation and management of pesticide resistance in field mites and insects, thereby extending the lifespan of existing insecticides and acaricides, is of paramount importance for the chemical control of mites and insects in the field. The field population of *Tetranychus carmine* has developed high levels of resistance to organochlorine and organophosphate acaricides, such as trichlorfon, dimethoate, parathion, and phorate, but has not developed significant resistance to pyrethroid acaricides.

[0004] With the increasing prominence of problems such as resistance, residues, and toxicity of organochlorine and organophosphate acaricides, these two types of acaricides have gradually been phased out of the acaricide market. Although pyrethroid acaricides also face resistance issues, they are still used for the control of field mites due to their advantages such as low toxicity, low residues, and environmental friendliness.

[0005] Subsequently, with the widespread use of other types of acaricides in the field in China, the resistance of spider mites to these agents gradually became apparent.

[0006] Furthermore, etoxazole, another mitochondrial electron transport inhibitor independently developed in my country, was registered and marketed in 2017, and no reports of spider mites developing resistance to it have been found. The growth inhibitor acaricides spirodiclofen and etoxazole were registered for use in my country in 2010 and 2011, respectively. Although these acaricides face the problem of resistance, they are still widely used in the field, similar to pyrethroid acaricides, due to their advantages of low toxicity, low residue, and environmental friendliness. However, due to the existence of spider mite resistance, the use of acaricides in the field will face the long-term risk of reduced or even ineffective control.

[0007] Currently, the methods for monitoring pesticide resistance in pests (mites) both domestically and internationally are mainly divided into three categories: bioassay, biochemical detection, and molecular detection.

[0008] Therefore, we designed the application of the resistance gene haplotype CHS1-mut2 in the precise monitoring of etoxazole resistance, providing another technical solution to the above-mentioned technical problems. Summary of the Invention

[0009] Therefore, it is necessary to provide an application of the resistance gene haplotype CHS1-mut2 in the accurate monitoring of etoxazole resistance to address the aforementioned technical problems, thereby resolving the technical issues raised in the background section.

[0010] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: The resistance gene haplotype CHS1-mut2, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0011] The application of the resistance gene haplotype CHS1-mut2 as described in claim 1 in the precise monitoring of etoxazole resistance comprises the following steps: The toxicity of etoxazole to Tetranychus tinctoria eggs was determined by the leaf disc spray method, and a baseline sensitivity of Tetranychus tinctoria eggs to etoxazole was established. Extraction of spider mite genomic DNA; Information on the target genes and mutation sites of the spider mites detected.

[0012] As a preferred embodiment of the application of the resistance gene haplotype CHS1-mut2 provided by the present invention in the precise monitoring of etoxazole resistance, the toxicity of etoxazole to Tetranychus two-spotted isopods is determined by the leaf disc spray method, and a sensitivity baseline of the susceptible population of Tetranychus two-spotted isopods is established. The steps are as follows: Use a square punch measuring 2cm x 2cm to punch fresh, clean cowpea leaves free of pesticide contamination into small leaves of uniform size. Place a moist sponge in a petri dish and cover it with filter paper. Place the leaf blades on the filter paper with the undersides facing up to make a leaf disc. Use a small paintbrush to pick out 20-30 3-5 day old larvae and place them on the leaf disc; Dilute the drug with distilled water to five concentrations and set up a water control. The Potter spray tower sprays water in the following order: clear water control → low concentration → high concentration. After the drug solution has settled for 30 seconds, it is taken out and transferred to a constant temperature and light incubator with a temperature of 26±1℃, humidity of 55%~75%, and a light cycle of 14h:10h (L:D) for rearing and observation. The mortality rate of spider mites was determined by microscopic examination after 24 hours. The mite was considered dead if it did not move or if one or two pairs of legs trembled involuntarily when gently touched with the tip of a paintbrush.

[0013] As a preferred embodiment of the application of the resistance gene haplotype CHS1-mut2 provided by the present invention in the precise monitoring of etoxazole resistance, the target gene and mutation site information of spider mites are detected, and primers are added according to the sequence of each target gene and mutation site. The primer amplification fragment contains mutation sites.

[0014] As a preferred embodiment of the application of the resistance gene haplotype CHS1-mut2 provided by the present invention in the precise monitoring of etoxazole resistance, in order to distinguish different populations, specific 8bp tag sequences corresponding to specific field populations are added to both the upstream and downstream primers.

[0015] As a preferred embodiment of the application of the resistance gene haplotype CHS1-mut2 provided by the present invention in the precise monitoring of etoxazole resistance, the detected spider mite target gene and mutation site information are used to determine whether etoxazole resistance can be monitored based on whether the resistance level of the two-spotted spider mite to etoxazole is proportional. If the resistance level of two-spotted spider mites to etoxazole is proportional to the specific resistance gene haplotype, then etoxazole resistance can be monitored.

[0016] It is clear without a doubt that the technical solution described above in this application can solve the technical problem that this application aims to address.

[0017] Meanwhile, through the above technical solutions, the present invention has at least the following beneficial effects: The application of the resistance gene haplotype CHS1-mut2 provided by this invention in the precise monitoring of etoxazole resistance can be used to detect whether etoxazole has a good acaricidal effect against two-spotted spider mites by detecting the frequency of resistance mutations in the agent to etoxazole. Attached Figure Description

[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a schematic diagram showing the resistance level of the two-spotted spider mite to etoxazole and the mutation frequency of the resistance gene. Figure 2 This is a flowchart of the amplicon sequencing detection of gene mutations according to the present invention. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0021] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0022] It should be noted that, unless otherwise specified, the embodiments and features and technical solutions in the present invention can be combined with each other.

[0023] It should be noted that similar labels and letters in the following figures indicate similar items. Therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures.

[0024] Reference Figure 1 Application of the resistance gene haplotype CHS1-mut2 in the precise monitoring of etoxazole resistance.

[0025] The gene sequence of CHS1-mut2 was sequenced, and its nucleotide sequence is shown in SEQ ID NO1: SEQ ID NO.1: CAGATTCTGGTTGCACAAATAATGTCCGCTTGTTATGCACTGCTCATGATGGCTGTCTTTGTTGGTACCGCTATTCAAATGGCTGAAGATGGTGTTACTTCACCGTCTGCCGTATTTTTCATAGCTTTATCTGGGTCTTTTGT AGTGGCGGCACTGCTTCATCCACAAGAGTTTCACTGTTTATATCCATGTTTACTTTATTTCCTTTTCATTTCCATGCATGTACCTTCTACTTATGATCTATTCTCTGGTCAACTTGAACGTTGTTACTTGGGGAACACGTGAAG.

[0026] Due to the long-term and extensive use of acaricides, two-spotted spider mites have developed resistance to an increasing number of agents, leading to reduced or even ineffective control and failure to effectively manage the mite infestation. Monitoring spider mite resistance in the field can clarify their current resistance status to commonly used pesticides, allowing for scientific and rational guidance in pesticide application, slowing the development of resistance, extending the lifespan of pesticides, and achieving long-term, highly effective control of the mites. Etoxazole is a commonly used acaricide, primarily controlling mite eggs, and its target is chitin synthase 1. With the widespread use of etoxazole, the two-spotted spider mite has gradually developed severe resistance. A population of two-spotted spider mites exhibiting severe etoxazole resistance was investigated.

[0027] 1. Detection Method 1.1 Dose-response method The dose-response test is a classic bioassay method that can directly and accurately reflect the resistance level of mites. By setting a series of doses to control the mortality rate of mites between 5% and 95%, the LC50 of the mites can be obtained based on the correlation between the logarithm of the dose and the probability of death. 50 Common methods for dose-response bioassays of spider mites include leaf disc spraying, slide immersion, and pesticide film application.

[0028] The toxicity of six pesticides (etoxazole, cypermethrin, abamectin, pyridaben, etoxazole, and bifenazate) to Tetranychus bismuth subtilis eggs was determined using the leaf disc spraying method, and a baseline sensitivity of susceptible Tetranychus bismuth subtilis eggs to etoxazole was established. The steps are as follows: First, use a square punch with a length and width of 2 cm × 2 cm to punch small leaves of fresh, clean, and pesticide - free cowpea leaves into uniform sizes. Place a moist sponge in a petri dish with a diameter of 10 cm and cover it with filter paper. Place the leaves with the abaxial side up on the filter paper to make leaf discs. Then, use a small brush to pick 20 - 30 healthy adult female mites aged 3 - 5 days (the test mites for etoxazole are larvae) onto the leaf discs. Dilute the pesticide into 5 concentrations with distilled water and set a water control. Set 3 technical replicates for each concentration. Then, use a Potter spray tower to spray in the order of water control → low concentration → high concentration. The liquid spraying amount per dish is 1 mL. After the liquid medicine has settled for 30 s, take it out and transfer it to a constant - temperature light incubator at a temperature of 26 ± 1°C, a humidity of 55% - 75%, and a light cycle of 14 h : 10 h (L:D) for feeding and observation. After 24 h, microscopically examine the mortality rate of the mites. Gently touch the mite body with the tip of a brush. If it does not move or 1 - 2 pairs of legs tremble involuntarily, it is considered dead.

[0029] 1.2 Data analysis Use Polo Plus 2.0 software to calculate the slope ± standard error of the virulence regression equation, median lethal concentration (LC 50 ), 95% confidence interval, chi - square value (c 2 ), and lethal concentration at 99% mortality rate (LC 99 ).

[0030] The formula for calculating the resistance ratio (RR) of the field population of spider mites is: Resistance ratio = LC value of the field population / LC value of the sensitive population 50 50 value The evaluation of the resistance level by the dose - response method follows the grading standard of Liu Fengyi et al. (2010): sensitive (RR ≤ 3), decreased sensitivity (3 < RR ≤ 5), low - level resistance (5 < RR ≤ 10), medium - level resistance (10 < RR ≤ 40), high - level resistance (40 < RR ≤ 160), extremely high - level resistance (RR > 160).

[0031]

[0031] 2. Detection techniques Target mutation is one of the most important mechanisms causing mite resistance. Based on molecular biology techniques, detecting the resistance point mutation frequency of the target gene of spider mites to evaluate the resistance level of spider mites has become an effective way for field resistance monitoring of spider mites. As the cost of high - throughput sequencing becomes lower and lower, amplicon sequencing has stood out in molecular detection techniques due to its advantages such as low cost, high throughput, and the ability to simultaneously detect target mutations in dozens to hundreds of population samples.

[0032] For highly resistant populations, resistance is typically mediated by target mutations. Examination of the chitin synthase 1 gene resistance mutation (I1017F mutation) in these highly resistant populations revealed that Tu-YN was sensitive to etoxazole, with a very low frequency of resistance mutations, and bioassays also indicated its sensitivity to etoxazole. In populations resistant to etoxazole, the frequency of resistance mutations was significantly increased, indicating a close correlation between target mutations and etoxazole resistance.

[0033] To target the main mutation sites associated with chitin synthase 1 and high-level resistance in spider mites, a rapid detection method for spider mite gene mutations using amplicon sequencing technology based on a next-generation sequencing platform was established, and the accuracy of this technology in detecting gene mutation frequency was verified.

[0034] 2.1 Experimental Methods 2.1.1 Preparation of Commonly Used Reagents (1) SDS extraction solution: 200mM Tris-HCl, 400mM NaCl, 10mM EDTA, 2% SDS, pH 8.2; (2) 1.5% agarose gel: Dissolve 0.3g agarose in 20mL of 1×TAE solution and heat in a microwave oven until boiling. Add 0.2μL of nucleic acid dye, mix well, pour into a mold and let it cool and solidify.

[0035] 2.1.2 Extraction of Tetranychus genomic DNA (gDNA) (1) Take 100 healthy female adult mites aged 3-5 days into a 1.5 mL enzyme-free centrifuge tube, add 100 μL of SDS extraction solution and grind thoroughly, then rinse the grinding rod with 593 μL of SDS extraction solution; (2) Add 7 μL of proteinase K (final concentration 100 ug / mL) and incubate in a water bath at 60℃ for 3-4 h; (3) Add 2.1 μL of RNase A (final concentration 30 ug / mL), and incubate in a water bath at 37°C for 30 min; (4) Transfer the homogenate to a 2 mL enzyme-free centrifuge tube, add 700 μL of DNA extraction buffer (phenol: chloroform: isoamyl alcohol = 25: 24: 1), and mix by inverting the tube. (5) Centrifuge at 12000 rpm for 5 min at room temperature; (6) Transfer the supernatant to a 1.5 mL enzyme-free centrifuge tube; (7) Add an equal volume of chloroform:isoamyl alcohol (49:1) and mix by inverting the container. (8) Centrifuge at 12000 rpm for 5 min at room temperature; (9) Transfer the supernatant to a 1.5 mL enzyme-free centrifuge tube; (10) Add 2 to 2.5 times the volume of pre-cooled anhydrous ethanol, slowly invert several times until mixed, and place at -20℃ for 30 min; (11) Centrifuge at 4℃ and maximum speed for 20 min; (12) Remove the supernatant and wash the precipitate twice with 500 μL of pre-cooled 70% ethanol; (13) Centrifuge at 12000 rpm for 10 min, remove the supernatant, and air-dry the precipitate at room temperature; (14) Add 32 μL of Nuclease-Free Water to dissolve the precipitate and store it in a -20°C refrigerator.

[0036] Table 1: Data on etoxazole detection in highly resistant populations

[0037] 2.1.3 Primer Design The target genes and mutation sites of the spider mites detected are shown in Table 2. Primers were designed using the NCBI Primer BLAST software based on the sequences and mutation sites of each target gene. The primer amplification fragments contained the mutation sites. In addition, to distinguish different populations, specific 8bp tag sequences corresponding to specific field populations were added to the 5' ends of both upstream and downstream primers. Primer information is shown in Table 2.

[0038] Table 2 shows the primers used to determine the chitin synthase 1 gene in different field populations. At the same time, according to Figure 1 The resistance level of the two-spotted spider mite to etoxazole is not directly proportional to the frequency of resistance gene mutations (dots), but is directly proportional to a specific resistance gene haplotype (squares). Therefore, the resistance gene haplotype CHS1-mut2 is considered a molecular marker for monitoring etoxazole resistance.

[0039] 2.1.4 PCR amplification of target gene fragments containing mutation sites The PCR reaction system and reaction conditions are shown in Tables 3 and 4: Table 3 PCR reaction system

[0040] Table 4 PCR reaction conditions

[0041] 2.1.5 PCR product recovery PCR products were recovered using a universal DNA purification and recovery kit, following the instructions in the kit's manual. The specific steps are as follows: (1) Gel cutting: Separate the PCR products by agarose gel electrophoresis, cut the single target DNA band from the gel under UV light, put it into a 1.5mL centrifuge tube, and weigh it; (2) Sol: Add 100 μL of PC solution to every 100 mg of gel, heat in a 50°C metal bath until the gel is completely dissolved, and invert the centrifuge tube every 2-3 minutes to ensure that the gel is fully dissolved; (3) Column equilibration: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12000 rpm for 1 min, and discard the filtrate; (4) Add the dissolved gel mixture to the adsorption column CB2, centrifuge at 12000 rpm for 1 min, and discard the filtrate; (5) Add 600 μL of washing solution PW to the adsorption column CB2, let stand for 2 min, centrifuge at 12000 rpm for 1 min, and discard the filtrate; (6) Repeat step (5); (7) Centrifuge at 12000 rpm for 2 min, and place the adsorption column CB2 at room temperature for several minutes until it is completely dry; (8) Place the adsorption column CB2 into a new 1.5 mL centrifuge tube, add 30 μL of elution buffer EB to the center of the adsorption column, and let it stand at room temperature for 2 min. (9) Centrifuge at 12000 rpm for 2 min and collect the DNA solution; (10) Determine DNA concentration and store at -20℃.

[0042] 2.2 Amplicon Sequencing and Sequencing Data Processing 2.2.1 Construction of sequencing libraries and sequencing (1) Sample preparation: 100 healthy female adult mites aged 3-5 days were selected from each spider mite population as a sample for genomic DNA extraction and PCR amplification. The PCR product of each sample was diluted to 100 ng / μL, and 20-21 samples were mixed in equal volumes into a 1.5 mL centrifuge tube. (2) Library construction: In order to reduce the deviation of sequencing results caused by the introduction of mismatched bases and amplification bias during PCR amplification, PCR-free library construction was adopted. TruSeq DNA PCR-free Kits (Illumina, San Diego, CA, USA) were used for library construction.

[0043] (3) Sequencing: The NovaSeq 6000 sequencer on the Illumina sequencing platform was used, and the PE250 sequencing strategy was adopted.

[0044] 2.2.2 Quality Control of Sequencing Raw Data Paired-end sequencing was used, resulting in two FASTQ files for each sample in the raw sequencing data, yielding a total of 11.61G of raw data. To perform in-depth analysis, the raw data first underwent quality control, with the following standards: (1) When the N content in any sequencing read exceeds 10% of the base number of that read, remove this paired read; (2) If the number of low-quality (Q ≤ 5) bases in any sequencing read exceeds 50% of the total number of bases in that read, remove the paired reads. (3) If any sequencing read contains an adapter sequence, remove the paired read.

[0045] After quality control filtering, 11.11G of clean data was obtained for subsequent analysis.

[0046] 2.2.3 Paired-end sequence splicing The FASTQ files in the Clean data were spliced ​​using pandaseq 2.11 software, and the resulting spliced ​​sequence was a FASTA file.

[0047] 2.2.4 Sample Splitting The Seqtk software was used to perform reverse complementation on the sequences. Simultaneously, based on the specific tag sequences of the spider mite populations, the grep command on a Linux system (Ubuntu 20.04 LTS) was used to split the sequences of different populations and remove chimeras. Then, the Seqtk software was used again to remove an 8bp tag sequence.

[0048] 2.2.5 Haplotype Statistics The FASTX-Toolkit software was used to count the number of various haplotypes. Since adult female spider mites are diploid organisms, the frequency of haplotypes must be greater than 1 / 2n (n: the number of mites used to extract gDNA).

[0049] The preferred embodiments of the present invention disclosed above are merely illustrative of the invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the invention to the specific implementations described. Clearly, many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention. The invention is limited only by the claims and their full scope and equivalents.

Claims

1. A resistance gene haplotype CHS1-mut2, characterized in that, The nucleotide sequence of the haplotype CHS1-mut2 is shown in SEQ ID No 1.

2. Use of the resistance gene haplotype CHS1-mut2 according to claim 1 for the precise monitoring of resistance to ethiprole, characterized in that, The steps are as follows: The toxicity of the ethyl abamectin to the eggs of T. urticae was determined by the leaf disc spray method, and the sensitive baseline of the eggs of the sensitive population of T. urticae to the ethyl abamectin was established. The genome DNA of the spider mites was extracted. The target genes and mutation sites of the spider mites were detected.

3. Use of the resistance gene haplotype CHS1-mut2 according to claim 2 for the precise monitoring of resistance to ethiprole, characterized in that, The toxicity of the ethyl abamectin to the eggs of T. urticae was determined by the leaf disc spray method, and the sensitive baseline of the eggs of the sensitive population of T. urticae to the ethyl abamectin was established. Fresh, clean and non-contaminated cowpea leaves were punched into small leaves with a square puncher with a length and width of 2 cm x 2 cm; A piece of wet sponge was placed in a culture dish and covered with filter paper, and the leaf disc was prepared by placing the leaf back on the filter paper; 20-30 3-5 day old juvenile mites were picked up on the leaf disc with a small brush; The pesticide was diluted with distilled water into 5 concentrations, and a water control was set up; The spray tower was sprayed in the order of water control, low concentration and high concentration; After the pesticide solution was settled for 30 s, it was taken out and transferred to a constant temperature and light incubator with a temperature of 26±1℃, a humidity of 55%-75% and a light cycle of 14h:10h (L:D) for feeding and observation; After 24 h, the mortality of the spider mites was observed under a microscope, and the mite body was gently touched with a brush tip. If it was not moving or 1-2 pairs of legs were not moving, it was considered dead.

4. The use of the resistance gene haplotype CHS1-mut2 according to claim 2 for the precise monitoring of resistance to ethiprole, characterized in that, The target genes and mutation sites of the spider mites were detected, and primers were added according to the sequences of the target genes and the mutation sites. The primer amplification fragment contained the mutation site.

5. Use of the resistance gene haplotype CHS1-mut2 according to claim 4 for the precise monitoring of resistance to etoxazole, characterized in that, In order to distinguish different populations, specific 8bp tag sequences were added to the upstream and downstream primers corresponding to specific field populations.

6. The use of the resistance gene haplotype CHS1-mut2 according to claim 2 for the precise monitoring of resistance to ethiprole, characterized in that, The target genes and mutation sites of the spider mites were detected, and whether the resistance level of T. urticae to ethyl abamectin was proportional to the specific resistance gene haplotype was determined to judge whether it could monitor the resistance of ethyl abamectin. If the resistance level of T. urticae to ethyl abamectin is proportional to the specific resistance gene haplotype, it can monitor the resistance of ethyl abamectin.

Images