DNA bar code for identifying nitraria tangutorum and nitraria sibirica and application of DNA bar code
By using DNA barcoding with specific variant sites in the ITS2 region, the problem of insufficient resolution of traditional DNA barcoding in identifying Nitraria tangutorum and Nitraria argentea is solved, achieving rapid and accurate species identification, which is suitable for the protection and utilization of germplasm resources of Nitraria tangutorum and Nitraria argentea.
Patent Information
- Application Number
- CN202610098563.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-26
- Publication Date
- 2026-03-31
AI Technical Summary
Traditional long-fragment DNA barcoding technology has limited resolution in identifying white thorn and small-fruited white thorn, especially with low success rate when DNA quality is poor, making it difficult to provide stable and reliable identification evidence, which leads to difficulties in species resource protection and utilization.
Using a combination of specific variant sites located in the ITS2 region, including the first to sixth variant sites, we rapidly identified *Nitraria tangutorum* and *Nitraria argyracea* var. *milliflora* through PCR amplification, gel electrophoresis, and Sanger sequencing. DNA barcoding was performed using ITS2F and ITS3R primers for further identification.
It provides a rapid and accurate identification method that is suitable for conventional laboratory equipment. It can improve the accuracy of identification when morphological identification is not feasible and is applicable to the collection, conservation and scientific research of germplasm resources of Nitraria tangutorum and Nitraria argyracea var. chinensis.
Smart Images

Figure CN121759636A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant gene molecular marker technology, specifically relating to a DNA barcode for identifying white thorn and small-fruited white thorn and its application. Background Technology
[0002] White thorn ( Nitraria tangutorum ) and small-fruited white thorn ( Nitraria sibirica Both belong to the genus *Nitraria* of the family Nitrariaceae. Nitraria It is a typical salt- and drought-tolerant shrub in temperate and sub-temperate arid and semi-arid regions, and is a key constructive species in desert ecosystems. At the same time, the fruits of Nitraria tangutorum and Nitraria argentea are rich in nutrients such as vitamins and flavonoids, and have the functions of sand fixation and improvement of saline-alkali soil, making Nitraria tangutorum and Nitraria argentea have medicinal, ecological restoration and economic development value.
[0003] Within the genus *Nitraria*, *Nitraria tangutorum* and *Nitraria tangutorum* are closely related, and their morphological characteristics are easily influenced by the environment, making them difficult to distinguish based on phenotypic morphology during the vegetative growth stage. Traditional long-fragment DNA barcoding techniques typically use longer DNA sequences to uniquely identify biological species, such as matK and rbcL. However, the resolution between these closely related species is limited, failing to provide stable and reliable identification criteria. This is especially true when processing dried samples or plant fragments with poor DNA quality, where traditional long-fragment barcoding techniques have a low success rate. This presents significant challenges to the conservation, utilization, and scientific research of *Nitraria tangutorum* and *Nitraria tangutorum* species resources. Summary of the Invention
[0004] The purpose of this invention is to provide a DNA barcode for identifying white thorn and small-fruited white thorn and its application. The DNA barcode for identifying white thorn and small-fruited white thorn contains a combination of specific variant sites located in the ITS2 region, which can be used to quickly identify white thorn and small-fruited white thorn.
[0005] This invention provides a DNA barcode for identifying *Nitraria tangutorum* and *Nitraria arvense*, wherein the DNA barcode includes a combination of specific variant sites located in the ITS2 region. The combination of specific variant sites includes a first variant site, a second variant site, a third variant site, a fourth variant site, a fifth variant site, and a sixth variant site. The first variant site is located at 69 bp in the ITS2 region and exhibits C / T polymorphism; the second variant site is located at 103 bp in the ITS2 region and exhibits C / T polymorphism; the third variant site is located at 185 bp in the ITS2 region and exhibits C / T polymorphism; the fourth variant site is located at 239 bp in the ITS2 region and exhibits C / T polymorphism; the fifth variant site is located at 246 bp in the ITS2 region and exhibits a base deletion / T polymorphism; and the sixth variant site is located at 257 bp in the ITS2 region and exhibits C / T polymorphism. The nucleotide sequence of the ITS2 region is shown in SEQ ID NO:3 or SEQ ID NO:4.
[0006] Preferably, the primers for amplifying the ITS2 region include ITS2F and ITS3R, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.
[0007] The present invention also provides the application of the DNA barcode of Nitraria tangutorum and Nitraria argentea described in the above technical solution, or the reagent for detecting the DNA barcode of Nitraria tangutorum and Nitraria argentea described in the above technical solution, in the identification of Nitraria tangutorum and Nitraria argentea.
[0008] Preferably, the reagent includes ITS2 primers, which include ITS2F and ITS3R, and the nucleotide sequences of ITS2F and ITS3R are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.
[0009] Preferably, the reagents also include PCR amplification reagents.
[0010] This invention also provides a method for distinguishing between white thorn and small-fruited white thorn, comprising the following steps: The genomic DNA of the test sample was amplified by PCR using ITS2 primers to obtain the ITS2 amplification product; The ITS2 amplification products were analyzed by gel electrophoresis, and ITS2 amplification products with the target band were selected. The ITS2 amplification product with the target band was sequenced to obtain the nucleotide sequence of the ITS2 region of the sample to be tested. The ITS2 primers include ITS2F and ITS3R, and the nucleotide sequences of ITS2F and ITS3R are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The nucleotide sequence of the ITS2 region is compared with the DNA barcode for identifying *Nitraria tangutorum* and *Nitraria argyi* as described in the above technical solution, and the result is determined: When the nucleotide sequence of the ITS2 region has C bases at the alignment positions of 69bp, 103bp, 185bp, 239bp, and 257bp, and a base deletion occurs at the alignment position of 246bp, the sample to be tested is white thorn. When the bases at the alignment positions of the nucleotide sequence in the ITS2 region are all T at positions 69bp, 103bp, 185bp, 239bp, 257bp, and 246bp, the sample to be tested is *Nitraria tangutorum*.
[0011] Preferably, the sequencing includes Sanger sequencing.
[0012] Preferably, when the sample to be tested includes multiple samples, the comparison includes performing multiple sequence alignment, alignment and correction of differential sites on the nucleotide sequences of the ITS2 region of multiple samples to be tested, so as to confirm the base types at positions 69bp, 103bp, 185bp, 239bp, 257bp and 246bp of the DNA barcode for distinguishing between white thorn and small-fruited white thorn.
[0013] Preferably, the method further includes: performing cluster analysis on the nucleotide sequence of the ITS2 region of the sample to be tested with the nucleotide sequence of the ITS2 region of the samples already identified as white thorn and small-fruited white thorn, and constructing a phylogenetic tree; if the sample to be tested is clustered into the confirmed white thorn gene cluster, it is determined to be white thorn, and if the sample to be tested is clustered into the confirmed small-fruited white thorn gene cluster, it is determined to be small-fruited white thorn.
[0014] Preferably, the PCR amplification system comprises: 1 μL of 10 mM ITS2F, 1 μL of 10 mM ITS3R, and Platinum. TM II. Hot-start PCR premix 10 μL, genomic DNA 2 μL, ddH2O 6 μL; The PCR amplification program is as follows: 94℃ pre-denaturation for 2 min, 1 cycle; 94℃ denaturation for 15 s, 56℃ annealing for 15 s, 68℃ extension for 15 s, 35 cycles; 65℃ extension for 5 s; 4℃ hold.
[0015] Beneficial effects: This invention provides a DNA barcode for identifying white thorn and small-fruited white thorn. The DNA barcode for identifying white thorn and small-fruited white thorn contains a combination of specific variant sites located in the ITS2 region, forming a site matrix with species diagnostic properties. These sites have stable species specificity. By detecting the nucleotide sequence of the ITS2 region of the sample, white thorn and small-fruited white thorn can be quickly identified.
[0016] Based on the DNA barcodes used to distinguish between *Nitraria tangutorum* and *Nitraria argentea*, this invention also provides a method for identifying *Nitraria tangutorum* and *Nitraria argentea*. This method can quickly and accurately distinguish between *Nitraria tangutorum* and *Nitraria argentea* through simple steps such as PCR amplification, Sanger sequencing, and alignment of the genomic DNA of the sample to be tested. The method is simple to operate and applicable to commonly used laboratory equipment (such as conventional PCR instruments, gel electrophoresis systems, and Sanger sequencing platforms). It can provide objective and reproducible identification evidence at the molecular level, and significantly improves identification accuracy, especially when morphological identification is not feasible or uncertain. This is beneficial for germplasm resource collection, conservation, and related scientific research, and provides a convenient method for germplasm identification and resource protection. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0018] Figure 1 The sequencing peak diagrams of the white thorn and small-fruited white thorn samples from Example 2 are shown. Figure 2 This is a diagram showing the sequencing sequence alignment results of the white thorn and small-fruited white thorn samples in Example 2; Figure 3 The results of cluster analysis of the samples of white thorn and small-fruited white thorn in Example 2 are shown. Detailed Implementation
[0019] This invention also provides a DNA barcode for identifying *Nitraria tangutorum* and *Nitraria arvense*, wherein the DNA barcode for identifying *Nitraria tangutorum* and *Nitraria arvense* includes a combination of specific variant sites located in the ITS2 region. The combination of specific variant sites includes a first variant site, a second variant site, a third variant site, a fourth variant site, a fifth variant site, and a sixth variant site. The first variant site is located at 69 bp in the ITS2 region and exhibits C / T polymorphism; the second variant site is located at 103 bp in the ITS2 region and exhibits C / T polymorphism; the third variant site is located at 185 bp in the ITS2 region and exhibits C / T polymorphism; the fourth variant site is located at 239 bp in the ITS2 region and exhibits C / T polymorphism; the fifth variant site is located at 246 bp in the ITS2 region and exhibits base deletion / T polymorphism; and the sixth variant site is located at 257 bp in the ITS2 region and exhibits C / T polymorphism. The nucleotide sequence of the ITS2 region is shown in SEQ ID NO:3 or SEQ ID NO:4.
[0020] The nucleotide sequence shown in SEQ ID NO:3 of this invention is: AAGCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCCCACCGTCTACAAACG C GTGCGGGGAGCGGAGATTGGCCTCCCGTGAGGG C GTTCCCTCGCGGTTGGCCCAAACACAGGTCCCCGGCCGAGGAAGCCGCGACTTTCGGTGGTTGTTAACAAACAGACATGCC C TGTCGTGCTCTCCTCGTGCCTTTTGCGGCACCCTCGACCCTAAGAAGGGCCAG C GCACTCTTTGAGTAAG C The full length of the sequence is 370 bp. The nucleotide sequence shown in SEQ ID NO:4 of this invention is: AAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCCCACCGTCTACAAACG. T GTGCGGGGAGCGGAGATTGGCCTCCCGTGAGGG T GTTCCCTCGCGGTTGGCCCAAACACAGGTCCCCGGCCGAGGAAGCCGCGACTTTCGGTGGTTGTTAACAAACAGACATGCC T TGTCGTGCTCTCCTCGTGCCTTTTGCGGCACCCTCGACCCTAAGAAGGGCCAG T GCACTC T TTTGAGTAAG T TGCGCTCGCTTTGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACCAGGATTCCCCTAGTAACGGCGAGCGAACCGG, its full length is 371bp.
[0021] In the nucleotide sequences shown in SEQ ID NO:3 and SEQ ID NO:4, the italicized and underlined positions indicate the locations of the variant sites. SEQ ID NO:3 represents the DNA barcode sequence matching *Nitraria tangutorum*, and SEQ ID NO:4 represents the DNA barcode sequence matching *Nitraria tangutorum* var. *small-fruited*. As an implementation method, although the ITS2 sequences of different individuals may contain individual random mutations or sequencing noise other than those mentioned above, the six specific polymorphic sites identified in this invention are conserved within species and specific to different species, serving as the decisive basis for distinguishing *Nitraria tangutorum* from *Nitraria tangutorum* var. *small-fruited*.
[0022] In this invention, as one embodiment, the primers for amplifying the ITS2 region include ITS2F and ITS3R, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The nucleotide sequence shown in SEQ ID NO:1 is 5'-ATGCGATACTTGGTGTGAAT-3', and the nucleotide sequence shown in SEQ ID NO:2 is 5'-GACGCTTCTCCAGACTACAAT-3'.
[0023] The DNA barcoding described in this invention refers to a new molecular identification technique that uses a standard, short DNA fragment within the genome to identify species. DNA barcoding differs from traditional identification methods and is characterized by its simplicity, high efficiency, and wide applicability.
[0024] The present invention also provides the application of the DNA barcode of Nitraria tangutorum and Nitraria argentea described in the above technical solution, or the reagent for detecting the DNA barcode of Nitraria tangutorum and Nitraria argentea described in the above technical solution, in the identification of Nitraria tangutorum and Nitraria argentea.
[0025] In one embodiment, the reagent includes ITS2 primers, which include ITS2F and ITS3R, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. In another embodiment, the reagent also includes PCR amplification reagents. This invention does not specifically limit the composition of the PCR amplification reagents; any conventional amplification reagents in the art are acceptable. In one embodiment, the application of this invention is to distinguish between *Nitraria tangutorum* and *Nitraria spp.* at various growth stages. However, in the juvenile vegetative growth stage, the phenotypes of *Nitraria tangutorum* and *Nitraria spp.* are more similar. Therefore, the method described in this invention is more accurate and has a more significant advantage than phenotypic identification methods.
[0026] This invention also provides a method for distinguishing between white thorn and small-fruited white thorn, comprising the following steps: The genomic DNA of the test sample was amplified by PCR using ITS2 primers to obtain the ITS2 amplification product; The ITS2 amplification products were analyzed by gel electrophoresis, and ITS2 amplification products with the target band were selected. The ITS2 amplification product with the target band was sequenced to obtain the nucleotide sequence of the ITS2 region of the sample to be tested. The ITS2 primers include ITS2F and ITS3R, and the nucleotide sequences of ITS2F and ITS3R are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The nucleotide sequence of the ITS2 region is compared with the DNA barcode for identifying *Nitraria tangutorum* and *Nitraria argyi* as described in the above technical solution, and the result is determined: When the nucleotide sequence of the ITS2 region has C bases at the alignment positions of 69bp, 103bp, 185bp, 239bp, and 257bp, and a base deletion occurs at the alignment position of 246bp, the sample to be tested is white thorn. When the bases at the alignment positions of the nucleotide sequence in the ITS2 region are all T at positions 69bp, 103bp, 185bp, 239bp, 257bp, and 246bp, the sample to be tested is *Nitraria tangutorum*.
[0027] In one embodiment, the sample to be tested in this invention can be fresh tissue, silica gel-dried tissue, or tissue preserved at low temperatures (-20℃ / -80℃) of *Nitraria tangutorum* or *Nitraria argyrophylla*. The amount of the sample to be tested is not less than 20 mg. When processing the sample, surface impurities must be washed with sterile water to avoid exogenous DNA contamination affecting the quality of total genomic DNA extraction. This invention does not specifically limit the method for extracting the genomic DNA; conventional genomic DNA extraction methods in the art can be used.
[0028] As one implementation method, the PCR amplification system includes: 1 μL of 10 mM ITS2F, 1 μL of 10 mM ITS3R, and Platinum. TM II. Hot-start PCR premix: 10 μL, genomic DNA: 2 μL, ddH2O: 6 μL. As one embodiment, the PCR amplification program is as follows: 94°C pre-denaturation for 2 min, 1 cycle; 94°C denaturation for 15 s, 56°C annealing for 15 s, 68°C extension for 15 s, 35 cycles; 65°C extension for 5 s; hold at 4°C.
[0029] In one embodiment, the sequencing includes Sanger sequencing. In another embodiment, the sequencing platform can be an ABI 3730xl gene sequencer or an equivalent sequencing instrument. In one embodiment, during the alignment, the nucleotide sequence of the ITS2 region is aligned with a reference sequence to determine the location of specific variant sites; the reference sequence is shown in SEQ ID NO:3 or SEQ ID NO:4, meaning that the present invention further includes editing the sequenced nucleotide sequence after sequencing, trimming both ends and aligning it with the reference sequence to determine the sites.
[0030] In one implementation, when the test sample includes multiple samples, the comparison includes performing multiple sequence alignment, alignment, and correction of differing sites on the nucleotide sequences of the ITS2 region of the multiple test samples to confirm the base types at positions 69bp, 103bp, 185bp, 239bp, 257bp, and 246bp of the DNA barcode for identifying *Nitraria tangutorum* and *Nitraria argyrophylla*. In another implementation, the multiple sequence alignment can be performed using Mega software and the Muscle algorithm; during the alignment process, differing sites need to be manually corrected, with particular attention to confirming the base types at positions 69bp, 103bp, 185bp, 239bp, 257bp, and 246bp to avoid inaccurate identification results due to alignment errors. In one implementation, the Mega software version is 7.0 or higher.
[0031] In one implementation, the method further includes performing cluster analysis on the ITS2 region nucleotide sequence of the sample to be tested together with the ITS2 region nucleotide sequences of confirmed *Nitraria tangutorum* samples and *Nitraria tangutorum* var. *mongolica* samples to construct a phylogenetic tree. If the sample to be tested clusters into the *Nitraria tangutorum* gene cluster, it is determined to be *Nitraria tangutorum*; if the sample to be tested clusters into the *Nitraria tangutorum* var. *mongolica* gene cluster, it is determined to be *Nitraria tangutorum* var. *mongolica*. The cluster analysis is cross-validated with the method of identifying *Nitraria tangutorum* and *Nitraria tangutorum* var. *mongolica* by DNA barcoding, thereby improving the accuracy of the method.
[0032] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0033] Example 1 Previous studies have found that the nucleotide sequences of the ITS2 region of *Nitraria tangutorum* and *Nitraria arvense* are very similar, but there are base variations at fixed sites. The nucleotide sequence of the ITS2 region of *Nitraria tangutorum* is shown in SEQ ID NO:3, and the nucleotide sequence of the ITS2 region of *Nitraria arvense* is shown in SEQ ID NO:4. Both ITS2 regions have base variations at positions 69bp, 103bp, 185bp, 239bp, 257bp, and 246bp. Specifically, in *Nitraria tangutorum*, the bases at positions 69bp, 103bp, 185bp, 239bp, and 257bp are all C, and a base is deleted at position 246bp; while in *Nitraria arvense*, the bases at positions 69bp, 103bp, 185bp, 239bp, 257bp, and 246bp are all T.
[0034] The ITS2 region containing the aforementioned variant sites was then used as a DNA barcode to distinguish between Nitraria tangutorum and Nitraria argyracea var. chinensis.
[0035] Example 2 The identification of *Nitraria tangutorum* and *Nitraria argyracea* based on DNA barcoding is performed using the following steps: Six samples were selected for subsequent experiments: three samples Ns1, Ns2, and Ns3, which were confirmed as small-fruited white thorn, from Gonghe County, Qinghai Province, China; and three samples Nt-DK1, Nt-DK2, and Nt-DK3, which were confirmed as white thorn, from Dengkou County, Inner Mongolia Autonomous Region, China.
[0036] 1. Experimental reagents: 1) High-efficiency plant genomic DNA extraction kit (Tiangen, DP350): 2) Platinum TMII. Hot-start PCR premix (2×) for amplification mix (Thermo Fisher 14000014); 3) Hi-Di deionized formamide, POP-7 adhesive, 10× Buffer (ABI 4311320); 4) Internal standard (Thermo ABI 4322682).
[0037] 5) ITS2F / ITS3R primer pair, the nucleotide sequences of ITS2F and ITS3R are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.
[0038] 2. Experimental apparatus 1) NANO Drop spectrophotometer (ThermoFisher); 2) BC-subMIDI electrophoresis tank (Beijing Baijing Biotechnology Co., Ltd.), BG-Power300C electrophoresis power supply (Beijing Baijing Biotechnology Co., Ltd.); 3) Centrifuge 1-14 (Sigma); 4) Verity PCR instrument (ABI); 5) Gel imaging system (Beijing Liuyi Company); 6) 3730xl gene analyzer (ABI).
[0039] 3. Experimental steps: 1) DNA extraction DNA was extracted according to the instructions for Tiangen DP350, followed by 1% agarose gel electrophoresis.
[0040] 2) Primer synthesis This embodiment uses the universal primers ITS2F and ITS3R for plant DNA barcoding; the nucleotide sequences of the primers ITS2F and ITS3R are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively, and were synthesized by a third-party company.
[0041] 3) PCR amplification and detection 3.1) The system is shown in Table 1.
[0042] Table 1 PCR amplification system
[0043] 3.2) The amplification procedure is shown in Table 2.
[0044] Table 2 PCR amplification program
[0045] 3.3) First, perform 2% agarose gel electrophoresis to determine the presence and approximate size of the product.
[0046] 4) Sequencing: Products with the target band were selected and analyzed using a 3730xl gene analyzer. The sequencing peak diagram is shown below. Figure 1 As shown.
[0047] 5) Data splicing and comparison Import the bidirectional sequencing data into BioEdit software, remove low-quality data, and perform bidirectional assembly. The nucleotide sequences of the ITS2 region from six samples are obtained as follows: >ITS2F3R-Ns1 AAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCCCACCGTCTACAAACGTGTGCGGGGAGCGGAGATTGGCCTCCCGTGAGGGTGTTCCCTCGCGGTTGGCCCAAACACAGGTCCCCGGCCGAGGAAGCCGCGACTTTCGGTGGTTGTTAACAAACAGACATGCCTTG TCGTGCTCTCCTCGTGCCTTTTGCGGCACCCTCGACCCTAAGAAGGGCCAGTGCACTCTTTTGAGTAAGTTGCGCTCGCTTTGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACCAGGATTCCCCTAGTAACGGCGAGCGAACCGG (SEQ ID NO:5); >ITS2F3R-Ns2 AAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCCCACCGTCTACAAACGTGTGCGGGGAGCGGAGATTGGCCTCCCGTGAGGGTGTTCCCTCGCGGTTGGCCCAAACACAGGTCCCCGGCCGAGGAAGCCGCGACTTTCGGTGGTTGTTAACAAACAGACATGCCTTGTCGTGCTCTCCTCGTGCCTTTTGCGGCACCCTCGACCCTAAGAAGGGCCAGTGCACTCTTTTGAGTAAGTTGCGCTCGCTTTGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACCAGGATTCCCCTAGTAACGGCGAGCGAACCGG(SEQ ID NO:6); >ITS2F3R-Ns3 AAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCCCACCGTCTACAAACGTGTGCGGGGAGCGGAGATTGGCCTCCCGTGAGGGTGTTCCCTCGCGGTTGGCCCAAACACAGGTCCCCGGCCGAGGAAGCCGCGACTTTCGGTGGTTGTTAACAAACAGACATGCCTTGTCGTGCTCTCCTCGTGCCTTTTGCGGCACCCTCGACCCTAAGAAGGGCCAGTGCACTCTTTTGAGTAAGTTGCGCTCGCTTTGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACCAGGATTCCCCTAGTAACGGCGAGCGAACCGG(SEQ ID NO:7); >ITS2F3R-Nt-DK1 AAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCCCACCGTCTACAAACGCGTGCGGGGAGCGGAGATTGGCCTCCCGTGAGGGCGTTCCCTCGCGGTTGGCCCAAACACAGGTCCCCGGCCGAGGAAGCCGCGACTTTCGGTGGTTGTTAACAAACAGACATGCCCTGTCGTGCTCTCCTCGTGCCTTTTGCGGCACCCTCGACCCTAAGAAGGGCCAGCGCACTCTTTGAGTAAGCTGCGCTCGCTTTGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACCAGGATTCCCCTAGTAACGGCGAGCGAACCGG(SEQ ID NO:8); >ITS2F3R-Nt-DK2 AAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCCCACCGTCTACAAACGCGTGCGGGGAGCGGAGATTGGCCTCCCGTGAGGGCGTTCCCTCGCGGTTGGCCCAAACACAGGTCCCCGGCCGAGGAAGCCGCGACTTTCGGTGGTTGTTAACAAACAGACATGCCCTGTCGTGCTCTCCTCGTGCCTTTTGCGGCACCCTCGACCCTAAGAAGGGCCAGCGCACTCTTTGAGTAAGCTGCGCTCGCTTTGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACCAGGATTCCCCTAGTAACGGCGAGCGAACCGG(SEQ ID NO:9); >ITS2F3R-Nt-DK3 AAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCCCACCGTCTACAAACGCGTGCGGGGAGCGGAGATTGGCCTCCCGTGAGGGCGTTCCCTCGCGGTTGGCCCAAACACAGGTCCCCGGCCGAGGAAGCCGCGACTTTCGGTGGTTGTTAACAAACAGACATGCCCTG TCGTGCTCTCCTCGTGCCTTTTGCGGCACCCTCGACCCTAAGAAGGGCCAGCGCACTCTTTGAGTAAGCTGCGCTCGCTTTGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTTACCAGGATTCCCCTAGTAACGGCGAGCGAACCGG (SEQ ID NO:10).
[0048] The six samples were compared with the DNA barcode sequences in Example 1. It was found that the three *Nitraria tangutorum* samples (Nt-DK1, Nt-DK2, and Nt-DK3) all had C bases at positions 69bp, 103bp, 185bp, 239bp, and 257bp in the ITS2 region, and a base deletion occurred at position 246bp. Conversely, the three *Nitraria tangutorum* small-fruited samples (Ns1, Ns2, and Ns3) all had T bases at positions 69bp, 103bp, 185bp, 239bp, 257bp, and 246bp in the ITS2 region. The comparison results are as follows: Figure 2 As shown.
[0049] It is evident that the DNA barcoding method used in this invention can effectively distinguish between white thorn and small-fruited white thorn with high accuracy.
[0050] Furthermore, in this embodiment, the nucleotide sequences of the ITS2 region obtained from the sequencing of the above six samples were imported into Mega for alignment, and the Muscle algorithm was used to perform clustering to construct a phylogenetic tree. The results are as follows: Figure 3 As shown.
[0051] Depend on Figure 1 It can be concluded that the three white thorn samples Nt-DK1, Nt-DK2, and Nt-DK3 and the three small-fruited white thorn samples Ns1, Ns2, and Ns3 each cluster into two gene clusters, which also verifies the above-mentioned DNA barcoding detection method.
[0052] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A DNA barcode for identifying Nitraria tangutorum and Nitraria sphaerica, characterized in that, The DNA barcode for identifying Nitraria sibirica and Nitraria tangutorum comprises specific variation site combinations on an ITS2 region, and the specific variation site combinations comprise a first variation site, a second variation site, a third variation site, a fourth variation site, a fifth variation site and a sixth variation site; the first variation site is located at 69 bp of the ITS2 region, and C / T polymorphism exists; the second variation site is located at 103 bp of the ITS2 region, and C / T polymorphism exists; the third variation site is located at 185 bp of the ITS2 region, and C / T polymorphism exists; the fourth variation site is located at 239 bp of the ITS2 region, and C / T polymorphism exists; the fifth variation site is located at 246 bp of the ITS2 region, and base deletion / T polymorphism exists; and the sixth variation site is located at 257 bp of the ITS2 region, and C / T polymorphism exists; and the nucleotide sequence of the ITS2 region is shown in SEQ ID NO: 3 or SEQ ID NO:
4.
2. The DNA barcode for identifying Nitraria sibirica and Nitraria tangutorum according to claim 1, characterized in that, The primer for amplifying the ITS2 region comprises ITS2F and ITS3R, and the nucleotide sequences of the ITS2F and ITS3R are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively.
3. Use of the DNA barcode for identifying Nitraria sibirica and Nitraria tangutorum or a reagent for detecting the DNA barcode for identifying Nitraria sibirica and Nitraria tangutorum in claim 1 or 2 in identifying Nitraria sibirica and Nitraria tangutorum.
4. Use according to claim 3, characterized in that, The reagent comprises ITS2 primers, and the ITS2 primers comprise ITS2F and ITS3R, and the nucleotide sequences of the ITS2F and ITS3R are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively.
5. Use according to claim 4, characterized in that, The reagent further comprises a PCR amplification reagent.
6. A method for discriminating between Nitraria sibirica and Nitraria tangutorum, characterized in that, The method comprises the following steps: PCR amplification is performed on genomic DNA of a sample to be tested by using the ITS2 primers to obtain an ITS2 amplification product; Gel electrophoresis detection is performed on the ITS2 amplification product, and the ITS2 amplification product with a target band is selected; Sequencing is performed on the ITS2 amplification product with the target band to obtain a nucleotide sequence of the ITS2 region of the sample to be tested, and the ITS2 primers comprise ITS2F and ITS3R, and the nucleotide sequences of the ITS2F and ITS3R are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively; The nucleotide sequence of the ITS2 region is compared with the DNA barcode for identifying Nitraria sibirica and Nitraria tangutorum in claim 1 or 2 to determine the result: When the bases at the positions of 69 bp, 103 bp, 185 bp, 239 bp and 257 bp of the aligned positions are all C, and base deletion occurs at the position of 246 bp of the aligned positions, the sample to be tested is Nitraria sibirica; When the bases at positions 69bp, 103bp, 185bp, 239bp, 257bp and 246bp of the aligned positions of the ITS2 region nucleotide sequence are all T, the sample to be tested is Nitraria sphaerica.
7. The method of claim 6, wherein, The sequencing comprises Sanger sequencing.
8. The method according to claim 6, characterized in that, When the sample to be tested comprises multiple samples, the alignment comprises multiple sequence alignment, alignment and correction of the ITS2 region nucleotide sequences of the multiple samples to be tested, so as to confirm the base types at positions 69bp, 103bp, 185bp, 239bp, 257bp and 246bp of the DNA barcode of Nitraria sphaerica and Nitraria tangutorum.
9. The method according to any one of claims 6 to 8, characterized in that, The method further comprises: performing cluster analysis on the ITS2 region nucleotide sequence of the sample to be tested and the ITS2 region nucleotide sequences of the Nitraria sphaerica and Nitraria tangutorum samples confirmed, and constructing a phylogenetic tree; if the sample to be tested is clustered into the Nitraria sphaerica gene cluster confirmed, it is determined to be Nitraria sphaerica, and if the sample to be tested is clustered into the Nitraria tangutorum gene cluster confirmed, it is determined to be Nitraria tangutorum.
10. The method of claim 6, wherein, The PCR amplification system comprises: ITS2F 1 μL, ITS3R 1 μL, Platinum TM II hot start PCR premix 10 μL, genomic DNA 2 μL, ddH2O 6 μL; The PCR amplification program is: 94℃ pre-denaturation for 2min, 1 cycle; 94℃ denaturation for 15s, 56℃ annealing for 15s, 68℃ extension for 15s, 35 cycles; 65℃ extension for 5s; 4℃ keeping.
Citation Information
Patent Citations
Method for identifying lycium ruthenicum based on DNA bar code and application thereof
CN110229927A
DNA barcode identification method of flaccid anemone rhizome / flaccid anemone rhizome original plants
CN110592261A
Method for identifying traditional Chinese medicine ficus microcarpa based on DNA bar code (ITS2) and application thereof
CN112877451A
Application of DNA bar code in identifying / distinguishing purslane and / or portulaca pilosa
CN118600074A
Honeysuckle stem and red-white honeysuckle stem molecule identification method based on DNA bar code
CN119144762A