Indel marker related to corn kernel protein content character and application of Indel marker

By cloning the maize gdh2 gene and developing the Indel marker, the problem of improving maize kernel protein content was solved, achieving efficient and stable maize breeding results and cultivating new high-protein maize germplasm.

CN121700104APending Publication Date: 2026-03-20JIANGSU ACAD OF AGRI SCI
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202610159582.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-04
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the protein content of maize kernels. Traditional breeding methods are inefficient, time-consuming, and lack predictability. QTL effect values ​​are small and environmental stability is poor. Molecular regulatory pathways are unclear, making it difficult to improve the nutritional quality of maize through targeted genetic modification.

Method used

The maize gdh2 gene was cloned, an Indel marker was developed and amplified using specific primer pairs, the protein content trait of maize kernels was identified, and a new high-protein maize germplasm was created by interfering with the post-transcriptional processing of mRNA through gene editing.

Benefits of technology

This study achieved a stable increase in the protein content of maize kernels, developed environmentally stable molecular markers, cultivated new high-protein maize germplasm, met the national high-quality protein standards, and improved breeding efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121700104A_ABST
    Figure CN121700104A_ABST
Patent Text Reader

Abstract

The invention discloses an Indel marker related to a corn kernel protein content character and application of the Indel marker, and belongs to the technical field of plant molecular genetics and crop molecular design breeding. The Indel marker is located on a gdh2 gene of a chromosome 10 of a corn genome, and insertion or deletion of a nucleotide sequence as shown in SEQ ID NO.5 occurs in an intron region between a second exon and a third exon. By applying the molecular marker-assisted selection technology, high-protein new germplasms S3317 (the crude protein content is 17.0%) and JS231148 (the crude protein content is 15.6%) have been successfully cultivated, the increase amplitudes of the high-protein new germplasms and JS231148 are both more than 15% compared with those of the conventional control, and the lysine content reaches 0.41% and reaches the national high-quality protein corn standard.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of plant molecular genetics and crop molecular design breeding technology, particularly to the function and application of the maize glutamate dehydrogenase 2 gene (gdh2) and its specific intron sequence variations in regulating grain protein content. The invention further relates to molecular marker development, marker-assisted selection (MAS), and gene editing breeding methods based on the gene's loss-of-function alleles or key variant sites (such as the 182bp InDel intron region) for creating new high-protein maize germplasm. Background Technology

[0002] Corn is one of the world's most important grains, and its kernel protein content directly determines its nutritional value as food and feed. However, kernel protein content is a typical complex quantitative trait, regulated by the interaction of multiple gene networks and environmental factors. The genetic mechanisms are difficult to elucidate, resulting in low efficiency, long cycles, and poor predictability of traditional breeding methods.

[0003] Although some quantitative trait loci (QTLs) related to maize protein content have been located using linkage or association analysis, these loci generally suffer from small effect sizes, poor environmental stability, and difficulty in reproducing in different genetic backgrounds. More importantly, the causal genes of the vast majority of QTLs have not been cloned, and their downstream molecular regulatory pathways are unknown, making it impossible to translate them into efficient molecular breeding tools, which seriously restricts the targeted genetic improvement of maize nutritional quality.

[0004] Glutamate dehydrogenase (GDH) is a key enzyme catalyzing the interconversion of glutamate and α-ketoglutarate, located at the crossroads of carbon and nitrogen metabolism. Existing literature indicates that maize GDH2 (encoded by the gdh2 gene) participates in abiotic stress responses, but its crucial regulatory role in maize kernel development, particularly in determining the core agronomic trait of final storage protein accumulation, has not been reported. Identifying and validating major genes controlling kernel protein content, elucidating their mechanisms of action, and developing closely related and easily applicable molecular markers are of great significance for achieving molecular design breeding of maize based on protein content. Summary of the Invention

[0005] The purpose of this invention is to provide an Indel marker related to maize kernel protein content and its application, thereby addressing the problems existing in the prior art. This invention provides a systematic solution from major gene cloning and functional analysis to breeding applications, specifically addressing: 1. Unclear targets: identifying key genes with stable, major-effect genetic regulatory roles in maize kernel protein content. 2. Unclear mechanisms: revealing the specific molecular mechanisms by which these genes regulate protein accumulation, particularly whether new regulatory levels exist. 3. Lack of tools: developing molecular markers stably linked to high-protein phenotypes and effective across environments, solving the problem of low efficiency in traditional marker selection. 4. Inefficient pathways: providing efficient molecular design breeding technology pathways (including MAS and gene editing) based on clearly defined molecular targets.

[0006] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is an Indel marker related to the protein content trait of maize kernels. The Indel marker is located on the gdh2 gene on chromosome 10 of the maize genome, and the insertion or deletion of the nucleotide sequence as shown in SEQ ID NO.5 occurs in the intron region between the 2nd and 3rd exons.

[0007] The second technical solution of the present invention is a specific primer pair for amplifying the Indel label, comprising an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4.

[0008] The third technical solution of the present invention is a kit for detecting the protein content of corn kernels, comprising the specific primer pair.

[0009] The fourth technical solution of the present invention is a method for identifying the protein content trait of maize kernels using the Indel marker, comprising the following steps: (1) Extract DNA from the corn to be tested; (2) Using the extracted DNA as a template, amplification is performed using the specific primer pair or the kit to obtain the amplification product; (3) Identify the genotype of the amplified product. The kernel protein content of the maize individual with the inserted genotype is higher than that of the maize individual with the deleted genotype.

[0010] The fifth technical solution of the present invention is the application of the Indel label, the specific primer pair, or the kit in the detection of protein content in maize kernels.

[0011] The sixth technical solution of the present invention is the application of the Indel marker, the specific primer pair, or the kit in assisted breeding of maize kernel protein content traits.

[0012] The seventh technical solution of the present invention is a method for assisted breeding of maize kernel protein content traits, which uses the Indel marker to identify maize kernel protein content traits and selects maize individuals with nucleotide sequence insertion genotypes shown in SEQ ID NO.5 for breeding.

[0013] The eighth technical solution of this invention is a method for increasing the protein content of maize kernels by reducing the expression level of the gdh2 gene and / or the enzyme activity of its encoded protein GDH2 in maize plants, thereby increasing the protein content of maize kernels. Based on the above technical solution, the present invention has the following technical effects: 1. Cloning and functional verification of the major gene: gdh2 was cloned and confirmed to be the causal gene of qpc10, the major QTL that controls the stable protein content of maize kernels, providing direct evidence for its use as a molecular breeding target. Figure 2 , Figure 3 B, Figure 4 ).

[0014] 2. A novel post-transcriptional regulatory mechanism was revealed: the post-transcriptional regulatory mechanism of GDH2 was clearly demonstrated for the first time, showing that the deletion of 182bp in the intron region leads to changes in mRNA splicing efficiency or stability, resulting in a significant downregulation of GDH2 protein abundance by 82%. Figure 3 (D), while its transcript level did not change significantly ( Figure 3 (C) provides a new paradigm for the innovative regulation of crop quality traits.

[0015] 3. Development of molecular markers with extremely high environmental stability: 182bp InDel marker developed based on key variants ( Figure 8 In both Hainan and Nanjing, two vastly different ecological environments, the association between the protein phenotype and the high-protein phenotype was highly significant (p values ​​were 1.78 × 10⁻⁶ and 1.78 × 10⁻⁶, respectively). -4 and 4.78×10 -4 () Figure 8 (B); The average protein content of the genotype carrying the insertion was 15.6% and 14.1% in the two environments, respectively, which is at least 15% higher than that of the non-inserted type (13.7% and 12.3%), effectively solving the industrial problem of poor environmental stability of molecular markers.

[0016] 4. In Example 5, the molecular marker-assisted selection technology of this invention was applied to successfully cultivate new high-protein germplasm S3317 (crude protein content 17.0%) and JS231148 (crude protein content 15.6%), with an increase of more than 15% compared with the conventional control. Figure 9 Its lysine content reaches 0.41%, meeting the national standard for high-quality protein corn.

[0017] 5. In Example 6, based on the post-transcriptional regulatory mechanism revealed in this invention, a clear gene editing targeting strategy is provided. sgRNAs are preferentially designed to target the 182bp deletion region (SEQ ID NO.5) between exons 2 and 3 or its flanking splicing key sites. This can more accurately mimic naturally occurring superior alleles, directly interfering with the post-transcriptional processing of mRNA and creating new non-transgenic high-protein maize germplasm. Attached Figure Description

[0018] Figure 1 This study compares the phenotypic traits of grain quality traits in parental lines 517F and 417F and their bidirectional introgression line (IL). The phenotypic traits include: (A) grain protein content; (B) grain oil content; (C) grain starch content; and (D) weight of 100 pure proteins per grain.

[0019] Figure 2 This study analyzed the localization and allele effects of the major-effect QTL qpc10. Specifically, (A) the LOD curves and additive effect diagrams for grain protein content in a 417F backcross background IL population; (B) the LOD curves and additive effect diagrams for grain protein content in a 517F backcross background IL population; and (C) a comparison of grain protein content differences among lines carrying different alleles of qpc10 from 417F and 517F in the S18, S19, and S20 environments.

[0020] Figure 3 The purpose of this study was to screen and identify candidate genes for gdh2 within the qpc10 region. (A) A schematic diagram of the chromosome of the high-protein introduction line F181, showing that its introduced fragment includes the qpc10 region; (B) A comparison of seed protein content between F181 and the recurrent parent 417F; (C) A plot of transcriptomic expression levels of genes within the qpc10 physical region in seeds of F181 and 417F 30 days after pollination (DAP30), showing no significant difference; (D) Differences in proteomic expression of proteins within the qpc10 region in F181 and 417F seeds at DAP30, showing that the gdh2-encoded protein (GDH2) was the only significantly downregulated protein.

[0021] Figure 4 To create and validate the phenotype of the gdh2 loss-of-function mutant (gdh2-ems). (A) A schematic diagram of the gene structure of the gdh2-ems mutant and the location of the G-to-A point mutation in exon 4; (B) A comparison of the grain protein content of the gdh2-ems mutant and the wild-type (WT) control, showing that the mutant protein content is significantly increased.

[0022] Figure 5This is an analysis of sequence variations in the gdh2 gene. (A) shows the structure and variation distribution of 112 gdh2 gene sequences, with the 182 bp Indel located between the second and third exons highlighted in red; (B) shows five key missense mutation sites in the CDS region that cause amino acid changes.

[0023] Figure 6 To reveal the gdh2-regulated metabolic network through multi-omics integration analysis. The results include: (A) Volcano plot of differentially expressed genes in the DAP30 seed transcriptome of F181 vs. 417F; (B) KEGG pathway enrichment analysis of differentially expressed genes; (C) Volcano plot of differentially expressed proteins in the DAP30 seed proteome of F181 vs. 417F; (D) KEGG pathway enrichment analysis of differentially expressed proteins; (E) Volcano plot of differentially expressed metabolites in the DAP30 seed metabolome of F181 vs. 417F; and (F) KEGG pathway enrichment analysis of differentially expressed metabolites.

[0024] Figure 7 To validate the continuity of metabolic processes in mature grain proteomics. Specifically, (A) the gene encoding zein showed no significant difference in the DAP30 grain transcriptome; (B) the abundance of zein proteins identified in the DAP30 grain proteome showed no significant difference; (C) in the mature dry grain proteome, 50 kDa and 22 kDa zein proteins were significantly upregulated in the high-protein material; (D) SDS-PAGE electrophoresis of grain proteins showed a darker band for 22 kDa zein in the material carrying the 517F allele; (E) the KEGG enrichment pathway for upregulated proteins in dry grains; and (F) the KEGG enrichment pathway for downregulated proteins in dry grains.

[0025] Figure 8 This study aims to develop and validate a molecular marker based on a 182bp InDel. (A) shows the electrophoresis validation image of the developed InDel marker (primers SEQ ID NO. 3 / 4), where M is the molecular weight marker, "+" indicates a genotype with a 182bp insertion (e.g., F181), "-" indicates a genotype without an insertion (e.g., 417F), and NTC (No-Template Control) is the template-free control. (B) shows the difference in grain protein content among different genotypes (with insertion vs. without insertion) of 28 resources screened using this marker in two environments: Hainan in 2024 and Nanjing in 2025. *** indicates p < 0.001.

[0026] Figure 9This is a test report for a new high-protein variety created based on the qpc10 / gdh2 locus. The results show that the crude protein content of the seeds of the new germplasm S3317 and JS231148 is significantly higher than that of the conventional control, with a lysine content of 0.41%, meeting the national standard for high-quality protein.

[0027] Figure 10 Target design for gdh2 gene editing. The high-protein allele F181 contains a 182bp insertion sequence (green), which significantly reduces GDH2 protein abundance through posttranscriptional regulation. The editing strategy targets the low-protein receptor 417F, designing sgRNAs to create targets at homologous sites to precisely insert the 182bp F181-type sequence, mimicking the natural high-protein allele. Target design was carried out for precise editing of the gdh2-ems mutation site. PAM sequences are marked in red. Detailed Implementation

[0028] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0029] This invention provides an Indel marker associated with the protein content trait in maize kernels. The Indel marker is located on the gdh2 gene on chromosome 10 of the maize genome, and an insertion or deletion of the nucleotide sequence shown in SEQ ID NO.5 occurs in the intron region between exons 2 and 3.

[0030] In some specific implementations, the reference gene for the Indel marker is B73_V5.

[0031] This invention also provides a specific primer pair for amplifying the Indel marker, including an upstream primer as shown in SEQ ID NO. 3 and a downstream primer as shown in SEQ ID NO. 4.

[0032] This invention also provides a kit for detecting the protein content trait in corn kernels, including the aforementioned specific primer pair.

[0033] This invention also provides a method for identifying the protein content trait in maize kernels using the Indel marker, comprising the following steps: (1) Extract DNA from the corn to be tested; (2) Using the extracted DNA as a template, amplification is performed using the specific primer pair or the kit to obtain the amplification product; (3) Identify the genotype of the amplified product. The kernel protein content of the maize individual with the inserted genotype is higher than that of the maize individual with the deleted genotype.

[0034] This invention also provides the application of the Indel marker, the specific primer pair, or the kit in the detection of protein content in maize kernels.

[0035] This invention also provides the application of the Indel marker, the specific primer pair, or the kit in assisted breeding of maize kernel protein content traits.

[0036] This invention also provides a method for assisted breeding of maize kernel protein content traits, which uses the Indel marker to identify maize kernel protein content traits and selects maize individuals with the nucleotide sequence insertion genotype shown in SEQ ID NO.5 for breeding.

[0037] In some specific implementation schemes, the following steps are included: (1) Construct a maize breeding population and extract genomic DNA from each maize individual in the population; (2) PCR amplification of the genomic DNA of each maize individual was performed using the specific primer pair or the kit to obtain the amplification product; (3) Identify the genotype of each amplification product and screen out maize individuals containing the nucleotide sequence insertion genotype shown in SEQ ID NO.5; (4) Field agronomic traits of the selected maize individuals are identified, and individuals with excellent agronomic traits are selected for multiple generations of backcrossing and self-pollination to cultivate new high-protein maize germplasm.

[0038] A method to increase the protein content of maize kernels involves reducing the expression level of the gdh2 gene and / or the enzyme activity of its encoded protein GDH2 in maize plants, thereby increasing the protein content of maize kernels. Example 1 Identification of the main effect QTL qpc10 Population Construction and Phenotypic Identification. A bidirectional introgression population (232 accessions in total, used in this example) was constructed using high-protein maize inbred line 517F and low-protein maize inbred line 417F as parents. (Liu, R.; Cui, Y.; Kong, L.; Zheng, F.; Zhao, W.; Meng, Q.; Yuan, J.; Zhang, M.; Chen, Y. Evaluating the Genetic Background Effect on Dissecting the Genetic Basis of Kernel Traits in Reciprocal Maize Introgression Lines. Genes 2023,14, 1044. https: / / doi.org / 10.3390 / genes14051044). This population and the parents were planted in three different environments, and grain protein content was measured using near-infrared spectroscopy. Statistical analysis showed that grain protein content exhibited wide variation within the population and high heritability (0.58-0.63), making it suitable for QTL mapping.

[0039] QTL mapping. Using the constructed high-density bin maps and phenotypic data, linkage analysis detected a major-effect QTL stably expressed on chromosome 10 in both bidirectional introgression lines, named qpc10, located near 134-135 Mb on chromosome 10. In introgression lines with a 517F background, qpc10 had a LOD value of 7.32, explaining 32.33% of the phenotypic variation; in introgression lines with a 417F background, the LOD value was 2.68, explaining 10.23% of the phenotypic variation (Table 1). Alleles from 517F significantly increased grain protein content.

[0040] Table 1. QTL information on seed protein content at the location

[0041] Phenotypic validation. The high-protein importation line F181, which incorporated the 517F qpc10 chromosome fragment into a 417F background, was selected. Figure 3 (A). Field phenotypic validation showed that the grain protein content of F181 (15.0%) was significantly higher than that of its recurrent parent 417F (13.0%), confirming the genetic effect of the qpc10 fragment. Figure 3 (B)

[0042] Example 2 Creation and functional verification of gdh2-ems mutant Mutant Creation and Identification: A homozygous mutant, named gdh2-ems, was obtained by EMS mutagenesis of maize inbred lines, followed by screening and sequencing, with a G-to-A point mutation in exon 4 of the gdh2 gene (B73_V5). This mutation results in an early stop codon in the coding sequence, producing a truncated, non-functional protein. The mutation site and its flanking sequences have been determined, as shown in SEQ ID NO.1 (…). Figure 4 (A). SEQ ID NO.1: Genomic DNA characteristic sequence fragment containing the G-to-A point mutation in exon 4 (TSS+2403bp) of the gdh2-ems mutant.

[0043] A atgctggatgagtactcgaaatttcatggtcactccccagcagtcgtcactgggaagccaatagtaagtgaaaaaatgtggcagcaagttaaattggtgccaataaacttttttacaaagtataa tataacagaaaaaatgtacacaatagttattatcatttttactcttttttgtttgttgttgtaggatcttggcggatcactgggcagggatgcagcaacagggcgaggcgtaatgtatgctaccg aggccctactcgctgaatatggaaaatgcatttctggatcaacttttgtgatccaagtgagtgatagtttatcacatatgtccatcgaatgtacttttataagatgataaaaggataaccacat gttccctatagcaggttacctactgaaatattagtttttttttaaaaaactctatatttgtatatttgctatcgtgtcagtatgcaatatatatggtttaatatgtaaaccttgcagggttttgg.

[0044] Note: The bolded slanted sites are SNP sites.

[0045] Phenotypic validation: The gdh2-ems mutant and its wild-type control were planted under the same field conditions. After harvesting the grains, the crude protein content was determined using near-infrared spectroscopy. The results showed that the grain protein content of the gdh2-ems mutant was 15.1%, which was significantly higher than that of the wild type (11.1%) (p<0.01). Figure 4 (B). This result directly confirms that loss of gdh2 function can significantly increase the protein content of maize kernels.

[0046] Example 3 Sequence variation and regulatory mechanism analysis of candidate gene gdh2 1. Sequence alignment and key variant discovery Deep sequencing and alignment were performed on the gdh2 genome sequences (from the transcription start site TSS to the 3'UTR) of the recurrent parent 417F (low protein) and the introduced line F181 (high protein) to obtain the complete sequences shown in SEQ ID NO.6 (417F) and SEQ ID NO.7 (F181).

[0047] SEQ ID NO: 6: Complete genomic DNA sequence of the gdh2 gene from the transcription start site (TSS) to the 3'UTR in the low-protein maize inbred line 417F. SEQ ID NO: 7: Complete genomic DNA sequence of the gdh2 gene from the transcription start site (TSS) to the 3'UTR in the high-protein maize introduction line F181 (carrying the 517F allele).

[0048]

[0049]

[0050] The results showed that 112 variants were detected after the transcription start site (TSS), 21 of which were located in the coding region (CDS). Key amino acid alterations are as follows: TSS+2936bp: G→A (Gly273→Asp); TSS+3242bp: A→G (Ile307→Val); TSS+3277bp: G→T (Glu318→Asp); TSS+3582bp: CC→AT (Ala358→Asp); TSS+3638bp: A→T (Met377→Leu).

[0051] The most crucial finding: In the intron region between exons 2 and 3 of TSS+1518bp, F181 has a 182bp insertion compared to 417F (as shown in SEQ ID NO. 5). This 182bp insertion alters mRNA splicing efficiency, stability, or translation, thereby significantly downregulating GDH2 protein abundance. Figure 5 ).

[0052] SEQ ID NO. 5: GTTAGGGGGTGTTTGGTTTCTAGGGACTAATGTTTAGTCCCTTCATTTTATTCCTTTTTAGTATATAAATTGTTAAATATAGAAACTAAGATAAAGTTTTAGTTTCTATATTTGGTAATTTTGGAACTAAAATGGAATAAAATGTAGGGACTAAACATTAGTCCCTAGAAACCAAACATCCC.

[0053] 2. Molecular evidence for post-transcriptional regulatory mechanisms Transcriptome data showed no difference in gdh2 transcription levels between F181 and 417F. Figure 3 (C); while proteomic data showed that the abundance of GDH2 protein in F181 was significantly downregulated by 82% (C). Figure 3 (Middle D). This indicates that the deletion of the 182bp intron regulates GDH2 protein accumulation through a post-transcriptional mechanism.

[0054] Example 4 Multi-omics integration analysis of gdh2 regulatory network Transcriptomic, proteomic, and metabolomic analyses were performed on DAP30 seeds of F181 (high protein) and 417F (low protein). Differentially expressed gene, protein, and metabolite data were integrated, mapped to the KEGG pathway, and an association network was constructed. Figure 6 Analysis revealed that in the high-protein material F181, glycolysis and precursor accumulation, along with the activation of amino acid biosynthesis pathways, were observed; while in the low-protein material 417F, secondary metabolic pathways such as phenylpropane and flavonoid synthesis were more active. Figure 6 (B, D, F).

[0055] Metabolomics data revealed a significant redirection of carbon and nitrogen metabolic fluxes. Key metabolite changes are as follows: 1. Core changes in glutamate metabolism: As a substrate of GDH2, the content of glutamate (ID:280) remained stable between F181 and 417F (p=0.98). This is consistent with the phenomenon that there was no difference in the transcriptional level of GDH2 in the transcriptome, but the abundance of GDH2 protein in the proteome was significantly downregulated by 82%. This directly proves the operation of the "glutamate-saving" mechanism, which allows more glutamate to be used for protein synthesis rather than catabolism.

[0056] 2. Enhanced Carbon Skeleton Supply: Significant accumulation of 2-methylheptanoic acid (ID:198, log2FC=2.17, p=1.92e-2) and hexadecanoic acid (ID:442, log2FC=2.87, p=6.38e-3) in F181, both intermediates of fatty acid metabolism, directly reflects an enhanced carbon skeleton supply, providing ample precursors for amino acid and protein synthesis. Simultaneously, the accumulation of galactopyric acid (ID:310, log2FC=0.82, p=2.41e-2) indicates increased activity in glycolysis and pentose phosphate pathways, further supporting the redirection of carbon metabolism towards precursor synthesis.

[0057] 3. Inhibition of Secondary Metabolic Pathways: In 417F, multiple secondary metabolites were significantly enriched, especially ID:83 (4-hydroxy-9-(4-hydroxy-3,5-dimethoxy-phenyl)-5a,6,8a,9-tetrahydro-5H-isobenzofurano[5,6-f][1,3]benzodioxane-8-one, log2FC=3.77) and ID:84 (3H-1,3-benzothiazol-2-one, log2FC=1.43, p=1.10e-2). The former is a lignin / phenylpropane metabolite, and the latter is a nitrogen-containing secondary metabolite. This enrichment confirms that secondary metabolic pathways such as phenylpropane and flavonoid synthesis are more active in low-protein materials, consuming carbon and nitrogen resources that could be used for protein synthesis.

[0058] 4. Nitrogen allocation optimization: Proline (ID: 79, log2FC = -1.80) was significantly downregulated in F181. As a non-essential amino acid and nitrogen storage substance, its reduction indicates a shift of nitrogen from non-essential amino acids to essential amino acids and storage proteins. Simultaneously, changes in 2,3-dinor-8-isoprostaglandin F1alpha (ID: 1274, log2FC = 3.86, p = 5.73e-3), a marker of oxidative stress, reflect the redox state adjustment during metabolic reprogramming, providing a suitable cellular environment for protein synthesis.

[0059] 5. Lipid metabolism reprogramming: Metabolic changes of phosphatidylcholine (PC(34:2), ID:625) (log2FC=0.108) and Figure 6 The lipid metabolism pathway reprogramming shown in the data is consistent, indicating an adaptive response of cell membrane composition and function to gdh2 regulation.

[0060] Based on multi-omics integrated analysis, a gdh2 regulatory model was proposed: the insertion of 182 bp into the gdh2 gene induces post-transcriptional regulation (abnormal mRNA splicing / decreased stability), resulting in a significant 82% downregulation of GDH2 protein abundance. This leads to altered glutamate metabolic pathways (reduced degradation, increased integration), reprogramming of carbon and nitrogen metabolism, enhanced precursor supply, inhibition of secondary metabolic pathways (manifested as weakened phenylpropane / flavonoid synthesis), and optimized nitrogen allocation to storage proteins (manifested as decreased proline and increased essential amino acids), ultimately promoting net accumulation of grain protein. GDH2 acts as a key metabolic switch, and its expression level is negatively correlated with grain protein content. This metabolic reprogramming pattern persists from mid-grain development (DAP30) to maturity. Proteomics analysis of mature grains showed significant upregulation of 50 kDa and 22 kDa zein proteins in high-protein materials. Figure 7 (C, D) This model confirms that early metabolic redirection ultimately leads to the massive accumulation of storage proteins. This model fully explains the molecular basis of how the 182bp insertion of the gdh2 intron precisely regulates the protein content of maize kernels through post-transcriptional regulatory mechanisms.

[0061] Example 5 Molecular marker-assisted selection (MAS) based on gdh2 gene InDel markers and its application validation 1. Marker Development: Based on the 182bp deletion of the intron region of the gdh2 gene discovered in Example 2 (the inserted fragment sequence is shown in SEQ ID NO. 5), specific PCR primers were designed: F: 5'-TTTCCCCAGCAGTTGTTGACA-3' (SEQ ID NO: 3); R: 5'-TTTGGACATTCGCAAAAGGCC-3' (SEQ ID NO: 4).

[0062] Expected product: No 182bp insertion (417F type, low protein) ≈ 200bp, with insertion type 181 (high protein) ≈ 400bp ( Figure 8 (A)

[0063] 2. Marker Validation. Genotyping of 28 maize germplasm resources with broad genetic backgrounds was performed using this marker (Table 2). The kernel protein content was then analyzed in Hainan (Environment 1) in 2024 and Nanjing (Environment 2) in 2025. The results are shown in Table 2. Figure 8 As shown in B.

[0064] Table 2 Germplasm resources used to validate gdh2 molecular markers

[0065] The results showed that the average protein content of the 13 materials with the "insertion" genotype was 15.6% and 14.1% in the two environments, respectively; while the average protein content of the 15 materials with the "no insertion" genotype was 13.7% and 12.3%, respectively. The differences in protein content between the two genotypes were highly significant in both environments (p-values ​​were 1.78 × 10⁻ ... 4 and 4.78×10⁻ 4 () Figure 8 (B). This 182bp InDel marker showed a highly significant and stable association with the high-protein phenotype in two distinctly different ecological environments, with high selection accuracy. The average protein content of genotypes carrying this insertion was significantly higher in both environments than in non-carriers, demonstrating that this marker can be used for precise molecular marker-assisted selection across environments.

[0066] 3. Targeted Breeding Applications. In a backcross breeding program using 417F as the recurrent parent and 517F as the donor, the InDel marker was used for foreground selection to efficiently screen individual plants carrying the superior gdh2 allele from 517F (with a 182 bp insertion). Combined with field agronomic trait selection, and after multiple generations of backcrossing and self-pollination, new high-protein germplasm with high background reversion rates and excellent and stable agronomic traits, such as S3317 and JS231148, were successfully bred.

[0067] 4. Evaluation of New Germplasm. Third-party testing showed that the crude protein content of the new germplasm S3317 kernels reached 17.0%, and the lysine content was 0.41%, meeting the national standard for high-quality protein corn; the crude protein content of JS231148 reached 15.6%. Field trials demonstrated excellent yield potential and overall traits. Figure 9 ).

[0068] Implementation Case 6 GDH2-based gene editing breeding pathway This embodiment proposes an implementable technical path based on the principles disclosed in this invention and the verified mutant effect.

[0069] 1. Target expansion and optimization Based on the sequences and mechanisms revealed in this invention, gene editing targets are no longer limited to coding regions. In addition to targeting exon 4 to mimic EMS mutations (as in Example 4), sgRNAs targeting the intron region between exons 2 and 3 are preferentially designed, particularly targeting the identified 182bp deletion region (sequence shown in SEQ ID NO. 5) or its flanking splicing critical sites. By editing to introduce deletions or mutations in this region, naturally occurring superior alleles (F181 type) can be more accurately mimicked, directly interfering with the post-transcriptional processing of mRNA. Figure 10 ).

[0070] 2. Technical Approach The designed sgRNA and Cas9 gene were constructed into a plant transformation vector, and embryogenic callus tissue of maize recipient material was transformed using Agrobacterium-mediated transformation. Regenerated plants were obtained through tissue culture, and the editing type of the target site was identified by PCR and sequencing. Gdh2 gene editing mutants were then screened for.

[0071] 3. Expected Advantages and Results High success rate, targeting key regulatory regions of introns, effectively mimicking natural variations, and downregulating GDH2 protein by influencing post-transcriptional processes. Phenotypic effects have been verified by both natural alleles and EMS mutants. Figure 8 B, Figure 5 (B)

[0072] Low off-target risk; intron sequences may have higher specificity, which helps reduce off-target effects.

[0073] Biomaterials and sequence information.

[0074] Targeted creation provides a clear and optimized technical blueprint for the rapid and targeted creation of new non-GMO high-protein maize germplasm, and can directly obtain edited alleles that are similar to or even better than superior natural alleles.

[0075] The maize inbred lines 517F and 417F involved in this invention, as well as the new high-protein germplasm S3317, JS231148 and mutant gdh2-ems created therefrom, can all be obtained from the applicant.

[0076] SEQ ID NO.2: Typical protein-coding sequence (CDS) of the maize gdh2 gene. This sequence is used to define the basic structure of the gene and to design molecular manipulation tools.

[0077]

[0078] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. An Indel marker associated with the protein content trait of maize kernels, characterized in that, The Indel marker is located on the gdh2 gene on chromosome 10 of the maize genome, where an insertion or deletion of the nucleotide sequence shown in SEQ ID NO. 5 occurs in the intron region between exons 2 and 3.

2. The Indel marker according to claim 1, characterized in that, The reference gene for the Indel marker is B73_V5.

3. A specific primer pair for amplifying the Indel label as described in claim 1 or 2, characterized in that, This includes the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.

4.

4. A kit for detecting the protein content trait in corn kernels, characterized in that, Includes the specific primer pair described in claim 3.

5. A method for identifying the protein content trait in maize kernels using the Indel marker described in claim 1 or 2, characterized in that, Includes the following steps: (1) Extract DNA from the corn to be tested; (2) Using the extracted DNA as a template, amplification is performed using the specific primer pair described in claim 3 or the kit described in claim 4 to obtain the amplification product; (3) Identify the genotype of the amplified product. The kernel protein content of the maize individual with the inserted genotype is higher than that of the maize individual with the deleted genotype.

6. The application of the Indel label of claim 1 or 2, the specific primer pair of claim 3, or the kit of claim 4 in the detection of protein content in maize kernels.

7. The application of the Indel marker of claim 1 or 2, the specific primer pair of claim 3, or the kit of claim 4 in assisted breeding of maize kernel protein content trait.

8. A method for assisted breeding of maize kernel protein content, characterized in that, The method for identifying the protein content trait in maize kernels using the Indel marker as described in claim 5 was used to screen maize individuals with the nucleotide sequence insertion genotype shown in SEQ ID NO. 5 for breeding.

9. The method for assisted breeding of maize kernel protein content according to claim 8, characterized in that, Includes the following steps: (1) Construct a maize breeding population and extract genomic DNA from each maize individual in the population; (2) Using the specific primer pair described in claim 3 or the kit described in claim 4, PCR amplification is performed on the genomic DNA of each maize individual to obtain amplification products; (3) Identify the genotype of each amplification product and screen out maize individuals containing the nucleotide sequence insertion genotype shown in SEQ ID NO.5; (4) Field agronomic traits of the selected maize individuals are identified, and individuals with excellent agronomic traits are selected for multiple generations of backcrossing and self-pollination to cultivate new high-protein maize germplasm.

10. A method for increasing the protein content of corn kernels, characterized in that, Reducing the expression level of the gdh2 gene and / or the enzyme activity of its encoded protein GDH2 in maize plants can increase the protein content of maize kernels.

Citation Information

Cited By

  • Maize kernel protein major QTL (Quantitative Trait Loci) and primer group, kit and method for identifying corn kernel protein major QTL

    CN120485409A