Application of limonin compound or medicinal derivative thereof in preparation of medicine for preventing or treating inflammation

Abstract

The invention relates to the field of natural products, and relates to application of limonin compounds or medicinal derivatives thereof in preparation of medicines for preventing or treating inflammation. The inventor of the invention finds for the first time that the compound I or the compound II extracted and separated from the mallotus oblongifolius can significantly inhibit the content of inflammatory factors of immune cells at an extremely low concentration, and can be used for preparing medicines for preventing or treating inflammation. Besides, the compound I or II can significantly reduce the expression level of LPS-induced inflammatory factors TNF-alpha, IL-1alpha, IL-1beta, IL-6 and IL-18 at a low concentration, and does not affect the survival of immune cells, which proves that the compound I or II can inhibit the expression of inflammatory factors and has a strong anti-inflammatory effect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of natural products, and relates to application of limonoids or a pharmaceutical derivative thereof in preparation of a medicine for preventing or treating inflammation. BACKGROUND

[0002] Inflammation, as the core defense mechanism of the body against injury or infection, its chronic process may trigger tissue fibrosis, autoimmune diseases and even malignant tumors, and has become a major challenge in the field of global health. In the field of anti-inflammatory drug research and development, significant progress has been made in the past two decades: from traditional therapies such as non-steroidal anti-inflammatory drugs (NSAIDs) to biological agents and small molecule inhibitors targeting cytokine pathways such as TNF-α, IL-1α and IL-6, and multi-target intervention strategies have gradually become a new paradigm for treatment. It is worth noting that natural products have always been an important source of drug development due to their multi-component synergistic effect, broad spectrum regulation potential and lower toxicity and side effects. Data shows that among the 89 anti-inflammatory drugs currently in clinical use, 65% are small molecule drugs, and 72% of them are directly derived from plant extracts or microbial metabolites. This phenomenon highlights the irreplaceability of natural products in the development of new anti-inflammatory active molecules, and also provides a key direction for the prevention and treatment of inflammation-related diseases in the future.

[0003] Trichilia connaroides belongs to the family Meliaceae and the genus Trichilia, and is mainly distributed in Guangdong, Guangxi and Yunnan, China. Studies have shown that the plant is rich in limonoids, a class of complex triterpenoid derivatives, with highly oxidized carbon skeletons and often modified with furan or lactone rings, showing significant chemical diversity. Currently, more than a hundred such components have been isolated from the roots, stems, barks, leaves and fruits of Trichilia connaroides, and they have a wide range of biological activities, including cytotoxicity, anti-inflammatory, antibacterial and insect antifeeding effects. The structural specificity and functional diversity of these compounds make them have important development value in the fields of medicine and agriculture. Different limonoids have many differences in biological activities.

[0004] The present application found that two of the four new limonoids extracted from Trichilia connaroides have strong inhibitory effect on the release of multiple inflammatory factors. SUMMARY

[0005] The present application aims to provide the application of limonoids or a pharmaceutical derivative thereof in preparation of a medicine for preventing or treating inflammation. The compounds provided by the present application have significant inhibitory effect on the synthesis and release of inflammatory factors in immune cells, and can be used as anti-inflammatory drugs for the treatment of inflammation-related diseases.

[0006] The technical scheme of the present application is as follows: The application provides application of limonoids or pharmaceutically acceptable derivatives thereof in preparation of a medicine for preventing or treating inflammation, wherein the medicine takes limonoids or pharmaceutically acceptable derivatives thereof as an active ingredient, and the limonoids are selected from compounds I with a structural formula as shown in formula I or compounds II with a structural formula as shown in formula II. .

[0007] Further, in the application, the pharmaceutically acceptable derivatives are pharmaceutically acceptable salts, esters or stereoisomers of the compounds I or the compounds II.

[0008] Further, in the application, the percentage content of the active ingredient in the total mass of the medicine is 0.1% to 99.9%.

[0009] Further, in the application, the active ingredient can be combined with a pharmaceutically acceptable carrier to prepare a medicine preparation convenient for administration. The pharmaceutically acceptable carrier includes but is not limited to diluents, absorption promoters, surfactants, preservatives, lubricants, binders, disintegrants, solvents or coating materials, etc. The dosage form of the medicine preparation can be selected according to the administration route, for example, oral preparations or injection preparations for systemic administration, or external preparations or inhalation preparations for local administration, etc.

[0010] Further, in the application, the active ingredient can be used alone or in combination with other medicines. The purpose of combination therapy mainly includes enhancing the therapeutic effect, reducing the single drug dose, reducing the occurrence of adverse reactions or delaying the generation of drug resistance, etc.

[0011] The application has the following beneficial effects: The inventors of the application first find that the compounds I or the compounds II extracted and separated from the bird's eye flower can significantly inhibit the content of inflammatory factors of immune cells at a very low concentration, and can be used for preparing a medicine for preventing or treating inflammation.

[0012] As can be seen from Example 2, the compound I significantly inhibits the expression of inflammatory factors induced by LPS at a very low concentration (2.5 nM, 10 nM treatment), and reduces the IL-6 and IL-1β levels secreted into the culture medium of THP-1 cells induced by LPS in a concentration gradient-dependent manner. It can be seen that the compound I has very strong anti-inflammatory activity. The compound II significantly inhibits the expression of inflammatory factors induced by LPS at a very low concentration (1 nM, 10 nM treatment), and reduces the IL-6 and IL-1β levels secreted into the culture medium of THP-1 cells induced by LPS in a concentration gradient-dependent manner. It can be seen that the compound II has very strong anti-inflammatory activity.

[0013] As can be seen from Example 3, compounds I or II significantly reduce the expression levels of LPS-induced inflammatory factors TNF-a, IL-1a, IL-1b, IL-6 and IL-18 at lower concentrations, and do not affect the survival of immune cells, proving that compounds I or II can inhibit the expression of inflammatory factors, and have strong anti-inflammatory effects. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 The structures of the four limonoids compounds in the present application.

[0015] Figure 2 The effects of the four limonoids compounds in the present application on the RNA contents of inflammatory factors in immune cells. Wherein, A represents the effects of the four limonoids compounds on the RNA content of human interleukin 1a (IL-1a) in immune cells THP-1; B represents the effects of the four limonoids compounds on the RNA content of human interleukin 1b (IL-1b) in immune cells THP-1. Figure 2 The middle ordinate represents the RNA levels of inflammatory factors in immune cells, and the abscissa represents the treatment conditions, * represents p < 0.05, ** represents p < 0.01, and *** represents p < 0.001. The leftmost bar chart in the figure represents the control group without adding compound I and LPS (lipopolysaccharide) (DMSO). The treatment concentration of LPS in the figure is 10 μg / mL.

[0016] Figure 3 The effects of limonoids compounds I and II on the viability of THP-1 cells. ns represents no significant difference. The leftmost bar chart in the figure represents the control group without adding compound I or II.

[0017] Figure 4 The protein content determination results of inflammatory factors secreted by immune cells THP-1 treated with limonoids compound I. Wherein, A represents the effects of compound I on the protein content of human interleukin 6 (IL-6) secreted by immune cells THP-1; B represents the effects of compound I on the protein content of human interleukin 1b (IL-1b) secreted by immune cells THP-1. Figure 4 The middle ordinate represents the protein content of inflammatory factors secreted by immune cells, and the abscissa represents the treatment conditions, ** represents p < 0.01, and *** represents p < 0.001. The leftmost bar chart in the figure represents the control group without adding compound I and LPS.

[0018] Figure 5This image shows the results of measuring the protein content of inflammatory factors secreted by immune cells THP-1, using limonene compound II. In this image, A represents the effect of compound II on the protein content of human interleukin-6 (IL-6) secreted by immune cells THP-1; B represents the effect of compound II on the protein content of human interleukin-1β (IL-1β) secreted by immune cells THP-1. Figure 5 The vertical axis represents the protein content of inflammatory factors secreted by immune cells, and the horizontal axis represents the treatment conditions (** represents p<0.01, *** represents p<0.001). The leftmost bar in the figure represents the control group without compound II and LPS.

[0019] Figure 6 The effect of compound I of the present invention on the RNA content of inflammatory factors in immune cells and its half-maximal inhibitory concentration (IC50) 50 The results were calculated as follows: A represents the effect of compound I on the RNA content of IL-6 in THP-1 immune cells; B represents the effect of compound I on the RNA content of IL-1β in THP-1 immune cells; C represents the effect of compound I on the RNA content of IL-1α in THP-1 immune cells; D represents the effect of compound I on the RNA content of TNF-α in THP-1 immune cells; and E represents the effect of compound I on the RNA content of human interleukin-18 (IL-18) in THP-1 immune cells. Figure 6 The vertical axis represents the RNA content of inflammatory factors in immune cells, and the horizontal axis represents the treatment conditions. ns indicates no significant difference, * represents p<0.05, ** represents p<0.01, *** represents p<0.001, and **** represents p<0.0001. The leftmost bar in the figure represents the control group without compound I and LPS.

[0020] Figure 7 The effect of compound II of this invention on the RNA content of inflammatory factors in immune cells and its half-maximal inhibitory concentration (IC50) 50 The results were calculated as follows: A represents the effect of compound II on the RNA content of IL-6 in THP-1 immune cells; B represents the effect of compound II on the RNA content of IL-1β in THP-1 immune cells; C represents the effect of compound II on the RNA content of IL-1α in THP-1 immune cells; D represents the effect of compound II on the RNA content of TNF-α in THP-1 immune cells; and E represents the effect of compound II on the RNA content of human interleukin-18 (IL-18) in THP-1 immune cells. Figure 7The middle ordinate represents the RNA content of inflammatory factors in immune cells, the abscissa represents the treatment condition, ns represents no significant difference, * represents p<0.05, ** represents p<0.01, *** represents p<0.001, **** represents p<0.0001. The leftmost column chart in the figure represents the control group without adding compound II and LPS. DETAILED DESCRIPTION

[0021] The sesquiterpenoids I-IV are separated and purified from Bauhinia championii Benth. The separation methods of compounds I, II, III and IV are referred to Chinese patents CN202510828220.1 and CN202411239773.5.

[0022] The structural formulas of compounds I, II, III and IV are shown in formula I, II, III and IV respectively: .

[0023] The human immune cells used in the following experiments are human immune cells THP-1, which are purchased from ATCC cell library, and the item number is TIB-202.

[0024] Unless otherwise specified, the reagents used in the embodiments of the present application can be purchased through commercial channels. RPMI 1640 medium, LPS and fetal bovine serum are purchased from Gibco Company. The ELISA kit used for detecting immune factors in cell culture medium is purchased from Shanghai Dumax Biotechnology Co., Ltd., and the item numbers are DM4670 (human interleukin 6 ELISA kit), DM4708 (human interleukin 1β ELISA kit) respectively.

[0025] The cell strains are cultured in RPMI1640 medium containing 10% fetal bovine serum at 37℃, 5% CO2 and 90% humidity.

[0026] The RT-qPCR primer sequences involved in the embodiments are as follows: TNF-α: Forward: SEQ ID NO. 15'-CCTCTCTCTAATCAGCCCTCTG-3', Reverse: SEQ ID NO. 25'-GAGGACCTGGGAGTAGATGAG-3'; IL-1α: Forward: SEQ ID NO. 35'-AGATGCCTGAGATACCCAAAACC-3', Reverse: SEQ ID NO. 45'-CCAAGCACACCCAGTAGTCT-3'; IL-18: Forward: SEQ ID NO.5 5'- TCTTCATTGACCAAGGAAATCGG -3', Reverse: SEQ ID NO.6 5'- TCCGGGGTGCATTATCTCTAC -3'; IL-6: Forward: SEQ ID NO.7 5'-TAGTCCTTCCTACCCCAATTTCC -3', Reverse: SEQ ID NO.8 5'-TTGGTCCTTAGCCACTCCTTC-3'; IL-1β: Forward: SEQ ID NO.9 5'- TGGACCTTCCAGGATGAGGACA -3', Reverse: SEQ ID NO.10 5'- GTTCATCTCGGAGCCTGTAGTG -3'; 18S: Forward: SEQ ID NO.11 5'- CCTGAGAAACGGCTACCACATC -3', Reverse: SEQ ID NO.12 5'- GCCTCGAAAGAGTCCTGTATTG -3'.

[0027] The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0028] Example 1: Determination of the anti-inflammatory activity of four limonene compounds Will Figure 1 Compounds I, II, III, and IV were dissolved in DMSO (dimethyl sulfoxide) and then prepared into solutions with a concentration of 5 or 80 nM (compounds I and II were prepared to a final concentration of 5 nM, and compounds III and IV were prepared to a final concentration of 80 nM). These solutions were used as test solutions. To detect the anti-inflammatory activity of compounds I, II, III, and IV, the following experiment was performed: THP-1 immune cells were treated with lipopolysaccharide (LPS) for 24 h, then the THP-1 cells were transformed into inflammatory cells. Compounds I or II were added and treated for 12 h. RNA was extracted, and then RT-qPCR was performed to detect the levels of 18S, IL-1α, and IL-1β. 18S was used as an internal control for statistical analysis.

[0029] The test results are as follows: Figure 2 A and Figure 2B shows that compounds I and II significantly reduce the expression levels of LPS-induced inflammatory factors IL-1a and IL-1b at a concentration of 5 nM, proving that compound I or II can inhibit the expression of inflammatory factors and has strong anti-inflammatory effect. While compounds III or IV cannot reduce the expression levels of LPS-induced inflammatory factors IL-1a and IL-1b at a concentration of 80 nM, but further promote the expression levels of inflammatory factors IL-1a and IL-1b, indicating that compounds III or IV have no anti-inflammatory activity. It is proved that limonoids with the same or similar mother nucleus structure do not necessarily have the same activity.

[0030] Example 2 Cell proliferation detection of immune cells by limonoids compounds I and II In order to detect whether compound I or II itself can cause cell damage and death, CCK8 kit is used to detect cell viability. CCK8 method is used to detect cell growth inhibition. CCK-8 experiment, full name Cell Counting Kit-8, is a commonly used method for detecting cell proliferation and cytotoxicity. The principle of CCK-8 experiment is based on compound WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid phenyl)-2H-tetrazole monosodium salt). In the presence of electron carrier 1-methoxy PMS (phosphoric acid methoxy naphthoquinone), WST-8 can be reduced by mitochondrial dehydrogenase in cells to generate highly water-soluble orange yellow formazan product. The amount of formazan generated is proportional to the number of living cells, and the color depth can reflect the metabolic activity of cells. The absorbance can be measured by microplate reader at 450 nm wavelength, which can indirectly reflect the number of living cells. Therefore, CCK-8 can be used to evaluate cell proliferation, cytotoxicity or cell effect of drugs.

[0031] The specific steps of CCK8 are as follows: when CCK-8 detection is performed, 3x10 5 cells (THP-1 cells) are inoculated into 5 repeated holes in a 96-well plate with 90 µL of culture solution, and after 24 hours of culture, the cells are treated with different concentrations of compound I and LPS. After 48 hours of treatment, 10 µL of CCK-8 reagent is added to each hole, and then the 96-well plate is incubated at 37 ℃ for 1 hour. The absorbance is measured by microplate reader at 450 nm wavelength. The average OD value of each hole is calculated, and the change of cell proliferation or activity is analyzed by comparison with the control group (without compound I and LPS). The percentage of absorbance value of experimental group relative to that of control group represents the survival rate or proliferation level of cells, i.e. the control group is set as 100%.

[0032] The test results are as follows: Figure 3It is shown that compound I or II (40 nM, 20 nM, 10 nM) does not inhibit the viability of THP-1 cells. It can be seen that compound I or II has good tolerance and does not inhibit the growth of immune cells. ns represents no statistical difference.

[0033] Example 3 Effect of limonoids I and II on extracellular inflammatory factors In order to further detect the anti-inflammatory activity of compound I or II, whether compound II or II affects the IL-6 and IL-1β levels secreted by immune cells THP-1 is tested by ELASA kit. The specific experimental steps are: after LPS treatment of THP-1 cells for 24 h, compound I or II is added to treat the cells for 12 h, the treated cell suspension is collected, the supernatant is taken after centrifugation and the precipitate is discarded, and the IL-6 and IL-1β levels secreted by THP-1 cells are detected according to the steps of ELASA kit instruction book Figure 4 and Figure 5 The ordinate in the middle represents the expression level of inflammatory factors, and the abscissa represents the treatment condition. ** represents p<0.01, and *** represents p<0.001.

[0034] The test results are as follows: Figure 4 It is shown that compound I at very low concentration (2.5 nM, 10 nM treatment) significantly inhibits the expression of LPS-induced inflammatory factors, and reduces the IL-6 and IL-1β levels secreted by LPS-induced THP-1 cells into the culture medium in a concentration gradient-dependent manner. It can be seen that compound I has very strong anti-inflammatory activity.

[0035] Figure 5 It is shown that compound II at very low concentration (1 nM, 10 nM treatment) significantly inhibits the expression of LPS-induced inflammatory factors, and reduces the IL-6 and IL-1β levels secreted by LPS-induced THP-1 cells into the culture medium in a concentration gradient-dependent manner. It can be seen that compound II has very strong anti-inflammatory activity.

[0036] Example 3 IC of limonoids I and II for inhibiting the expression of inflammatory factors 50 Calculation TNF-a is a core driver and key regulator of inflammatory response, mainly produced by activated immune cells, which strongly initiates and amplifies local and systemic inflammatory response through mechanisms such as activation of vascular endothelial cells, recruitment and activation of leukocytes, induction of release of other pro-inflammatory mediators, etc., which is essential for the body to resist infection and repair damage; however, its excessive or persistent production will disrupt the balance between pro-inflammatory and anti-inflammatory, leading to tissue damage, and become the core culprit of pathological damage of various chronic inflammatory diseases (such as rheumatoid arthritis, inflammatory bowel disease), which also makes it a revolutionary anti-inflammatory therapeutic target. IL-6 is an early marker of inflammation in inflammatory response, and its level in the serum of patients with various autoimmune diseases such as rheumatoid arthritis, psoriasis and systemic lupus erythematosus is usually higher. IL-1β plays an important role in the pathogenic process of acute and chronic inflammation, and is closely related to the pathological process of diabetes, rheumatoid arthritis and periodontitis. IL-1a is a key pro-inflammatory cytokine that plays a pioneer and core driver role in the initiation and amplification of inflammatory response. Continuous action of IL-1a will aggravate inflammation and cause pathological damage. IL-18 is a pleiotropic pro-inflammatory cytokine that is over-activated in chronic inflammation (such as rheumatoid arthritis, inflammatory bowel disease) or autoimmune diseases, which can cause tissue damage. Therefore, TNF-a, IL-1a, IL-1β, IL-6 and IL-18 are important inflammatory targets.

[0037] In order to further detect the anti-inflammatory activity of compound I, IC 50 , the following test was carried out: after treating immune cells THP-1 cells with lipopolysaccharide LPS for 24 h, the THP-1 cells were transformed into inflammatory cells releasing inflammatory factors, compound I was added for 12 h, RNA was extracted, and then RT-qPCR experiment was carried out to detect the contents of 18S, TNF-a, IL-1β, IL-1a, IL-6 and IL-18, and 18S was used as an internal reference for statistical analysis.

[0038] The experimental results are as follows: Figure 6 A shows that the mRNA expression level of inflammatory factor IL-6 is induced to increase after treating THP-1 cells with lipopolysaccharide LPS, and compound I can significantly reduce the mRNA content of LPS-induced inflammatory factor IL-6, and the IC 50 of compound I to inhibit IL-6 is 3.99 nM.

[0039] Figure 6 B shows that the mRNA expression level of inflammatory factor IL-1β is induced to increase after treating THP-1 cells with lipopolysaccharide LPS, and compound I can significantly reduce the mRNA content of LPS-induced inflammatory factor IL-1β, and the IC 50 of compound I to inhibit IL-1β is 1.21 nM.

[0040] Figure 6 C shows that the mRNA expression level of inflammatory factor IL-1a is increased after THP-1 cells are treated with lipopolysaccharide LPS, and compound I significantly reduces the mRNA content of inflammatory factor IL-1a induced by LPS, and the IC of compound I inhibiting IL-1a is 50 5.08 nM.

[0041] Figure 6 D shows that the mRNA expression level of inflammatory factor TNF-a is increased after THP-1 cells are treated with lipopolysaccharide LPS, and compound I significantly reduces the mRNA content of inflammatory factor TNF-a induced by LPS, and the IC of compound I inhibiting TNF-a is 50 4.53 nM.

[0042] Figure 6 E shows that the mRNA expression level of inflammatory factor IL-18 is increased after THP-1 cells are treated with lipopolysaccharide LPS, and compound I significantly reduces the mRNA content of inflammatory factor IL-18 induced by LPS, and the IC of compound I inhibiting IL-18 is 50 3.27 nM.

[0043] In order to further detect the IC of anti-inflammatory activity of compound II 50 , the following test is carried out: after immune cells THP-1 cells are treated with lipopolysaccharide LPS for 24 h, the THP-1 cells are converted into inflammatory cells releasing inflammatory factors, compound II is added for 12 h, RNA is extracted, and then RT-qPCR experiment is carried out to detect the contents of 18S, TNF-a, IL-1b, IL-1a, IL-6 and IL-18, and 18S is used as an internal reference for statistical analysis.

[0044] The experimental results are as follows: Figure 7 A shows that the mRNA expression level of inflammatory factor IL-6 is increased after THP-1 cells are treated with lipopolysaccharide LPS, and compound II can significantly reduce the mRNA content of inflammatory factor IL-6 induced by LPS, and the IC of compound II inhibiting IL-6 is 50 3.38 nM.

[0045] Figure 7 B shows that the mRNA expression level of inflammatory factor IL-1b is increased after THP-1 cells are treated with lipopolysaccharide LPS, and compound II significantly reduces the mRNA content of inflammatory factor IL-1b induced by LPS, and the IC of compound II inhibiting IL-1b is 50 18.41 nM.

[0046] Figure 7C shows that the mRNA expression level of inflammatory factor IL-1a is increased after THP-1 cells are treated with lipopolysaccharide LPS, and compound II significantly reduces the mRNA content of LPS-induced inflammatory factor IL-1a, and the IC of compound II inhibiting IL-1a is 50 9.68 nM.

[0047] Figure 7 D shows that the mRNA expression level of inflammatory factor TNF-a is increased after THP-1 cells are treated with lipopolysaccharide LPS, and compound II significantly reduces the mRNA content of LPS-induced inflammatory factor TNF-a, and the IC of compound II inhibiting TNF-a is 50 10.43 nM.

[0048] Figure 7 E shows that the mRNA expression level of inflammatory factor IL-18 is increased after THP-1 cells are treated with lipopolysaccharide LPS, and compound II significantly reduces the mRNA content of LPS-induced inflammatory factor IL-18, and the IC of compound II inhibiting IL-18 is 50 9.95 nM.

[0049] In summary, compound I or II can significantly reduce the expression level of LPS-induced inflammatory factors TNF-a, IL-1a, IL-1b, IL-6 and IL-18 at a lower concentration, and does not affect the survival of immune cells, proving that compound I or II can inhibit the expression of inflammatory factors, and has strong anti-inflammatory effect.

[0050] In summary, compound I or II has very strong anti-inflammatory effect, and can effectively inhibit the expression and release of inflammatory factors TNF-a, IL-1a, IL-1b, IL-6 and IL-18 at a very low concentration.

[0051] It should be noted that the above-described examples are only used to explain the present application and do not constitute any limitation on the present application. The present application is described by referring to typical examples, but it should be understood that the words used therein are descriptive and explanatory words, rather than limiting words. Modifications can be made to the present application within the scope of the claims of the present application, and the present application can be revised without departing from the scope and spirit of the present application. Although the present application described therein relates to specific methods, materials and examples, it does not mean that the present application is limited to the specific examples disclosed therein, on the contrary, the present application extends to all other methods and applications having the same function.

Claims

1. The use of limonene compounds or their pharmaceutical derivatives in the preparation of drugs for the prevention or treatment of inflammation, characterized in that, The drug uses limonene compounds or their pharmaceutical derivatives as the active pharmaceutical ingredient, wherein the limonene compounds are selected from compound I with structural formula I or compound II with structural formula II. 。 2. The application according to claim 1, characterized in that, The pharmaceutical derivative is a pharmaceutically acceptable salt, ester, or stereoisomer of compound I or compound II.

3. The application according to claim 1, characterized in that, The percentage content of the active pharmaceutical ingredient in the total mass of the drug is from 0.1% to 99.9%.

4. The application according to claim 1, characterized in that, The active pharmaceutical ingredient is combined with a pharmaceutically acceptable carrier to form a pharmaceutical formulation that is easy to administer.

5. The application according to claim 4, characterized in that, The pharmaceutically acceptable carrier is selected from any one or more of the following carriers: diluent, absorption enhancer, surfactant, preservative, lubricant, binder, disintegrant, solvent or coating material.

6. The application according to claim 4, characterized in that, The dosage form of the pharmaceutical preparation is an oral or injectable preparation for systemic administration, or a topical or inhaled preparation for local administration.

7. The application according to claim 1, characterized in that, The active pharmaceutical ingredient may be used alone or in combination with other drugs.

Images