Application of ginseng glycosyl transferase UGT84K2 in improving abiotic stress resistance of plants
By overexpressing the ginseng glycosyltransferase UGT84K2 gene in plants, the problem of insufficient resistance of ginseng under adverse conditions was solved, its resistance to salt and drought stress was improved, chlorophyll stability and osmotic regulation capacity were enhanced, and antioxidant capacity was increased.
Patent Information
- Application Number
- CN202610006095.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-05
- Publication Date
- 2026-03-20
AI Technical Summary
Existing technologies have limited research on the resilience of ginseng under adverse conditions, and there is a lack of effective means to enhance its resistance to abiotic stresses.
By overexpressing the ginseng glycosyltransferase UGT84K2 gene in plants through genetic engineering, the salt and drought stress tolerance of plants can be regulated, thereby enhancing their stress resistance.
It enhanced the plant's resistance to salt and drought stress, improved the stability of chlorophyll content, enhanced osmotic regulation and antioxidant capacity, and promoted the plant's growth and survival under adverse conditions.
Smart Images

Figure CN121699985A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant genetic engineering, and in particular to the application of ginseng glycosyltransferase UGT84K2 in improving the resistance of plants to abiotic stress. BACKGROUND
[0002] The information disclosed in this Background section is only for the purpose of increasing an understanding of the general background of the application and does not necessarily constitute an acknowledgement or any form of suggestion that this information forms part of the prior art already known to a person of ordinary skill in the art.
[0003] Glycosyltransferases (GTs) are a class of enzymes widely present in the endoplasmic reticulum and Golgi apparatus, which are responsible for catalyzing glycosyltransfer reactions in organisms. Glycosyltransferases transfer sugar molecules from donors (usually ribonucleoside diphosphates) to other acceptor molecules (such as hormones, proteins, nucleic acids or other small molecule compounds) to form glycosylated products. Glycosyltransferases play a very key role in various physiological processes in organisms, including cell recognition, signal transduction, protein folding and stability, etc.
[0004] Ginseng is a plant of the genus Panax in the family Araliaceae. The dried roots and rhizomes of ginseng have pharmacological effects. Ginseng contains a variety of chemical components, the main components are ginsenosides, ginseng polysaccharides, volatile oils, proteins, amino acids, vitamins, organic acids, flavonoids, trace elements, sterols, lignin and polypeptides, etc. Ginseng has the effects of tonifying vital energy, restoring pulse and preventing collapse, tonifying the spleen and lung, generating fluid and nourishing blood, calming the mind and improving intelligence. Modern research has found that ginseng also has the effects of anti-tumor, delaying aging, enhancing memory, improving immunity, protecting cardiovascular and cerebrovascular system, reducing blood sugar, and antioxidant. Ginseng has high requirements for the growing environment, likes shade and dislikes strong light, likes cool and mild environment, and is relatively cold-resistant. The growth of ginseng is affected by adverse conditions such as drought, waterlogging, salinization, high temperature or low temperature.
[0005] At present, there are few studies on the stress resistance of ginseng. The study on the response of glycosyltransferases in ginseng under adverse conditions lays a foundation for later improvement of varieties by using genetic engineering techniques. SUMMARY
[0006] In order to overcome the above problems, the present application provides the application of ginseng glycosyltransferase UGT84K2 in improving the resistance of plants to abiotic stress.
[0007] In order to achieve the above technical purposes, the present application adopts the following technical solutions: In a first aspect of the present application, the application of ginseng glycosyltransferase UGT84K2 and biological materials related thereto in any of the following is provided: a1) application in regulating plant salt stress tolerance; a2) use in modulating plant tolerance to drought stress; a3) use in breeding transgenic plants with improved salt stress tolerance; a4) use in breeding transgenic plants with improved drought stress tolerance; The ginseng glycosyltransferase UGT84K2 is a protein as shown in b1) or b2) or b3) or b4) below: b1) a protein with an amino acid sequence as shown in SEQ ID NO: 2; b2) a fusion protein with a tag linked to the N-terminus and / or C-terminus of a protein as shown in SEQ ID NO: 2; b3) a protein with the same function as a protein with an amino acid sequence as shown in SEQ ID NO: 2, but with substitution, deletion or addition of one or several amino acid residues; b4) a protein with 75% or more homology to an amino acid sequence as shown in SEQ ID NO: 2 and with the same function.
[0008] In one or more embodiments, the biological material related to the ginseng glycosyltransferase UGT84K2 is any one of c1) to c9) below: c1) a nucleic acid molecule encoding the ginseng glycosyltransferase UGT84K2; the sequence of the nucleic acid molecule is as shown in SEQ ID NO: 1; c2) an expression cassette containing the nucleic acid molecule of c1); c3) a recombinant vector containing the nucleic acid molecule of c1) or containing the expression cassette of c2); c4) a recombinant microorganism containing the nucleic acid molecule of c1) or containing the expression cassette of c2) or containing the recombinant vector of c3); c5) a transgenic plant cell line containing the nucleic acid molecule of c1) or containing the expression cassette of c2); c6) a transgenic plant tissue containing the nucleic acid molecule of c1) or containing the expression cassette of c2); c7) a transgenic plant organ containing the nucleic acid molecule of c1) or containing the expression cassette of c2); c8) a nucleic acid molecule for increasing the expression of the ginseng glycosyltransferase UGT84K2; c9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule of c8).
[0009] In one or more embodiments, the modulation is promotion.
[0010] In one or more embodiments, the salt stress tolerance of the plant is reflected by any one of the following, d1) increasing the germination rate of the plant; d2) increasing the green seedling rate of the plant; d3) increasing the water loss rate of the in vitro leaf; d4) reducing the chlorophyll decline rate; d5) increasing the proline content; d6) increasing the green seedling rate under H2O2 treatment.
[0011] In one or more embodiments, the drought stress tolerance of the plant is reflected by any one of the following, e1) increasing the germination rate of the plant; e2) increasing the green seedling rate of the plant; e3) increasing the water loss rate of the in vitro leaf; e4) reducing the chlorophyll decline rate; e5) increasing the proline content; e6) increasing the green seedling rate under H2O2 treatment.
[0012] In one or more embodiments, the plant is a monocotyledon or a dicotyledon; preferably, the plant is Panax ginseng and Arabidopsis thaliana.
[0013] In a second aspect of the present application, a method for improving the abiotic stress tolerance of a plant is provided, comprising: overexpressing a Panax ginseng glycosyltransferase UGT84K2 gene in the plant by genetic engineering, wherein the nucleotide sequence of the Panax ginseng glycosyltransferase UGT84K2 gene is shown as SEQ ID NO: 1.
[0014] In one or more embodiments, the plant is a monocotyledon or a dicotyledon; preferably, the plant is Panax ginseng and Arabidopsis thaliana.
[0015] In one or more embodiments, the overexpression is achieved by any one of the following: f1) by introducing a plasmid containing the gene; f2) by increasing the copy number of the gene on the plant chromosome; f3) by changing the promoter sequence of the gene on the plant chromosome; f4) by operably linking a strong promoter to the gene; f5) by introducing an enhancer.
[0016] In a third aspect of the present application, the use of the transgenic plant obtained by the method of the second aspect in plant breeding is provided.
[0017] In one or more embodiments, the breeding method comprises transgenesis, crossing, backcrossing, selfing, or vegetative reproduction.
[0018] The present application has the advantages of: The ginseng glycosyltransferase UGT84K2 gene was introduced into the model plant Arabidopsis thaliana for research, and a ginseng glycosyltransferase UGT84K2 overexpression strain was constructed. The results showed that under the conditions of adversity such as high salt (NaCl) and drought stress (osmotic stress), the expression level of ginseng glycosyltransferase UGT84K2 was up-regulated, and the ginseng glycosyltransferase UGT84K2 overexpression strain showed stronger tolerance under adversity conditions, which reflected that it might enhance the stress resistance through glycosylation modification. The analysis of the stress resistance mechanism of the ginseng glycosyltransferase UGT84K2 overexpression strain showed that under the conditions of salt stress and drought stress, the chlorophyll content of all plants was significantly reduced, but the chlorophyll reduction rate of the ginseng glycosyltransferase UGT84K2 overexpression strain was relatively small, indicating that it had certain advantages in maintaining photosynthetic capacity. At the same time, the change of proline content was also detected, and under the conditions of salt stress and drought stress, the proline content of all plants increased, but the proline content of the ginseng glycosyltransferase UGT84K2 overexpression strain increased more, which indicated that the ginseng glycosyltransferase UGT84K2 overexpression strain showed stronger ability in osmotic regulation. By culturing green seedlings under H2O2 stress and combining with diaminobenzidine (DAB) and nitro blue tetrazolium (NBT) staining to judge the antioxidant capacity of the plants, the results showed that the ginseng glycosyltransferase UGT84K2 overexpression strain showed lower H2O2 accumulation and superoxide anion production level under H2O2 stress, which indicated that its antioxidant capacity was significantly enhanced. These results showed that ginseng glycosyltransferase UGT84K2 enhanced the stress resistance of plants, could alleviate the osmotic pressure impact of adversity on cells by regulating the accumulation of osmotic substances proline, regulate the chlorophyll content, and the improvement of its antioxidant capacity helped to enhance the stress resistance of plants under adversity conditions. BRIEF DESCRIPTION OF DRAWINGS
[0019] The accompanying drawings, which form a part of this specification, are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification. The embodiments of the application, and their
[0020] Figure 1 To preliminarily verify the effect of ginseng glycosyltransferase UGT84K2 gene in non-biological stress; Figure 2 The map of the recombinant expression vector pBI121-GFP-UGT84K2; Figure 3 The expression level of UGT84K2 gene in WT and UGT84K2 overexpression strain; Figure 4 To show that the germination rate of the UGT84K2 overexpression line was higher than that of the wild type on MS medium supplemented with 1.5 μM ABA, a is a photograph of the germination rate, and b and c are line graphs of the germination rate on ordinary MS medium and MS medium supplemented with 1.5 μM ABA, respectively. Figure 5 The germination rate of the UGT84K2 overexpression line was significantly higher than that of the wild type in MS medium supplemented with 100 mM and 125 mM NaCl. Here, a is a photograph of the germination rate, and b~d are line graphs of the germination rate on ordinary MS medium, MS medium supplemented with 100 mM NaCl and MS medium supplemented with 125 mM NaCl, respectively. Figure 6 The germination rate of the UGT84K2 overexpression line was significantly higher than that of the wild type on MS medium supplemented with 200 mM and 250 mM mannitol (Man). Here, a is a photograph of the germination rate, and b~d are line graphs of the germination rate on ordinary MS medium, MS medium supplemented with 200 mM Man and MS medium supplemented with 250 mM Man, respectively. Figure 7 To show the cotyledon greening and growth of the UGT84K2 overexpression line under stress treatment; where a is a photograph of seeds of wild type (WT) and transgenic line sown on MS medium supplemented with 300 mM Man, 100 mM NaCl and 1.5 μM ABA for 14 days; b is the number of green seedlings established under each treatment condition. Figure 8 Water loss in detached leaves of wild-type (WT) and overexpressing UGT84K2; Figure 9 The results show the relative chlorophyll content, where a is the relative chlorophyll content (%) after 5 days of treatment with 125 Mm NaCl; b is the relative chlorophyll content (%) after 5 days of drought treatment (*p<0.05, **p<0.01, Student's st-test). Figure 10 The results are for proline content per unit fresh weight, where a is the proline content per unit fresh weight (%) after treatment with 125 mM NaCl for 5 days; and b is the proline content per unit fresh weight (%) after drought treatment for 5 days. Figure 11 To detect the greening of seedlings after treating wild-type (WT) and UGT84K2 overexpression lines with H2O2, a is a photograph and b is the greening rate. Figure 12The staining results of WT, UGT84K2OE-11, and UGT84K3OE-14 after treatment with 200 mM Man, 200 Mm NaCl, 16% PEG, and 200 mM H2O2 are shown in DAB and NBT staining solutions. In the figure, a represents DAB staining and b represents NBT staining. Detailed Implementation
[0021] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0022] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0023] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0024] Example 1 To preliminarily verify the role of the ginseng glycosyltransferase UGT84K2 gene in abiotic stress, Changbai Mountain ginseng (2-3 years old) was exposed to NaCl and PEG (polyethylene glycol) stress. The expression level of the UGT84K2 gene was analyzed by qPCR experiments using the qpcr-84K2-F / R primer pair. Figure 1 ).
[0025] qpcr-84K2-F:ATTCTTCCTTCAAATACTTCTGGTG; qPCR-84K2-R:GTCAATAACATCTTTTTCTAACTCG.
[0026] Treatment of ginseng leaves with NaCl and Man upregulated the expression of the ginseng glycosyltransferase UGT84K2 gene. This phenomenon may be closely related to the function of the ginseng glycosyltransferase UGT84K2 gene and its role in plant stress response.
[0027] Example 2 Construction of ginseng glycosyltransferase UGT84K2 expression vector: RNA was extracted from ginseng (2-3 years old) from Changbai Mountain and reverse transcribed using PrimeSTAR Max DNA Polymerase (TaKaRa, Japan) to obtain cDNA. Using the cDNA as a template, the CDS sequence of the UGT84K2 gene was amplified by PCR using primers 1 and 2. Primer 1: 5'-CGGTCGACATGGCTTCGGAAGGAAAGA-3'; Primer 2: 5'-GACTAGTTTAAGAATAACCTTTGATCTCATCA-3'.
[0028] The pBI121-EGFP vector and the amplified UGT84K2 gene CDS sequence were digested with enzymes (Spe I and SalI), and ligated with T4 DNA ligase to obtain the ligation product. 3 μL of the ligation product was added to 100 μL of *E. coli* DH5α competent cells and incubated on ice for 30 min. The sample was then rapidly transferred to a 42 ℃ water bath for 90 s, and quickly placed on ice for 5 min to cool. 1 mL of sterile LB medium without any antibiotics was added, and the mixture was incubated at 37 ℃, 200 rpm, and shaken for 1 h. LB solid medium containing the antibiotic Kan was prepared, and an appropriate amount of bacterial culture was evenly spread onto the medium and incubated upside down at 37 ℃ for 12 h. Colonies that were positive by colony PCR were inoculated into LB medium containing the antibiotic Kan and incubated at 37 ℃, 200 rpm for another 8 h.
[0029] After plasmid extraction and correct sequencing, the recombinant expression vector pBI121-GFP-UGT84K2 was obtained.
[0030] The map of the recombinant expression vector pBI121-GFP-UGT84K2 is as follows: Figure 2 As shown.
[0031] Example 3 Construction of ginseng glycosyltransferase UGT84K2 overexpression lines: (1) Transformation with Agrobacterium GV3101 Agrobacterium GV3101 was removed from -80 °C and placed on ice to thaw. Using a sterile 1.5 mL EP tube, 3–5 μL of the recombinant expression vector pBI121-GFP-UGT84K2 was added to 50 μL of Agrobacterium GV3101. The mixture was then pipetted and incubated on ice for 5 min, followed by liquid nitrogen treatment for 5 min, and finally a 28 °C water bath for 5 min. The tube was then quickly placed on ice and incubated for another 5 min. 700 μL of antibiotic-free sterile LB medium was added, and the tube was incubated at 28 °C with shaking for 2–3 h. The tube was centrifuged at 6000 rpm for 3 min at room temperature, and a portion of the supernatant was removed. A portion of the bacterial culture was evenly spread onto LA medium containing kanamycin and incubated upside down at 28 °C for 2–3 days. Colony PCR was performed to verify the presence of Agrobacterium GV3101 containing the recombinant expression vector pBI121-GFP-UGT84K2.
[0032] (2) Inoculation of Arabidopsis thaliana inflorescence: Agrobacterium GV3101 containing the recombinant expression vector pBI121-GFP-UGT84K2 was pre-mixed in sterile LB broth containing 50 μg / mL kanamycin and 25 μg / mL rifampin, and cultured for 12 h at 28 ℃ and 200 rpm in a shaker. The cells were collected by centrifugation at 4500 rpm for 5 min at room temperature, and inoculum was added until the OD600 reached 0.8–1.0. The mixture was then thoroughly mixed to obtain the mixed inoculum.
[0033] Prepare healthy, bolting Arabidopsis plants, removing any open inflorescences and developing siliques beforehand. Then, use a dropper to apply the mixed inoculum solution to the unopened inflorescences. Repeat this process three times. After inoculation, the Arabidopsis plants should be cultured in the dark for 24 hours, followed by normal light exposure. Repeat the inoculation process once a week, repeating each inoculation three times while maintaining darkness, for a total of 2-3 weeks.
[0034] After inoculation, mature seeds were collected and spread on MS medium containing 50 μg / mL kanamycin. After vernalization in the dark, the seeds were cultured at 22 ℃ under light. After 10 days of growth, the seedlings with normal growth were observed and screened as the T1 generation.
[0035] T1 generation green seedlings were transplanted into soil. After they matured, the seeds harvested from individual T1 plants were spread on MS medium containing 50 μg / mL kanamycin. After vernalization in the dark, the plants were cultured at 22 ℃ under light and continued to grow into seedlings that were 10 days old. The offspring with a ratio of green seedlings to albino seedlings of 3:1 were selected. The green seedlings were the T2 generation.
[0036] The T2 generation seedlings were transplanted into the soil. After they matured, the seeds harvested from individual T2 plants were spread on MS medium containing 50 μg / mL kanamycin. After vernalization in the dark, the plants were cultured at 22 ℃ under light. After 10 days, the seedlings were observed, and the offspring that grew into fully green seedlings were selected as the T3 generation homozygous overexpression lines.
[0037] Based on the selected T3 generation homozygous overexpression lines, semi-quantitative PCR was performed using primer pairs ACT2-F / R and 84K2-F / R to detect their expression levels. UGT84K2OE-11 was identified as a high-expression line, and UGT84K2OE-14 as a moderate-expression line. Subsequently, lines UGT84K2OE-11 and UGT84K2OE-14 were used as experimental materials. Figure 3 ).
[0038] ACT2-F: 5'-GCTCCTCTTAACCCAAAGGC-3'; ACT2-R: 5'-CACACCATCACCAGAATCCAGC-3'; 84K2-F: 5'-ACTCCGACGGCCTAAGCCTCGACGC-3'; 84K2-R: 5'-GTCAGGCCTAATGGGATGAACATTT-3'.
[0039] Example 4 (1) Germination rate of UGT84K2 overexpression lines Wild-type (WT), UGT84K2OE-11, and UGT84K2OE-14 Arabidopsis seeds in good condition were collected and cultured in the dark at 22 °C under light after vernalization on ordinary MS medium, MS medium supplemented with 100 mM and 125 mM NaCl, MS medium supplemented with 200 mM and 250 mM Man, and MS medium supplemented with 1.5 μM ABA (abscisic acid). After 4 days of light culture, their germination rate was observed.
[0040] After seeds of the three lines were grown on standard MS medium for 4 days, there was no significant difference between the UGT84K2 overexpression lines and the wild-type (WT). Figures 4-6 This indicates that under normal growth conditions, overexpression of the UGT84K2 gene has no significant effect on plant growth and development. On MS medium supplemented with 1.5 μM ABA, the germination rate of the UGT84K2 overexpressing line was higher than that of the wild type (WT), but the difference was not significant. Figure 4In MS medium supplemented with 100 mM and 125 mM NaCl, the germination rate of the UGT84K2 overexpression lines was significantly higher than that of the wild-type (WT). Figure 5 The same UGT84K2 overexpression line also showed higher germination rates in MS medium supplemented with 200 mM and 250 mM Man. Figure 6 The results indicate that overexpression of the UGT84K2 gene may enhance the plant's tolerance to drought and salt stress, further confirming the important role of the UGT84K2 gene in enhancing plant stress resistance.
[0041] (2) Green seedling rate of UGT84K2 overexpression lines Wild-type (WT), UGT84K2OE-11, and UGT84K2OE-14 Arabidopsis seeds with similar growth conditions were collected and cultured in the dark at 22 °C under light after vernalization on ordinary MS medium, MS medium supplemented with 125 mM NaCl, MS medium supplemented with 200 mM Man, and MS medium supplemented with 1.5 μMABA. After 14 days of light culture, the green seedling rate was observed.
[0042] After two weeks of growth under control conditions (ordinary MS medium), both wild-type (WT) and UGT84K2 overexpression lines showed a green seedling ratio close to 100%. Figure 5 Figures a and b show that under normal growth conditions, UGT84K2 overexpression had no significant effect on plant growth and development. However, under adverse conditions, the UGT84K2 overexpressing lines exhibited stronger adaptability. On a medium supplemented with 250 mM Man, 125 mM NaCl, and 1.5 μM ABA, the cotyledon greening rate of the UGT84K2 overexpressing lines was accelerated, and their overall growth was superior to that of the wild type (WT). After two weeks of growth, the proportion of green seedlings in the UGT84K2 overexpressing lines was significantly higher than that in the wild type (WT). Figure 7 This indicates that overexpression of the UGT84K2 gene enhances the plant's tolerance to drought and salt stress.
[0043] (3) Water loss rate of detached leaves Wild-type (WT), UGT84K2OE-11, and UGT84K2OE-14 seedlings were selected. After 4 weeks of growth, leaves of nearly identical size were cut and placed under environmental conditions (25 ℃ ± 1 ℃). Weighing was performed using a 1 / 10000 electronic balance, with measurements recorded every 20 minutes for a total of 180 minutes. Each weighing was repeated four times, with four plants per replicate. The baseline was the initial total fresh weight of the plant, used to calculate the average water loss rate of the leaves.
[0044] Under normal growth conditions, the water loss rate of wild-type (WT) Arabidopsis leaves reached 40% after 3 hours, while the water loss rate of the UGT84K2 overexpression line was only about 25%. Figure 8 This result indicates that overexpression of the UGT84K2 gene significantly enhances the water retention capacity of leaves. This enhanced water retention capacity is closely related to the function of the UGT84K2 gene in plant stress responses. Therefore, overexpression of the UGT84K2 gene significantly improves the water retention capacity of Arabidopsis leaves, providing important physiological support for the plant's survival under adverse conditions such as drought.
[0045] Example 5: Mechanism of action of UGT84K2 in response to abiotic stress (1) Determination of chlorophyll content Three-week-old wild-type (WT), UGT84K2OE-11, and UGT84K2OE-14 Arabidopsis thaliana seedlings with the same growth status were cultured. On the 5th day of 125 mM NaCl salt stress and drought stress, plant leaves were cut off and marked. Cut off 0.2 g of each leaf, add 9 mL of 95% ethanol, heat in a 43 ℃ water bath in the dark for 3 h, and measure the absorbance at wavelengths of 665 nm and 649 nm. Five plants of each of the three materials were used. The absorbance measurement was repeated 4 times, with four plants per measurement. The relative chlorophyll content (%) = 100 × chlorophyll content after stress / chlorophyll content before stress.
[0046] Under normal growth conditions, the chlorophyll content changes of wild-type (WT) Arabidopsis and the UGT84K2 overexpression line showed basically the same trend. However, after drought and salt stress treatments, the chlorophyll content of both plants decreased, but the relative chlorophyll content of the UGT84K2 overexpression line was significantly higher than that of the wild-type (WT). Therefore, the chlorophyll content of both wild-type (WT) and UGT84K2 overexpression lines decreased under salt and drought stress, but the decrease in chlorophyll content of the UGT84K2 overexpression line was smaller than that of the wild-type (WT). Figure 9 ).
[0047] This result demonstrates that UGT84K2 overexpression significantly enhances the plant's tolerance to stress conditions. Chlorophyll, a key pigment in photosynthesis, is crucial for plant survival and growth under stress. The relative stability of chlorophyll content in UGT84K2-overexpressing lines under salt and drought stress, combined with their higher survival rates and better growth under these conditions, suggests that this stress tolerance may be closely related to the regulatory function of the UGT84K2 gene in plant metabolism. Therefore, UGT84K2 overexpression significantly improves the stability of chlorophyll content in Arabidopsis thaliana under salt and drought stress, thereby enhancing its stress tolerance.
[0048] (2) Determination of proline content Three-week-old wild-type (WT), UGT84K2OE-11, and UGT84K2OE-14 Arabidopsis seedlings with the same growth status were cultured. On day 5 of 125 mM NaCl salt stress and drought stress, 0.5 g of wild-type (WT), UGT84K2OE-11, and UGT84K2OE-14 seedlings before and after stress were selected as samples. The samples were thoroughly ground into powder with liquid nitrogen and then transferred to a 10 mL sterile centrifuge tube. 5 mL of prepared 3% sulfosalicylic acid was added, and the mixture was heated in a boiling water bath for 20 min. Finally, the samples were centrifuged (5000 rpm, 7 min) to obtain the proline extract.
[0049] The extract was aliquoted and 2 mL was taken to measure the absorbance at 520 nm. The proline content was calculated based on the standard curve. The absorbance test was repeated four times, with three plants as the sample size each time.
[0050] The percentage of proline per unit fresh weight is calculated as follows: 100 × X × VT / (106 × W × VS), where VT is the volume of the extract, X is the proline content calculated according to the standard curve equation, VS is the sample volume, and W is the sample mass.
[0051] Under normal growth conditions, there was little difference in the free proline content in wild-type (WT) Arabidopsis thaliana and the UGT84K2 overexpression line. Figure 10 As shown in the figure. However, after 5 days of treatment with 125 mM NaCl and drought, the proline content in both wild-type (WT) and UGT84K2 overexpression lines increased. Among them, the proline content in wild-type (WT) Arabidopsis thaliana increased only slightly, while the proline content in the GT84K2 overexpression line increased significantly, approximately 1.4 times that of wild-type (WT). Figure 10This result indicates that under salt and drought stress conditions, the proline content in both wild-type (WT) and UGT84K2 overexpression lines of Arabidopsis thaliana was increased, but the increase was greater in the UGT84K2 overexpression lines. Proline is an important substance that regulates osmotic pressure, helping to maintain osmotic balance within plant cells and mitigate the damage to cell structure and function caused by abiotic stress. The significant increase in proline content in the UGT84K2 overexpression lines under abiotic stress conditions suggests that they possess a strong osmotic regulation capacity, thus enabling them to better adapt to salt and drought stress.
[0052] (3) Accumulation of H2O2 under abiotic stress To determine the accumulation of H2O2 in UGT84K2 overexpression lines under abiotic stress, wild-type (WT) and UGT84K2 overexpression lines were treated with H2O2, and seedling greening was assessed. Seeds from both wild-type (WT) and UGT84K2 overexpression lines germinated and continued to grow on MS medium supplemented with 10 mM H2O2. After two weeks, seedling greening was observed, and the greening rate was calculated.
[0053] Under 10 mM H2O2 treatment, the green seedling rate of the two overexpression lines, UGT84K2OE-11 and UGT84K2OE-14, was significantly higher than that of the wild type (WT). Figure 11 Studies have shown that exogenous H2O2 plays an important role in plant growth and stress response. Appropriate amounts of H2O2 can promote seed germination and seedling growth by regulating redox balance. As a stable reactive oxygen species (ROS), H2O2 has excellent transmembrane capacity, allowing it to rapidly diffuse into cells and activate the plant's antioxidant defense system. UGT84K2 overexpression lines exhibited higher green seedling rates under H2O2 treatment, which may be related to the role of H2O2 as a reactive oxygen species (ROS) signaling molecule.
[0054] To visualize the formation of H2O2 and superoxide under abiotic stress, Arabidopsis thaliana plants grown in soil for 4 weeks were treated with 200 mM Man, 16% PEG, 200 Mm NaCl, and 200 mM H2O2. Diaminobenzidine (DAB) staining and nitrotetrazole (NBT) staining were performed. Figure 12 The effects of hydrogen peroxide (H2O2) and superoxide dismutase (SOD) were detected by staining with diaminobenzidine (DAB) and nitrotetrazole (NBT), respectively. Figure 12 The staining of the UGT84K2 overexpressing lines was lighter than that of the wild-type (WT) lines, indicating that the antioxidant capacity of the UGT84K2 overexpressing lines was significantly higher than that of the wild-type (WT) lines, enhancing their tolerance to abiotic stresses.
[0055] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Application of ginseng glycosyltransferase UGT84K2 and related biological materials in any of the following: a1) Application in regulating plant salt tolerance stress; a2) Application in regulating plant drought stress tolerance; a3) Application in the development of transgenic plants with improved salt stress tolerance; a4) Application in the development of transgenic plants with improved drought stress tolerance; The ginseng glycosyltransferase UGT84K2 is the protein shown as b1), b2), b3), or b4) below: b1) The protein with the amino acid sequence shown in SEQ ID NO: 2; b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 2; b3) Proteins with the same function obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:
2. b4) Proteins that have 75% or more homology with the amino acid sequence shown in SEQ ID NO: 2 and have the same function.
2. The application as described in claim 1, characterized in that, The biological material associated with ginsenoside glycosyltransferase UGT84K2 is any one of c1) to c9) below: c1) A nucleic acid molecule encoding ginsenoside UGT84K2; the sequence of the nucleic acid molecule is shown in SEQ ID NO: 1; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1) or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3); c5) A transgenic plant cell line containing the nucleic acid molecule described in c1) or a transgenic plant cell line containing the expression cassette described in c2); c6) Transgenic plant tissue containing the nucleic acid molecule described in c1) or transgenic plant tissue containing the expression cassette described in c2); c7) A transgenic plant organ containing the nucleic acid molecule described in c1) or a transgenic plant organ containing the expression cassette described in c2); c8) Nucleic acid molecules that increase the expression level of ginseng glycosyltransferase UGT84K2; c9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in c8).
3. The application as described in claim 1, characterized in that, The regulation mentioned is to promote.
4. The application as described in claim 1, characterized in that, The plant's salt stress tolerance is manifested in any of the following ways. d1) Improve plant germination rate; d2) Improve the green seedling rate of plants; d3) Increase the water loss rate of detached leaves; d4) Reduce the rate of chlorophyll decrease; d5) Increase proline content; d6) Improve the green seedling rate under H2O2 treatment; Alternatively, plant drought stress tolerance manifests in any of the following ways: e1) Improve plant germination rate; e2) Improve the green seedling rate of plants; e3) Increase the water loss rate of detached leaves; e4) Reduce the rate of chlorophyll decrease; e5) Increase proline content; e6) Improve the green seedling rate under H2O2 treatment.
5. The application as described in claim 1, characterized in that, The plant is a monocotyledonous or dicotyledonous plant; preferably ginseng and Arabidopsis thaliana.
6. A method for improving plant resistance to abiotic stress, characterized in that, include: Using genetic engineering techniques, the ginseng glycosyltransferase UGT84K2 gene was overexpressed in plants. The nucleotide sequence of the ginseng glycosyltransferase UGT84K2 gene is shown in SEQ ID NO:
1.
7. The method as described in claim 6, characterized in that, The plant is a monocotyledonous or dicotyledonous plant; preferably ginseng and Arabidopsis thaliana.
8. The method as described in claim 6, characterized in that, The overexpression method is selected from any one of the following: f1) By introducing a plasmid containing the gene; f2) By increasing the copy number of the genes described on the plant chromosomes; f3) By altering the promoter sequence of the genes described on the plant chromosome; f4) By operatively linking a strong promoter to the gene; f5) By introducing enhancers.
9. The use of the transgenic plant obtained by the method according to any one of claims 6 to 8 in plant breeding.
10. The application as described in claim 9, characterized in that, Breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.