Application of uORF in upstream non-coding region of ABA2 gene in regulation of crop agronomic traits

Abstract

The invention discloses application of an upstream non-coding region uORF of an ABA2 gene in regulation and control of crop agronomic traits, in particular to application in improvement of pre-harvest sprouting resistance of rice and cultivation of pre-harvest sprouting resistant rice strains, and belongs to the technical field of gene engineering. The invention finds that uORF in the upstream non-coding region of the crop ABA2 gene can inhibit the translation level of downstream ABA2 protein on the basis of not influencing the transcriptional level, so that the uORF can participate in regulation and control of crop agronomic traits in which ABA participates in regulation and control, such as improvement of pre-harvest sprouting resistance of rice. Therefore, the upstream non-coding region uORF of the crop ABA2 gene can be modified through a hybridization or gene editing technology, so that the purpose of regulating and controlling crop agronomic traits in which ABA participates in regulation and control is achieved, for example, site-directed mutagenesis is performed on an initiation codon of the upstream non-coding region uORF of the rice ABA2 gene, and the pre-harvest sprouting resistance of rice is improved.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the open reading frame (uORF) in the upstream non-coding region of the ABA2 gene in regulating agronomic traits (such as panicle sprouting resistance and drought tolerance) regulated by ABA (abscisic acid) in crops (e.g., Arabidopsis thaliana, rice, wheat, tomato, cotton, alfalfa, rapeseed, and potato). In particular, it relates to the application of the uORF in the upstream non-coding region of the rice ABA2 gene (OsABA2 encoding gene LOC_Os03g59610) in regulating rice panicle sprouting resistance, and also relates to a method for improving crop panicle sprouting resistance or breeding panicle sprouting resistant varieties. Background Technology

[0002] Seeds are crucial for the reproduction of seed plants, an important indicator of crop yield, and one of the key agronomic traits that determine crop yield. The process by which seeds initiate the establishment of the next generation under suitable time and environment is called seed germination. However, not all seeds can germinate under normal conditions because seeds may exhibit dormancy. This phenomenon refers to the fact that viable seeds remain dormant under favorable conditions such as suitable moisture, temperature, and oxygen, and cannot germinate (Bewley JD. Seed germination and dormancy. Plant Cell. 1997: 9(7): 1055-1066). Appropriate dormancy keeps seeds dormant in the field, while weaker dormancy results in higher and more uniform germination rates after sowing. However, weak seed dormancy can also cause fresh, mature seeds to germinate prematurely on the mother plant spike under high temperature and humidity conditions. This condition is called preharvest sprouting (PHS). Sprouting at the panicle of important crops such as rice and wheat has become a serious problem worldwide. Sprouting not only reduces crop yields and lowers edible quality, but more importantly, it severely impacts seed production quality, making it a significant disaster affecting food crops. Statistics show that in southern China, where rice harvesting seasons often coincide with high temperatures and heavy rainfall, approximately 6% of the sown area for conventional rice and as much as 20% for hybrid rice suffers from severe sprouting at the panicle.

[0003] Currently, scientists from various countries are dedicated to finding key genes that regulate pre-harvest sprouting (Wang M et al. Parallel selection on a dormancy gene during domestication of crops from multiple families. Nat Genet. 2018: 50(10): 1435-1441; Zhu D et al. The effects of field pre-harvest sprouting on the morphological structure and physicochemical properties of rice (Oryza sativa L.) starch. Food chemistry. 2019: 278: 10-16; Xu F et al. Antagonistic control of seed dormancy in rice by two bHLH transcription factors. Nat Genet. 2022: 54(12): 1972-1982). However, the progress of related research is still relatively slow overall, mainly because there are few genes with breeding value that resist pre-harvest sprouting, and the genetic regulatory network is still unclear. Furthermore, current technologies such as CRISPR-Cas, CRISPRi, RNAi, and overexpression are commonly used to regulate the expression of key genes affecting crop agronomic traits. These technologies can only achieve complete knockout of the target gene or suppress or increase its expression to unpredictable levels, potentially causing unforeseen consequences for other important crop agronomic traits. Therefore, identifying key genes regulating panicle germination in crops such as rice and studying their related regulatory mechanisms, and then applying these findings to genetic improvement to breed panicle germination-resistant varieties, is of great significance for ensuring food security. Summary of the Invention

[0004] Addressing one or more problems existing in the prior art, this invention is the first to discover a uORF in the upstream non-coding region of the rice ABA biosynthesis-related gene OsABA2. This uORF can inhibit the translation level of downstream ABA2 protein without affecting the transcriptional level. Furthermore, this invention discovers that by site-directed mutagenesis of the start codon ATG of this uORF, the translation level of downstream ABA2 protein can be significantly increased without affecting the transcriptional level of the OsABA2 gene, thereby improving the panicle sprouting resistance of rice. Thus, this uORF can also regulate crop agronomic traits regulated by ABA. In addition, this invention also discovers that homologous ABA2 genes of the rice OsABA2 gene exist in crops such as Arabidopsis thaliana, wheat, tomato, cotton, alfalfa, rapeseed, and potato, and uORFs also exist in the upstream non-coding regions of these ABA2 genes. These uORFs all possess a conserved function of inhibiting the translation level of downstream genes. Therefore, by modifying the uORF in the upstream non-coding region of the ABA2 genes in these crops, agronomic traits regulated by ABA in these crops can also be regulated. This invention is mainly achieved through the following technical solutions.

[0005] In one aspect, the present invention provides the application of uORF in the upstream non-coding region of the ABA2 gene as a target in regulating agronomic traits of crops regulated by ABA.

[0006] In some embodiments, the crop includes one or more of Arabidopsis thaliana, rice, wheat, tomato, cotton, alfalfa, rapeseed, and potato.

[0007] In some implementations, the agronomic traits regulated by ABA include panicle budding resistance and / or drought tolerance.

[0008] In some embodiments, the crop is rice, and the agronomic trait regulated by ABA is panicle sprouting resistance; alternatively, the agronomic trait regulated by ABA in the crop is to improve panicle sprouting resistance in rice.

[0009] In some implementations, ABA-regulated agronomic traits of the crop are regulated by modifying the uORF sequence of the upstream uncoding region of the endogenous ABA2 gene in the crop.

[0010] Optionally, the uORF sequence of the upstream uncoding region of the endogenous ABA2 gene in the crop can be modified by one of the following methods:

[0011] (1) The sequence of the uORF upstream untranslated region of the endogenous ABA2 gene in the crop is altered by introducing base substitutions, insertions, or deletions to make it different from the original sequence. For example, by mutating the start codon ATG of the uORF upstream untranslated region of the ABA2 gene in the crop (e.g., mutating it to ATA) to eliminate the start codon, or by shortening the sequence of the uORF upstream untranslated region of the ABA2 gene in the crop; and

[0012] (2) The uORF sequence of the upstream uncoding region of the endogenous ABA2 gene in the crop is replaced with the uORF sequence of the upstream uncoding region of the ABA2 gene from the exogenous ABA2 gene. Optionally, when the crop is rice and the nucleotide sequence of the uORF sequence of the upstream uncoding region of its endogenous ABA2 gene is as shown in SEQ ID NO: 2, the endogenous uORF sequence shown in SEQ ID NO: 18 or SEQ ID NO: 20 is used to replace the endogenous uORF sequence shown in SEQ ID NO: 2.

[0013] Secondly, the present invention provides the application of an isolated nucleic acid molecule in improving the panicle sprouting resistance of japonica rice varieties, wherein the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 18; optionally, the nucleic acid molecule is used to replace the uORF of the upstream non-coding region of the endogenous ABA2 gene of the japonica rice variety to improve the panicle sprouting resistance of the japonica rice variety; further optionally, the japonica rice varieties include: Songjing 10, Songjing 3, Kongyu 131, Kendao 8, Songjing 8, Annong Wanjing B-1, Suijing 3, ZH11, Nip, Babaili, 2428, and Liaojing.

[0014] Thirdly, the present invention provides a method for cultivating rice lines resistant to panicle sprouting, which includes using transgenic, hybridization and / or gene editing technologies to remove the start codon from the uORF of the upstream non-coding region of the endogenous ABA2 gene in rice, and / or to shorten the length of the uORF.

[0015] Optionally, the gene editing technology involves transforming a vector that causes a site-directed mutation in the start codon of the uORF in the upstream uncoding region of the endogenous ABA2 gene of rice into the recipient rice, so that the uORF no longer contains a start codon, thereby obtaining the rice line resistant to panicle sprouting.

[0016] Further optionally, the vector that causes a site-directed mutation in the start codon of the uORF in the upstream non-coding region of the ABA2 coding gene in rice is a vector with a nucleotide sequence as shown in SEQ ID NO: 9.

[0017] Fourthly, the present invention provides an isolated nucleic acid molecule whose nucleotide sequence is shown in SEQ ID NO: 20.

[0018] Fifthly, the present invention provides a nucleic acid construct having a nucleotide sequence as shown in SEQ ID NO: 9.

[0019] In a sixth aspect, the present invention provides a recombinant cell comprising the above-described nucleic acid construct.

[0020] In a seventh aspect, the present invention provides the application of the above-mentioned isolated nucleic acid molecules, nucleic acid constructs or recombinant cells in improving the panicle sprouting resistance of rice or in cultivating rice lines resistant to panicle sprouting; optionally, the above-mentioned isolated nucleic acid molecules are used to replace the uORF of the upstream non-coding region of the endogenous ABA2 gene of rice to improve the panicle sprouting resistance of said rice or to cultivate rice lines resistant to panicle sprouting. Attached Figure Description

[0021] Figure 1 The diagram shows the predicted structure of uORF in the upstream non-coding region of the rice OsABA2 gene and the vector construction for an in vitro dual-luciferase reporter system (A). The mRNA expression values ​​of FLUC / RLUC after the constructed reporter system was transformed into rice protoplasts (B) and the enzyme activity ratio (C).

[0022] Figure 2 This is a plasmid map of the A3A-PBE-osABA2 vector.

[0023] Figure 3 The image shows the uORF start codon mutation in the upstream non-coding region of the rice OsABA2 gene (A), as well as the results of transcriptional level detection (B) and ABA2 protein expression level detection (C) of the OsABA2 gene in wild-type rice ZH11 and mutants.

[0024] Figure 4 The panicle budding phenotype (A) and seed germination rate statistics (B) of wild-type rice ZH11 and its mutant are shown.

[0025] Figure 5 The sequence variation of uORF in the upstream uncoding region of the OsABA2 gene in indica and japonica rice is shown in (A), the mRNA expression values ​​of FLUC / RLUC in rice protoplasts transformed with the two uORF sequences are shown in (B), and the ratio of enzyme activity is shown in (C).

[0026] Figure 6 The statistical results of panicle germination rate of natural materials of indica rice variety 9311 and japonica rice variety ZH11. Detailed Implementation

[0027] Given the lack of key genes and methods in the existing technology that can regulate the pre-emergence resistance of crops (such as rice) with breeding value, the inventors conducted in-depth research and realized that inhibiting pre-emergence, i.e., improving pre-emergence resistance, can be achieved by inhibiting the synthesis and signal transduction of gibberellin (GA), enhancing the biosynthesis and signal transduction of ABA, thereby promoting seed dormancy. The inventors also recognized that the OsABA2 encoding gene is a key gene involved in ABA biosynthesis in rice. Considering the shortcomings of existing technologies such as CRISPR-Cas, CRISPRi, RNAi, and overexpression, which may directly knock out the target gene or inhibit or increase gene expression to unpredictable levels, potentially causing unpredictable consequences for other agronomic traits of crops, the inventors focused on the uORF (Upstream Open Reading Frame) of the 5′UTR (5′ Untranslated Region) upstream of gene mRNA. They discovered that it can regulate the translation of downstream major genes without affecting the gene transcription level, thereby finely regulating gene expression at the translation level. In light of this, the inventors analyzed the mRNA sequence characteristics of the rice ABA biosynthesis gene OsABA2 and discovered a uORF in the upstream untranslated region of the OsABA2 mRNA, specifically a uORF located in the 5′UTR upstream of the OsABA2 coding gene. The inventors further found that site-directed editing of the start codon ATG of this uORF (eliminating the start codon) could enhance the translation of downstream genes without affecting transcription, thereby strengthening ABA biosynthesis and playing a crucial regulatory role in rice panicle sprouting resistance. The resulting mutant significantly inhibited rice panicle sprouting and could also regulate other agronomic traits known to be regulated by ABA (e.g., drought tolerance). Moreover, this method targets cis-regulatory elements in the upstream untranslated region of OsABA2 rather than the gene itself, thus avoiding impacts on downstream gene transcription and preventing unpredictable consequences for other agronomic traits.

[0028] Furthermore, the inventors have discovered uORFs in the untranslated regions upstream of ABA2-encoding genes (e.g., the ABA2-encoding gene B456_013G015600 in cotton and the ABA2-encoding gene GSBRNA2T00008252001 in rapeseed) in crops such as Arabidopsis thaliana, wheat, tomato, cotton, alfalfa, rapeseed, and potato. These uORFs all have the function of inhibiting the translation of downstream genes. Therefore, the uORFs in the untranslated regions upstream of the ABA2-encoding genes in these crops can also be used as molecular markers in the genetic breeding process of these crops to regulate important agronomic traits regulated by ABA, such as improving the crop's pre-harvest sprouting resistance and drought tolerance. Therefore, this invention is of great significance for regulating important agronomic traits regulated by ABA in the above crops.

[0029] The present invention will be further described below with reference to specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention and are not intended to limit the scope of the present invention.

[0030] In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of the invention. Therefore, the drawings and description are considered to be exemplary in nature and not restrictive.

[0031] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold Spring Harbor).

[0032] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials in this invention. In fact, the sources of the biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted according to the instructions in the embodiments. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.

[0033] The nucleotide or amino acid sequences involved in the following examples can all be synthesized using existing technologies. The A3A-PBE vector used in the examples is from Professor Caixia Gao's research group at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. For reference, see: Zong Y et al. Efficient C-to-T base editing in plants using a fusion of nCas9 and human APOBEC3A[J]. Nature Biotechnology, 2018, 36(10): 950-953.

[0034] Example 1: Prediction and Functional Validation of Sequence Features in the Upstream Untranslated Region of OsABA2

[0035] In this embodiment, the inventors, based on the sequence characteristics of uORF, used the presence of a start codon ATG and one of three stop codons, the number of bases between the start and stop codons being a multiple of 3, and the amino acid count being at least 2 or greater, in conjunction with the uORFlight website (refer to Niu R et al. uORFlight: a vehicle toward uORF-mediated translational regulation mechanisms in eukaryotes[J]. Database, 2020, 2020: baaa007.) to analyze and predict whether uORF (as shown in SEQ ID NO: 1) exists in the upstream untranslated region (5′UTR) of the OsABA2 mRNA (its corresponding cDNA sequence is shown in SEQ ID NO: 1) of the rice variety Zhonghua 11 (ZH11). Figure 1 As shown in Figure A, the potential uORF site was obtained. The results preliminarily confirmed the existence of a uORF in the upstream untranslated region of the OsABA2 mRNA of rice ZH11, with a length of 138 bp.

[0036] Furthermore, such as Figure 1 As shown in Figure A, in this embodiment, the 5′UTR of the OsABA2 encoding gene of wild-type rice ZH11 (uORF start codon is ATG, its nucleotide sequence is shown in SEQ ID NO: 2) and the 5′UTR of uORF where the start codon ATG is mutated to ATA (the nucleotide sequence of uORF after the start codon mutation is shown in SEQ ID NO: 20) were respectively constructed into a dual-luciferase reporter system. Then, they were each transformed into rice protoplasts. The mRNA expression values ​​of FLUC / RLUC and the enzyme activity ratio were detected to confirm that the uORF in the upstream untranslated region of the OsABA2 encoding gene has the biological function of inhibiting downstream gene translation without affecting the transcription level. The specific operation includes the following steps.

[0037] 1.1. Construction of a dual-luciferase reporter system

[0038] 1) The dual-luciferase reporter plasmid (Promega) was treated with BamHI restriction endonuclease. The dual-luciferase reporter plasmid included firefly luciferase (FLUC) expressed by the UBQ11 promoter and reniform luciferase (RLUC) expressed by the 35S promoter.

[0039] 2) The original 5′UTR sequence of OsABA2(ZH11) (containing the uORF shown in SEQ ID NO: 2) and the 5′UTR sequence of uORF (SEQ ID NO: 20) containing the ATG start codon mutated to ATA were commercially synthesized by GenScript. The two 5′UTR sequences were respectively ligated into the dual luciferase reporter plasmid treated with BamHI restriction endonuclease in the above steps, so that each 5′UTR sequence is located between the UBQ11 promoter and the FLUC coding sequence, and two plasmids were obtained, named OsWT and OsMu respectively, for later use.

[0040] 1.2. Transplantation into rice protoplasts

[0041] Following the method published by Jiang, YH et al. (Jiang, YH et al. (2018). Isolation and transformation of rice protoplasts. Bio-101e1010125. Doi: 10.21769 / BioProtoc.1010125.), ZH11 rice seedlings grown for 12 days under 28℃, 14h light, and 10h darkness conditions were used to prepare protoplasts. Subsequently, 20 μg of the two plasmids (OsWT and OsMu) prepared in step 1.1 above were mixed with 200 μl of the prepared protoplasts, and then 220 μl of 40% PEG4000 solution was added. The mixture was immediately and gently inverted to mix, and transformed in the dark at room temperature for 20 min. The mixture was then immediately washed with W5 solution and cultured overnight at 28℃ in the dark for about 12-16 h.

[0042] 1.3. Detect the mRNA expression level and enzyme activity ratio of FLUC / RLUC.

[0043] This experiment utilized Promega's Dual-Luciferase. FLUC / RLUC fluorescence values ​​were measured using the Reporter Assay System kit and a Promega single-tube multifunction detector. Specifically, after centrifuging the transformed protoplasts from step 1.2 and removing the supernatant, 1x Passive Lysis Buffer was added for lysis for 15 min. 20 μl of the lysis buffer was transferred to a new 1.5 ml centrifuge tube, and 50 μl of Luciferase Assay Substrate LARII solution was added. After mixing, the activity of firefly luciferase was measured. Then, 50 μl of 1x Stop & [unclear] solution was added to the centrifuge tube. Substrate, mix thoroughly, and measure the activity of Renalis luciferase. Calculate the ratio of the two enzyme activities. Add Trizol reagent to the remaining cell lysate, extract RNA from protoplasts, and reverse transcribe it into cDNA. Detect the expression levels of FLUC and RLUC by real-time quantitative qPCR. Primers ZXF37 (CGCTGGAGAGCAACTGCATA, SEQ ID NO: 3) and ZXF38 (TTGAAGAGAGTTTTCACTGC, SEQ ID NO: 4) were used to detect the expression level of FLUC, and primers ZXF35 (CATGGGATGAATGGCCTGATATTG, SEQ ID NO: 5) and ZXF36 (GATAATGTTGGACGACGAACTTC, SEQ ID NO: 6) were used to detect the expression level of RLUC.

[0044] The results of the FLUC / RLUC mRNA expression ratio and enzyme activity ratio are as follows: Figure 1 As shown in Figures B and C, there was no significant difference in the mRNA expression ratio of FLUC / RLUC in rice protoplasts transformed with two different dual-luciferase reporter system plasmids (OsWT and OsMu). However, there was a significant difference in the enzyme activity ratio of FLUC / RLUC between the two types of rice protoplasts. The enzyme activity ratio of FLUC / RLUC in rice protoplasts transformed with OsWT was significantly lower than that in rice protoplasts transformed with OsMu. These results indicate that the uORF in the upstream untranslated region of rice OsABA2 has the biological function of inhibiting downstream gene translation without affecting the transcriptional level.

[0045] Example 2: Construction of the OsABA2 gene site-directed mutagenesis vector A3A-PBE-osABA2

[0046] The purpose of constructing the A3A-PBE-osABA2 vector (also referred to as the single-base editing vector in this paper) in this embodiment is to induce a site-directed mutation in the start codon ATG of the upstream non-coding region uORF of the rice OsABA2 coding gene. The A3A-PBE vector's functional characteristic is to mutate cytosine bases to thymine, specifically by mutating the complementary base C to T in the start codon ATG of uORF. This allows for the segregation of homozygous mutant plants with ATG mutated to ATA in the next generation. The specific steps include:

[0047] 2.1. Primer Design

[0048] The NGG sequence (where N represents any base) near the start codon ATG of the uORF in the upstream non-coding region of the rice OsABA2 gene was selected. Forward primer CP7591 (5′-GGCGACTAGCCTGCATTATTATAG-3′, SEQ ID NO: 7) and reverse primer CP7592 (5′-AAACCTATAATAATGCAGGCTAGT-3′, SEQ ID NO: 8) were synthesized. The forward and reverse primers were then annealed using T4 polynucleotide kinase (T4 PNK) to form a double-stranded fragment structure for later use.

[0049] 2.2. Carrier Connection

[0050] The A3A-PBE vector was digested with the restriction enzyme BsaI at 37°C. The ends were dephosphated and the digested A3A-PBE vector product was recovered by electrophoresis. The annealed double-stranded fragment from step 2.1 was then ligated to the digested vector product using T4 DNA ligase to obtain the ligation product. The ligation reaction system is shown in Table 1 below.

[0051] Table 1: Connection Reaction System

[0052] 10×Cutsmart buffer (NEB) 1μL 10×T4 DNA ligase buffer (NEB) 0.2μL A3A-PBE vector product after enzyme digestion 1μL Annealed double-stranded fragments 1μL T4 DNA ligase (NEB) 0.1μL <![CDATA[ddH2O]]> 6.7μL

[0053] 2.3. Transformation of Escherichia coli

[0054] The ligation product obtained in step 2.2 was transformed into E. coli DH5α. After correct sequencing, the target vector A3A-PBE-osABA2 (SEQ ID NO: 9) (also referred to as pH-A3A-PBE-osABA2-uORF in this paper) was constructed. Its plasmid map is shown below. Figure 2 As shown, this method is used to construct OsABA2 uORF start codon-free rice lines by transforming recipient rice materials in the following embodiments (i.e., in this rice line, the upstream non-coding region uORF of the OsABA2 gene does not contain a start codon). The specific steps include the following operations.

[0055] 2.3.1 Transformation of E. coli DH5α: Take out the DH5α competent cells stored at -80℃ and place them on ice. After thawing, add the ligation product and continue to place on ice for 15 min. After heat shock in a 42℃ water bath for 1 min, add about 120 μl of LB (Luria-Bertani) culture medium and place in a shaker at 37℃ for 1 hour. Spread all of the above culture medium onto LB solid medium containing kanamycin (50 μg / mL) and incubate upside down at 37℃ overnight. The next day, pick a single clone and place it in LB liquid medium and incubate in a shaker at 37℃ for about 10 h. Send it to the company for first-generation sequencing using sequencing primer M13F (TGTAAAACGACGGCCAGT, SEQ ID NO: 10) to ensure successful sequence ligation.

[0056] 2.3.2 Plasmid Mini-Extraction: Plasmid mini-extraction was performed using the Novizan FastPure Plasmid Mini Kit. The specific procedure is as follows: Successfully sequenced bacterial culture was transferred to fresh LB liquid medium and cultured at 37°C with shaking for approximately 10 hours. After centrifugation at 12000 rpm for 1 min, the supernatant was discarded. The precipitate was resuspended in 250 μl of buffer P1 containing RNase A. Then, 250 μl of buffer P2 was added, and the mixture was gently mixed to ensure complete bacterial lysis. Next, 350 μl of buffer P3 was added, and the mixture was inverted until a white flocculent precipitate appeared. The mixture was centrifuged at 12000 rpm for 10 min. The FastPure DNA Mini Columns adsorption column was placed in a 2 ml Collection Tube. The supernatant from the previous centrifugation step was transferred to the adsorption column and centrifuged for 1 min. 600 μl of buffer diluted with anhydrous ethanol was added. PW2 was added to the adsorption column, centrifuged for 1 min, and the operation was repeated once; the adsorption column was returned to the collection tube, centrifuged at 12000 rpm for 1 min to dry the adsorption column; the adsorption column was placed in a new 1.5 ml centrifuge tube, 50 μl of purified water was added to the center of the membrane of the adsorption column, and the column was allowed to stand at room temperature for 2 min, and then centrifuged at 12000 rpm for 1 min to elute the plasmid, which is the target vector A3A-PBE-osABA2.

[0057] Example 3: Construction, identification, and expression level detection of OsABA2 uORF start codon-free rice lines

[0058] In this embodiment, the A3A-PBE-osABA2 vector, which contains site-specific editing of the uORF in the upstream uncoding region of rice osABA2 constructed in Example 2 above, was transferred into wild-type recipient material ZH11 rice to construct OsABA2 uORF start codon-free rice lines. The transcriptional and protein levels of osABA2 in the constructed OsABA2 uORF start codon-free rice lines were then detected. Specifically, the following operations were performed.

[0059] 3.1. Transformation of wild-type recipient material ZH11 rice with A3A-PBE-osABA2 vector

[0060] (1) Transformation of Agrobacterium EHA 105 with A3A-PBE-osABA2 vector: Take EHA 105 competent cells out of the -80℃ freezer and thaw them on ice; add 10 ng of A3A-PBE-osABA2 vector plasmid to 100 μL of EHA105 competent cells and place on ice for 20 min; transform using electroporation, add 200 μL of antibiotic-free liquid LB medium after electroporation, place in a shaker and incubate at 28℃ and 200 rpm for 1 h; spread the entire bacterial culture onto LB solid medium containing kanamycin (50 μg / mL) and rifampin (100 μg / mL) and incubate upside down at 28℃ for 2 days. After the colonies have grown, select a single positive clone and place it into liquid LB medium containing kanamycin (50 μg / mL) and rifampin (100 μg / mL). Incubate at 28°C and 180 rpm for 16 h. The resulting bacterial culture is Agrobacterium culture transformed by the A3A-PBE-osABA2 vector. It can be stored in a -80°C freezer using 50% glycerol at a 1:1 volume ratio. When infecting callus tissue, remove it from -80°C for activation.

[0061] (2) Infecting rice callus with Agrobacterium tumefaciens transformed into A3A-PBE-osABA2 vector: Take out the bacterial culture obtained in step (1) from the -80℃ freezer, add it to liquid LB medium containing kanamycin (50 μg / mL) and rifampicin (100 μg / mL) at a ratio of 1:100, and incubate overnight at 28℃ for 200 rpm; when the bacterial culture reaches an OD value of about 0.5, take it out of the incubator; take about 500 μL of bacterial culture into a 1.5 mL centrifuge tube, centrifuge at 28℃ for 3 min for 5000 rpm, discard the supernatant, and co-culture with 300 μL of liquid co-culture medium containing 20 μg / mL acetylsyleugenol (AAM basal medium (Coollabo, PM1961), containing 1 mg / L 2,4-D (2,4-dichlorophenoxyacetic acid), 0.2 mg / L Gently resuspend the bacterial pellet in a liquid co-culture medium containing KT (kinin) and 20 mg / L acetylsyringone (pH adjusted to 5.8). Select healthy ZH11 rice callus tissue (derived from seeds) and transfer it to a 50 mL centrifuge tube, filling it to approximately 5 mL. Add 20 mL of liquid co-culture medium containing 20 μg / mL acetylsyringone, then add the entire 300 μL of the resuspended bacterial suspension to the 50 mL centrifuge tube. Gently shake for 2–3 minutes to allow infection. Discard the liquid co-culture medium and transfer the infected callus tissue to a petri dish lined with filter paper to absorb excess medium. Place a layer of filter paper on the petri dish and transfer the infected callus tissue onto the filter paper. Incubate in the dark at 22°C for 2–3 days.

[0062] (3) Recovery culture of infected rice callus: After the infected callus was cultured in the dark for 2-3 days, the resulting callus was transferred to a 50 mL centrifuge tube; the callus was washed 4-5 times with sterile water containing 400 μg / mL carbolic acid for about 1 minute each time to remove bacteria; the callus was then washed 2-3 times with sterile water, transferred to a culture dish lined with filter paper, and excess water was absorbed; the above callus was then transferred to a culture dish containing 400 μg / mL carbolic acid. The medium for screening of carbobenzylpenicillin (NB basal medium salt (Coollab, PM1301) containing 0.3 mg / L casein, 0.5 mg / L proline, 2 mg / L 2,4-D, 30 g / L sucrose, 4 g / L plant gel, 400 μg / mL carbobenzylpenicillin, with 50 μg / mL hygromycin added as a screening agent (pH adjusted to 5.8)) was cultured in the dark at 28°C in an artificial climate incubator for about 30 days.

[0063] (4) Differentiation culture of resistant rice callus: The resistant callus on the screening medium was transferred to the differentiation medium (MS basal medium salt (Phytotech labs, M519) containing 2 mg / L casein, 30 g / L sorbitol, 30 g / L sucrose, 4.3 g / L plant gel, 2 mg / L KT, 0.02 mg / L NAA (naphthaleneacetic acid) (pH adjusted to 5.8)), one cluster of callus was transferred per bottle; it was placed in a 28℃ artificial climate incubator (24h light culture) and cultured for about 30 days to differentiate transgenic rice plants.

[0064] 3.2. Using primers ZXF45 (5'-TAGTTAAGGTGACGTGGCAAGACAACAC-3', SEQ ID NO: 11) and ZXF46 (5'-TTGAGATTCCCCATTCATCTTTTCAGTTCAAG-3', SEQ ID NO: 12), PCR amplification was performed on the genomic DNA from the transgenic rice plants obtained in step 3.1 above to obtain the upstream target fragment of osABA2. The editing type was identified by sequencing primer ZXF49 (5'-AAGAGGAGATCGGAITACGGCG-3', SEQ ID NO: 13). Finally, multiple lines with heterozygous editing of uORF start codons were identified. Specifically, the uORF start codon on one strand of the DNA from this line was ATG, and the other strand was ATA.

[0065] 3.3. The multiple uORF start codon heterozygous edited lines obtained in step 3.2 were planted at Changping Farm in Beijing. After harvesting T2 generation rice seeds (their self-pollinated offspring), they were planted at the Hainan Nanfan Base. The upstream target fragment of osABA2 was amplified using primers ZXF45 and ZXF46. The uORF homozygous edited plants were obtained by determination using primer ZXF49. The vector sequence of the uORF homozygous edited plants was amplified using forward primer CP3265 (5′TTTGCGGCTTTGGATTGG-3′, SEQ ID NO: 14) and reverse primer CP3266 (5′-AGGGCAGACGATGTTGGA-3′, SEQ ID NO: 15) to identify Cas9-free single plants (single plants with homozygous mutation at the target site and no Cas9; the A3A-PBE vector used may introduce unwanted Cas9), which are the target OsABA2. The uORF-free rice lines, with sequences near the start codon in the upstream non-coding region of uORF, are as follows: Figure 3 uORF of medium A-size CRAs shown, the start codon of uORF has been mutated from ATG to ATA in wild-type ZH11, that is, in uORF CR The start codon no longer exists. Figure 3 As can also be seen in section A, compared to the nucleotide sequence near the start codon ATG in the upstream non-coding region uORF of osABA2 in wild-type ZH11, uORF... CR There are also base mutations at other positions in the sample, but it is clear that these mutations do not form a new start codon ATG.

[0066] 3.4. RNA was extracted from wild-type ZH11 and OsABA2 uORF start codon-free rice lines (also referred to as mutants in this paper) and reverse transcribed. Using XP1503 (5'-CCCCGCTCCCCGGTTGGAAAGCAA-3', SEQ ID NO: 16) as the forward primer and XP1504 (5'-TGATTTTCTGG CCTGTAAAGCC-3', SEQ ID NO: 17) as the reverse primer, the OsABA2 transcription level in wild-type and mutant rice was detected by real-time quantitative PCR. The results are as follows: Figure 3 As shown in Figure B, there is no significant difference in the transcriptional level of OsABA2 between the wild type and the mutant, indicating that uORF can indeed regulate downstream gene expression at the mRNA translation level in vivo without affecting the transcriptional level. This is consistent with the results verified in vitro using a reporter system in Example 1 (see Figure B). Figure 1 (B and C) are the same.

[0067] 3.5. Wild-type ZH11 and OsABA2 uORF rice lines without a start codon were used. Total protein was extracted using a phosphate-buffered saline (PBS) system. The difference in ABA2 protein expression levels between wild-type and mutant lines was detected by Western blotting using an ABA2 antibody (PhytoAB). HSP82 protein detected by the HSP82 antibody (AbM51099-31-PU) was used as an internal control. Results are as follows: Figure 3 As shown in Figure C, it can be seen that when the internal reference protein HSP82 is less than that of the wild type, the content of OsABA2 protein in the mutant is significantly higher than that in the wild type. This indicates that after the uORF in the upstream untranslated region of OsABA2 mRNA does not have a start codon, its translation repression effect on downstream genes is significantly weakened, that is, it promotes the translation of downstream proteins.

[0068] Example 4: Phenotypic analysis of panicle sprouting at harvest time in rice lines without OsABA2 uORF start codon

[0069] The phenotypes of OsABA2 uORF start codon-free rice lines planted in the field were analyzed. The specific procedures were as follows: The field used was the Hainan Nanfan Base Farm; rice was sown in mid-November; seedlings were transplanted 45 days after sowing; and conventional water and fertilizer management was implemented in the field. Field results showed that the OsABA2 start codon-free rice lines did not differ significantly from the wild-type ZH11 throughout the seedling and vegetative growth stages. Specifically, at harvest, ZH11 and OsABA2 uORF start codon-free rice panicles planted at the Hainan Nanfan Base were harvested simultaneously and placed in a high-temperature, high-humidity environment (37℃, 100% humidity, 14 hours light, 10 hours darkness) to simulate panicle germination. The panicle germination rate was recorded on the third day of treatment. The results are as follows: Figure 4 Figures A and B show the panicle germination phenotypes of ZH11 rice panicles and rice lines with no start codon in OsABA2 uORF under high temperature and humidity conditions. Figure B shows the statistical results of panicle germination rate (also referred to as seed germination rate in the figure). It can be seen that the panicle germination rate of the mutant is significantly lower than that of wild-type ZH11. Combined with the results of Example 3, it is shown that rice OsABA2 uORF can inhibit the expression of downstream ABA2 protein and has a negative regulatory effect on rice panicle germination. Therefore, the start codon ATG of the upstream untranslated region uORF of the rice OsABA2 coding gene can be mutated to remove the start codon from uORF. This can significantly increase the expression of downstream ABA2 protein and thus significantly inhibit rice panicle germination.

[0070] Example 5: Differences in OsABA2 uORF sequences among different rice varieties

[0071] Analysis of the OsABA2 gene and its upstream non-coding region uORF from different rice varieties shown in Table 1 revealed differences in the uORF sequences of the upstream non-coding region of OsABA2 from different rice varieties. Most japonica rice varieties (such as Songjing 10, Songjing 3, Kongyu 131, Kendao 8, Songjing 8, Annong Wanjing B-1, Suijing 3, ZH11, Nip, Babaili, 2428, and Liaojing, listed in Table 2) had a uORF sequence length of 138 bp (its nucleotide sequence is shown in SEQ ID NO: 2) (hereinafter also referred to as ZH11-uORF or japonica rice type sequence), while most indica rice varieties (such as 9311, listed in Table 2) had a uORF sequence length of only 36 bp (SEQ ID NO: 2). NO: 18 (hereinafter also referred to as 9311-uORF or Indica rice type sequence), this is because, compared to the uORF sequence of the upstream non-coding region of OsABA2 in the above-mentioned japonica rice varieties, the uORF sequence of the upstream non-coding region of OsABA2 in these indica rice varieties has a deletion of two CA bases, causing the stop codon to appear prematurely. This results in the length between the start codon and the stop codon of its uORF sequence being shortened to 36 bp, such as Figure 5 As shown in Figure A. To investigate the effect of this sequence difference on the expression level of the OsABA2 gene, this example further constructed two sequence types (a 5' UTR containing a 138 bp ZH11-uORF sequence and a 5' UTR containing a 36 bp 9311-uORF sequence) into a dual-luciferase reporter system, and transformed them into ZH11 rice protoplasts according to the method described in Example 1. The FLUC / RLUC enzyme activity ratio and the mRNA expression ratio were measured. The construction of the two sequence types into the dual-luciferase reporter system included the following operations: two 5' UTR sequences were commercially synthesized by GenScript and ligated into dual-luciferase reporter plasmids digested with BamHI. The resulting two plasmids were then transformed into ZH11 rice protoplasts. The results are as follows... Figure 5 As shown in Figures B and C, the OsABA2 transcription level (expressed as the FLUC / RLUC mRNA expression ratio) in the rice lines transformed into 9311-uORF was no different from that in the rice lines transformed into ZH11-uORF, but the protein level (expressed as the FLUC / RLUC enzyme activity ratio) was significantly higher in the rice lines transformed into ZH11-uORF.

[0072] Simultaneously, this embodiment also conducted high-temperature and high-humidity germination treatment on panicles of different rice varieties at the Hainan Nanfan breeding base, and the panicle germination rate was statistically analyzed. The results are shown in Table 2 below. It can be seen that the overall average panicle germination rate of indica rice varieties containing shorter uORF sequences in the upstream non-coding region of OsABA2 was significantly lower (although some individual varieties had higher panicle germination rates), while the overall average panicle germination rate of japonica rice varieties containing longer uORF sequences in the upstream non-coding region of OsABA2 was significantly higher (although some individual varieties had lower panicle germination rates). Figure 6 The statistical results of panicle germination rate (also referred to as seed germination rate in the figure) of each indica rice variety and each japonica rice variety are shown in Table 2. It can be seen that the difference between the two is significant. The statistical panicle germination rate of indica rice varieties is significantly lower than that of japonica rice varieties.

[0073] The above results indicate that the influence of the upstream non-coding region uORF sequence of rice OsABA2 on the translation level of downstream ABA2 proteins, thereby regulating panicle germination, is common across different rice varieties. Specifically, the shorter uORF sequence in indica rice varieties exhibits a relatively weaker inhibitory effect on downstream ABA2 protein translation, while the longer uORF sequence in japonica rice varieties exhibits a relatively stronger inhibitory effect. Therefore, the shorter uORF sequence in indica rice varieties (e.g., the sequence shown in SEQ ID NO: 18) appears to be more advantageous as a molecular marker in breeding. For example, this shorter uORF sequence could be introduced into other rice varieties (e.g., japonica rice varieties) through hybridization or gene editing to replace their original potentially longer uORF sequences, or the original longer uORF sequence could be shortened using gene editing technology, thereby increasing the downstream ABA2 protein translation level and thus improving the panicle germination resistance of rice varieties with longer uORF sequences.

[0074] Table 2: Statistical results and sequence types of different rice varieties and their panicle germination rates

[0075]

[0076]

[0077] Example 6: uORF in the upstream untranslated region of the ABA2 gene is present in most plant species.

[0078] This example investigated whether uORFs exist in the upstream untranslated regions of rice OsABA2 homologs in other plant species (e.g., cotton homolog B456_013G015600 and rapeseed homolog GSBRNA2T00008252001), and their conservation. First, using the rice OsABA2 amino acid sequence (e.g., the OsABA2 amino acid sequence of rice variety ZH11 shown in SEQ ID NO: 19), sequence alignment was performed in the Ensmble Plants database to search for homologs in Arabidopsis thaliana, wheat, tomato, cotton, alfalfa, rapeseed, potato, maize, and sorghum. The alignment results showed that homologs of rice OsABA2 are conserved in all of these plants, meaning that ABA2-encoding genes are present in all of them. Further analysis of the untranslated regions upstream of these ABA2 genes revealed that the ABA2 genes in Arabidopsis, wheat, tomato, cotton, alfalfa, rapeseed, and potato all contain one or more uORFs (although varying in length) initiated by the ATG start codon, while the ABA2 genes in maize and sorghum do not contain uORFs upstream. The inventors have demonstrated that the uORFs in the untranslated regions upstream of the ABA2 genes, although exhibiting poor sequence conservation in rice, all possess the function of inhibiting downstream gene translation. Similarly, in Arabidopsis, the uORFs in the untranslated regions upstream of the ABA2 gene also inhibit downstream gene translation. Therefore, the uORFs in the untranslated regions upstream of this gene possess a certain degree of functional conservation, i.e., they all inhibit downstream gene translation. From this, it can be inferred that the uORFs upstream of the ABA2 genes in wheat, tomato, cotton, alfalfa, rapeseed, and potato also inhibit downstream gene translation. Some uORFs, as intervention targets, can also play a role in regulating agronomic traits regulated by ABA (such as pre-harvest sprouting resistance and drought tolerance). For example, by using gene editing and other means to mutate the start codon of uORFs in the upstream non-coding region of the ABA2 gene to make the start codon absent or shorten its length (for example, by making the stop codon appear earlier or shortening its length through gene editing), the inhibitory effect on the translation of downstream ABA2 protein can be relieved or reduced, thereby increasing the expression level of downstream ABA2 protein, and thus regulating agronomic traits regulated by ABA.

[0079] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of uORF in the upstream non-coding region of the ABA2 gene as a target in regulating agronomic traits in crops regulated by ABA.

2. The application according to claim 1, wherein the crop includes one or more of Arabidopsis thaliana, rice, wheat, tomato, cotton, alfalfa, rapeseed, and potato; and / or The agronomic traits regulated by ABA include panicle budding resistance and / or drought tolerance.

3. The application according to claim 2, wherein the crop is rice, and the agronomic trait regulated by ABA is panicle germination resistance; Optionally, the agronomic trait of the crop regulated by ABA is to improve the panicle germination resistance of rice.

4. The application according to any one of claims 1-3, wherein the agronomic traits of the crop regulated by ABA are regulated by modifying the uORF sequence of the upstream uncoding region of the endogenous ABA2 gene in the crop; Optionally, the uORF sequence of the upstream uncoding region of the endogenous ABA2 gene in the crop can be modified by one of the following methods: (1) The sequence of the uORF upstream untranslated region of the endogenous ABA2 gene in the crop is altered by introducing base substitutions, insertions, or deletions to make it different from the original sequence. For example, by mutating the start codon ATG of the uORF upstream untranslated region of the ABA2 gene in the crop (e.g., mutating it to ATA) to eliminate the start codon, or by shortening the sequence of the uORF upstream untranslated region of the ABA2 gene in the crop; and (2) The uORF sequence of the upstream uncoding region of the endogenous ABA2 gene in the crop is replaced with the uORF sequence of the upstream uncoding region of the ABA2 gene from the exogenous ABA2 gene. Optionally, when the crop is rice and the nucleotide sequence of the uORF sequence of the upstream uncoding region of its endogenous ABA2 gene is as shown in SEQ ID NO: 2, the endogenous uORF sequence shown in SEQ ID NO: 18 or SEQ ID NO: 20 is used to replace the endogenous uORF sequence shown in SEQ ID NO:

2.

5. The application of an isolated nucleic acid molecule in improving the panicle germination resistance of japonica rice varieties, wherein the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 18; Optionally, the nucleic acid molecule can be used to replace the uORF in the upstream non-coding region of the endogenous ABA2 gene of the japonica rice variety to improve the panicle sprouting resistance of the japonica rice variety. Further optionally, the japonica rice varieties include: Songjing 10, Songjing 3, Kongyu 131, Kendao 8, Songjing 8, Annong Wanjing B-1, Suijing 3, ZH11, Nip, Babaili, 2428, and Liaojing.

6. A method for breeding rice lines resistant to panicle sprouting, comprising using transgenic, hybridization and / or gene editing technologies to remove the start codon from the uORF of the upstream uncoding region of the endogenous ABA2 gene in rice, and / or to shorten the length of the uORF; Optionally, the gene editing technology involves transforming a vector that causes a site-directed mutation in the start codon of the uORF in the upstream uncoding region of the endogenous ABA2 gene of rice into the recipient rice, so that the uORF no longer contains a start codon, thereby obtaining the rice line resistant to panicle sprouting. Further optionally, the vector that causes a site-directed mutation in the start codon of the uORF in the upstream non-coding region of the ABA2 coding gene in rice is a vector with a nucleotide sequence as shown in SEQ ID NO:

9.

7. An isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO:

20.

8. A nucleic acid construct having the nucleotide sequence shown in SEQ ID NO:

9.

9. A recombinant cell comprising the nucleic acid construct of claim 8.

10. The application of the isolated nucleic acid molecule of claim 7, the nucleic acid construct of claim 8, or the recombinant cell of claim 9 in improving the panicle sprouting resistance of rice or in cultivating rice lines resistant to panicle sprouting; Optionally, the isolated nucleic acid molecule of claim 7 can be used to replace the uORF of the upstream non-coding region of the endogenous ABA2 gene in rice to improve the panicle sprouting resistance of the rice or to cultivate rice lines resistant to panicle sprouting.

Images