Limonium bicolor gene LbZFP8 and application thereof

By screening and cloning the LbZFP8 gene of the C2H2 transcription factor of Limonium bicolor, the problem of unresolved salt gland development in saline soil was solved, realizing the improvement of crop salt tolerance and the sustainable utilization of saline soil.

CN121779522APending Publication Date: 2026-04-03SHANDONG NORMAL UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202610138178.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-31
Publication Date
2026-04-03

Smart Images

  • Figure CN121779522A_ABST
    Figure CN121779522A_ABST
Patent Text Reader

Abstract

The invention discloses a limonium bicolor gene LbZFP8 and application thereof, and relates to the technical field of biological genetic engineering. The invention relates to a limonium bicolor gene LbZFP8 and application thereof. The limonium bicolor gene LbZFP8 is a gene for coding a protein composed of an amino acid sequence as shown in SEQ ID NO: 1; the biological material is recombinant DNA, an expression cassette, a transposon, a plasmid vector, a virus vector or engineering bacteria. The gene provided by the invention can significantly improve the salt tolerance and oxidation resistance of a target plant by transforming plant cells. Experiments show that under the salt stress condition, the survival rate of the LbZFP8 overexpressed arabidopsis thaliana plant is increased by about 45% compared with that of a control group. Meanwhile, the compound plays a key role in regulating and controlling an active oxygen scavenging system, and the activity of SOD and POD enzymes can be effectively enhanced. The technology provides an important gene resource for cultivating new varieties of crops with strong stress resistance, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to the gene of *Limonium bicolor*. LbZFP8 And its applications. Background Technology

[0002] Soil salinization is a widespread problem globally. Soil salinization refers to the accumulation of salts in soil, and soil salinity is related to the amount of soluble salts and exchangeable sodium ions in the soil. By definition, a saturated solution at 25°C with a conductivity greater than 4 ds·m... -1 Soils with an exchangeable sodium ion ratio of less than 15% are called saline soils. Furthermore, rising sea levels caused by global warming exacerbate soil salinization. Soil salinization damages the natural soil ecosystem, leading to decreased soil fertility, reduced crop yields, and in some areas, even rendering the land uncultivable, resulting in land abandonment and significantly reducing agricultural resource utilization. The salinization of land is expanding year by year, while the cost of remediation is high, putting pressure on agricultural production and local economies. Saline land has become an important reserve of arable land for addressing global climate change and ensuring food security. Promoting the sustainable use of saline land and improving its ecological environment is of great significance for ensuring food and ecological security. Plants face salt stress, and the main harms they suffer can be divided into primary stress and secondary stress. Primary stress includes osmotic stress and ionic stress; secondary stress includes oxidative stress and nutrient stress. Specifically, salt stress initially triggers osmotic stress. This is because excessive salt in the soil increases the osmotic pressure of the soil solution, making it difficult for plant root cells to absorb water or even causing water loss, thus hindering normal plant growth and development. To alleviate the damage caused by salt stress, plants initiate a series of defense responses. To cope with osmotic stress under high salinity, plants synthesize or accumulate osmotic regulating substances to reduce their own osmotic potential and prevent excessive water loss from cells. To cope with ion stress, plants convert sodium... + Cl - and Ca2 + Plants can alleviate ion homeostasis imbalances in the cell sap by efflux or vacuolar isolation. To combat oxidative damage, plants activate their antioxidant systems, primarily by increasing the activity of antioxidant enzymes and synthesizing antioxidants (such as glutathione) to scavenge reactive oxygen species (ROS). Furthermore, under salt stress, the levels of various hormones in plants change, acting as signaling molecules to regulate the plant's resistance to salt stress. For example, abscisic acid (ABA) levels increase rapidly under salt stress, promoting stomatal closure, reducing transpiration, and improving the plant's water retention capacity.

[0003] Halophytes are defined as plants that can effectively absorb water and nutrients, grow and develop normally, and complete their life cycle when the NaCl concentration in the soil is not less than 200 mM. Based on the different ways halophytes transport ions, Breckle divides them into three categories: (1) Euhalophytes (such as Suaeda salsa), which transport NaCl to the soil through salt ion compartmentalization. + Transported and isolated into intracellular vacuoles or succulent leaves, while simultaneously absorbing large amounts of water and reducing Na+ + Concentration; (2) Salt-resistant halophytes (such as reeds), which will absorb Na + The parenchyma tissue of the xylem, which gathers at the junction of the root and stem, has a well-developed apoplastic barrier that prevents Na+ from entering the cell. + (3) Salt-secreting halophytes (such as Limonium bicolor and Limonium spp.) use salt glands or salt vesicles to expel excess salt ions from their bodies.

[0004] Salt glands are specialized functional epidermal structures evolved by halophytes during long-term adaptation to salt stress. They excrete excess salt absorbed by the plant, maintaining normal growth and resisting the adverse effects of salt stress. The salt gland of *Limonium bicolor* consists of 16 cells. Excluding the collecting cells, the remaining cells are arranged in the same manner as in a 20-cell salt gland: the secretory cell (SC) is located in the center, surrounded by adjacent cells (AC), which in turn are surrounded by inner cup cells (IC) and outer cup cells (OC). Yuan et al., by continuously sampling the first true leaf of *Limonium bicolor* and tracing its cell differentiation process, divided the developmental stages of the true leaf in detail and proposed for the first time that the salt gland develops earlier than the stomata. Based on the differentiation of *Limonium bicolor* leaves, its development process can be divided into five stages: the first stage is the undifferentiated stage; the second stage is the salt gland differentiation stage, which eventually forms a mature 16-cell salt gland; the third stage is the stomatal differentiation stage, where stomata begin to develop; the fourth stage is the epidermal cell differentiation stage, where, after the stomata mature, the remaining stem cells develop into epidermal cells; and the fifth stage is the maturation stage, where the leaves enter the maturation stage. The molecular mechanisms of *Limonium bicolor* salt gland development have been extensively studied and reported. Multiple molecules, including transcription factors, functional proteins, and small RNAs, are involved in salt gland development and salt secretion regulation, and a preliminary regulatory network for salt gland development has been revealed. Several transcription factors play a role in the salt gland development of *Limonium bicolor*. Summary of the Invention

[0005] The purpose of this invention is to provide the gene for *Limonium bicolor*. LbZFP8 And its applications.

[0006] C2H2 zinc finger protein family genes are widely involved in plant growth, development, and stress responses, but their function and mechanism in the development of salt glands in *Limonium bicolor* have not been systematically elucidated. This study systematically analyzed the C2H2 family genes of *Limonium bicolor* and screened out one C2H2 transcription factor. LbZFP8 This gene is highly expressed in the early stages of salt gland development, can be induced by salt, and its specific localization in salt glands was found through in situ hybridization. Transgenic materials have shown that… LbZFP8 It plays a positive regulatory role in salt gland development and salt tolerance. LbZFP8 Heterologous overexpression of the gene in Arabidopsis thaliana revealed increased epidermal hair density and enhanced salt tolerance, while also providing valuable genes for transforming crops and other non-halophytes and improving saline soils.

[0007] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a gene for *Limonium bicolor*. LbZFP8 It is a gene that encodes either protein (a) or (b) as follows: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO:1; or (b) A protein derived from (a) with the sequence shown in SEQ ID NO:1 substituted, deleted or added with one or more amino acids and having the same function.

[0008] This invention clones genes from *Limonium bicolor*. LbZFP8 , LbZFP8 The gene coding region, including the stop codon, is 1029 bp (SEQ ID NO:2) and encodes 348 amino acids (SEQ ID NO:1).

[0009] Secondly, the present invention provides a product containing the aforementioned gene. LbZFP8 Or the biological material of the promoter, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or non-renewable plant parts.

[0010] Thirdly, the present invention provides the aforementioned gene. LbZFP8 or containing the aforementioned gene LbZFP8 The application of biomaterials in the preparation of transgenic plants.

[0011] Fourthly, the present invention provides the aforementioned gene. LbZFP8 Or contains genes LbZFP8 Any of the following applications of biomaterials: (1) Used to improve the salt tolerance of plants; (2) Used for plant variety improvement; (3) Used for the improvement of saline-alkali land.

[0012] In this invention, the plant includes halophytes (such as *Limonium bicolor*) or Arabidopsis thaliana.

[0013] Fifthly, the present invention provides a method for improving the salt tolerance of plants, said method being selected from the following ① or ②: ① To enable plants to express the aforementioned gene LbZFP8 The encoded protein; ② Overexpressing the gene in plants LbZFP8 .

[0014] The overexpression mode is selected from the following 1) to 5), or any combination thereof: 1) By importing a plasmid containing the gene; 2) By increasing the copy number of the aforementioned genes on plant chromosomes; 3) By altering the promoter sequence of the aforementioned genes on plant chromosomes; 4) By operatively linking a strong promoter to the gene; 5) By introducing enhancers.

[0015] Sixthly, the present invention provides any of the following applications of the transgenic plants obtained according to the above method: i. Used for plant breeding; ii. Used for planting in saline-alkali land.

[0016] Besides *Limonium bicolor* or *Arabidopsis thaliana*, the plants that can be included are: (1) Cereal crops (wheat, rice, corn, sorghum, millet, foxtail millet, buckwheat); (2) Legumes (soybeans, broad beans, peas, mung beans, red beans, cowpeas, lentils, etc.); (3) Root and tuber crops (sweet potato, potato, cassava, yam, taro, etc.); (4) Fiber crops (cotton, ramie, jute, flax, sisal, etc.); (5) Oil crops (rapeseed, peanut, sunflower, sesame, camellia, oil palm, olive, etc.); (6) Medicinal crops (ginseng, wolfberry, honeysuckle, Panax notoginseng, mint, angelica); (7) Forage crops (alfalfa, ryegrass, clover, Sudan grass, etc.); (8) Green manure crops (purple clover, vetch, sesbania, sweet clover, etc.).

[0017] Furthermore, the breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

[0018] The beneficial effects of this invention are as follows: This application is the first to systematically analyze the C2H2 family genes of *Limonium bicolor* and screen out a C2H2 transcription factor. LbZFP8 This gene is highly expressed in the early stages of salt gland development, can be induced by salt, and its specific localization in salt glands was found through in situ hybridization. Transgenic materials have shown that… LbZFP8 It plays a positive regulatory role in salt gland development and salt tolerance. It is overexpressed in Arabidopsis thaliana. LbZFP8 It can enhance salt tolerance. This invention lays the foundation for further research and elucidation of the developmental mechanism of salt glands, and at the same time provides valuable genes for transforming crops and other non-halophytes and improving saline soils.

[0019] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the preferred embodiments of the present invention are described in detail below with reference to the accompanying drawings. Attached Figure Description

[0020] Figure 1 Screening diagram for C2H2 family genes that regulate salt gland development.

[0021] Figure 2 for LbZFP8 Diagram showing the regulation of salt gland density and salt secretion capacity of *Limonium bicolor*.

[0022] Figure 3 for LbZFP8 Diagrams showing DAB and NBT staining and physiological parameters of gene overexpression and knockout lines.

[0023] Figure 4 for LbZFP8 A diagram illustrating the enhancement of Arabidopsis seedlings' resistance to NaCl through osmosis and ionization effects.

[0024] Figure 5 For WT and LbZFP8 Determination of phenotypes and physiological indicators of OE strains during the seedling stage after NaCl treatment. Detailed Implementation

[0025] The technical solution of the present invention will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] In the description of this invention, it should be noted that the terms "center," "upper," "lower," "left," "right," "vertical," "horizontal," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are used only for the convenience of describing the invention and for simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on the invention. Furthermore, the terms "first," "second," and "third" are used for descriptive purposes only and should not be construed as indicating or implying relative importance.

[0027] In the description of this invention, it should be noted that, unless otherwise explicitly specified and limited, the terms "installation," "connection," and "linking" should be interpreted broadly. For example, they can refer to a fixed connection, a detachable connection, or an integral connection; they can refer to a mechanical connection or an electrical connection; they can refer to a direct connection or an indirect connection through an intermediate medium; and they can refer to the internal connection of two components. Those skilled in the art can understand the specific meaning of the above terms in this invention based on the specific circumstances.

[0028] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0029] This invention analyzes the expression of 86 C2H2 genes at different leaf developmental stages and after salt treatment. LbZFP8 Highly expressed during leaf differentiation stages A and B (i.e., salt gland development stages) and significantly induced by salt, this gene was selected as a candidate for further analysis of its salt gland development and salt tolerance function. After heterologous expression in Arabidopsis, the transgenic lines exhibited higher salt tolerance.

[0030] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions. The primers used in this invention are shown in Table 1.

[0031] Table 1 Primers used in this invention Name Sequence -F ATGGAGAAGAAGGGCTCAGATG -R CAGACGAAGATCTAAACTCACTTGACC Promoter - F GGTTAAGGAGGAGTTAGTTAAGAATCAG Promoter - R ATATCAAGCCGGCCGGAG -1300-F ACGGGGGACGAGCTCGGTACCATGGAGAAGAAGGGCTCAGATG -1300-R GCCCTTGCTCACCATGTCGACCAGACGAAGATCTAAACTCACTTGACC LbZFP8 - Crispr - F TCACAGTTGCTAATTAACACCCCATTTTCTAA LbZFP8 - Crispr - R TCTTCTAATGTCGCTACGGCGTTTCTCTCCGT Example 1 Gene LbZFP8 Cloning and Bioinformatics Analysis 1. Materials and Methods 1.1 Plant materials and growing conditions Wild *Limonium bicolor* seeds were collected from the saline-alkali land of the Yellow River Delta (Shandong Province, China). Several dried and impurity-removed *Limonium bicolor* seeds were placed in 10 mL centrifuge tubes containing 70% ethanol solution and shaken for 6 min for preliminary sterilization. The ethanol solution was discarded, and 6% sodium hypochlorite solution was added to the centrifuge tubes. Shaking was repeated once for deep sterilization. In a clean bench, the sodium hypochlorite solution was discarded, and the seeds were rinsed 4-6 times with sterile water. Once the solution was colorless and clear, the seeds were blotted dry with filter paper and transferred to MS agar plates. The plates were sealed and transferred to a sterile tissue culture room for cultivation. Nutrient soil culture of *Limonium bicolor*: For cultivation requiring observation of the *Limonium bicolor* phenotype, the dried seeds were evenly scattered in nutrient soil, sprayed with water, sealed with a film, and placed in a constant temperature climate chamber for cultivation. After about one week of germination, the seedlings were transplanted into appropriately sized flowerpots.

[0032] 1.2 LbZFP8 Location analysis Will LbZFP8 The gene fragment was ligated into the pCAMBIA-1300 vector containing a GFP tag, driven by the 35S promoter. LbZFP8 -GFP fusion protein was transiently expressed in tobacco epidermal cells. The fluorescence was observed by two-photon confocal microscopy, and green and red fluorescence images were captured under emission light at 488 nm and 560 nm, respectively. The two images were superimposed with bright-field images to determine the location of the luminescent spots.

[0033] In order to determine LbZFP8 To determine the expression location in *Limonium bicolor*, in situ hybridization was performed from the first true leaf. Tissue was fixed with in situ hybridization fixative, embedded in paraffin, and dehydrated using a series of alcohols. Tissue sections (6 μm) were treated with proteinase K, and 100 μL of hybridization solution containing the LbZFP8 probe was added. The sections were then incubated in a humidified chamber at 55°C for 16 h. After blocking and washing, BCIP / NBT staining was performed, and images were acquired and analyzed using a digital scanning microtome.

[0034] 1.3 Genetic transformation of *Limonium bicolor* Constructing genes LbZFP8 Overexpression vector, pCAMBIA1300- LbZFP8 Expression vectors were developed, and gene knockout vectors were constructed for Agrobacterium-mediated transformation, thereby enabling tissue infection and culture of Limonium bicolor.

[0035] 1.4 Observation and statistics of salt gland density Cut square sections from newly grown leaves of *Limonium bicolor* and observe the underside of the leaves. Observe the size and shape of the salt glands; normal salt glands show four luminescent spots under ultraviolet light. Calculate the salt gland density by counting the number of salt glands in multiple unit fields of view, converting it to the number of salt glands per square millimeter.

[0036] 1.5 Observation of secretory vesicles and statistics of secretion rate Perforations were made in the leaves of *Limonium bicolor* using a 1 cm diameter punch to obtain leaf discs from different strains. Mineral oil was applied to the back of each leaf disc to coat it completely. Secretory vacuoles were observed and photographed after 24 hours. Depending on the salt gland density and secretion rate, the secretory vacuoles exhibited different sizes and shapes.

[0037] Collect the secretory vesicles and mineral oil from the back of the leaf disc using a pipette. After centrifugation, remove the mineral oil and measure the volume of the secreted fluid using a pipette. Measure the Na+ content of the secreted fluid using a flame spectrophotometer. + Concentration. Based on the volume of secreted fluid and Na+ + Concentration calculation of Na in secretions + Total amount. Calculate the Na content per salt gland based on the number of salt glands on the leaf disc. + Secretion rate.

[0038] 1.6 Measurement of physiological indicators 1.6.1 Determination of malondialdehyde (MDA) content Different Limonium bicolor strains treated with 200 mM NaCl for one week and untreated strains were analyzed. The MDA content in the tissues was calculated based on the OD value, supernatant volume, and tissue weight.

[0039] 1.6.2 Determination of H2O2 content Multiple strains of *Limonium bicolor*, treated with NaCl for one week and untreated, were sampled at the same location on the leaves, with a yield of 0.1 g each. Hydrogen peroxide content was measured using a hydrogen peroxide content assay kit. 1.6.3 Determination of proline content Different Limonium bicolor strains were treated with 200 mM NaCl for one week and untreated, and their OD values ​​were measured. The proline content was obtained according to the standard curve.

[0040] 1.6.4 Na + and K + Determination of content Different strains treated with 200 mM NaCl and those without treatment were sampled, boiled in water, and filtered. The resulting solutions were then subjected to NaCl analysis using a flame spectrophotometer. + and K + Content determination.

[0041] 1.7 Data Statistics and Analysis The significance of differences in experimental data was analyzed using Duncan's multiple range method in SPSS (v19.0) software. Each group had three replicates, and the standard deviation (SD) was calculated. Final data are expressed as mean ± standard deviation. Significant differences between groups (p<0.05) were indicated by different letters, while the same letter represented no difference.

[0042] 2. Results 2.1 Screening of C2H2 family genes regulating salt gland development The expression of 86 C2H2 genes at different leaf developmental stages and after salt treatment was statistically analyzed, and expression heatmaps and bar charts based on phylogenetic trees were drawn. Figure 1 A). The gene Lb5G29058.5 is highly expressed and significantly induced by salt during leaf differentiation stages A and B (i.e., salt gland development stages). Analysis revealed that the protein encoded by this gene has a conserved C2H2 domain and an EAR motif at the C-terminus. Phylogenetic analysis showed that it is closely related to the ZFP8 protein of Jatropha curcas and Arabidopsis thaliana, and thus it was named Lb5G29058.5. LbZFP8 ( Figure 1 (B and C). LbZFP8 Using the gene sequence as a probe, in situ hybridization of nucleic acids was performed on the leaves of *Limonium bicolor*, and the results were found... LbZFP8 Genes are specifically expressed in salt glands ( Figure 1 D), discovered through bioinformatics analysis LbZFP8 The promoter region contains various cis-acting elements. Among them, elements responding to abiotic stress include MBS involved in drought-induced responses and LTR involved in low-temperature responses; elements responding to hormone responses include TATC-Box involved in gibberellin responses and ABRE involved in abscisic acid responses, etc. Figure 4 F), *Limonium bicolor* seedlings were treated with NaCl, mannitol, and different hormones (salicylic acid, gibberellin, abscisic acid) respectively, and the results were tested. LbZFP8 Gene expression patterns were discovered. LbZFP8 All samples showed upregulated expression within 12 hours. (Note: This likely refers to a specific metric or formula.) LbZFP8 It may be involved in the salt stress response process ( Figure 1 G, H). The promoter of this gene was recombined with the GUS expression vector and transduced into Arabidopsis thaliana. GUS staining of positive homozygous transgenic lines revealed that the epidermal hairs of young true leaves, stem epidermal hairs, and root hairs of the transgenic lines all appeared blue. In addition, the vascular tissues of cotyledons, basal leaves, stem leaves, calyx, and roots also showed staining. Figure 1 I), Explanation LbZFP8 Homologous genes in Arabidopsis thaliana may be involved in epidermal hair development and substance transport.

[0043] 2.2 LbZFP8Functional study of salt gland development and salt tolerance in Limonium bicolor 2.2.1 LbZFP8 Promotes the development of salt glands Obtained via Agrobacterium-mediated transformation LbZFP8 Transgenic strains. Selected *Limonium sibiricum* strains of uniform size and growth. LbZFP8 Differences in salt gland expression were observed in overexpression, knockout lines, and WT strains. The results showed... LbZFP晓 Overexpression significantly increased the number of salt glands. 遗漏了一个8 Salt gland density was significantly reduced after knockout. LbZFP8 (A and D). But... Figure 2 The area of ​​other types of epidermal cells around the salt gland did not change significantly after gene overexpression or knockout. LbZFP8 Experiments were conducted on leaf disc salt secretion using B and E. The results showed that... Figure 2 After gene overexpression, the leaf disc secretory vacuoles enlarge, and the total secretion volume increases; after knockout, the secretory vacuoles shrink, and the total secretion volume decreases. LbZFP8 C and F), while the salt secretion rate of individual salt glands showed no significant change (C and F), Figure 2 G), Explanation Figure 2 Influencing the salt secretion of *Limonium bicolor* by affecting the density of salt glands does not affect the salt secretion rate of individual salt glands. Therefore, it can be inferred that... LbZFP8 It positively regulates the development of salt glands, thereby promoting the overall salt secretion process of the leaves. LbZFP8 Enhance the salt tolerance of Limonium bicolor. Overexpression, knockout, and WT lines were treated for 7 days with Hogland solution containing 250 mM NaCl (experimental group) and Hogland nutrient solution without NaCl (control group). Leaf discs were then collected for DAB and NBT staining, and salt tolerance-related physiological indicators, such as MDA, ion content, and proline, were measured. Results showed that in the control group, there was no significant difference in growth among the different lines; however, under NaCl treatment, the overexpression lines grew better, while the knockout lines showed smaller growth. LbZFP8 In the control group, there were no significant differences in DAB and NBT staining among different strains; however, under NaCl treatment, the overexpressing strains showed lighter DAB and NBT staining than the WT strains, while the knockout strains showed darker staining. Figure 3 CE). Physiological index measurements showed that the levels of MDA and H2O2 in the overexpression lines treated with NaCl were lower than those in the control. Figure 3 F and H), the relative content of proline increased (F and H), Figure 3 F), containing less Na. + And more K + Na + / K + Lower, ( Figure 3 IK), while the knockout lines showed the opposite. This indicatesFigure 3 It plays a positive regulatory role in the salt tolerance of Limonium bicolor.

[0044] 2.3 LbZFP8 Enhanced salt tolerance of Arabidopsis thaliana 2.3.1 LbZFP8 Salt tolerance index determination of transgenic Arabidopsis thaliana Using the inflorescence infection method, obtain LbZFP8 Transgenic Arabidopsis thaliana lines. Arabidopsis thaliana WT and... LbZFP8 The overexpression lines were cultured on plates containing 0, 80, 100, and 120 mM NaCl, and their growth was observed. On 1 / 2 MS medium without NaCl, the growth of the WT and OE lines was consistent. LbZFP8 In 1 / 2 MS medium containing NaCl, the growth of all lines was inhibited, and the inhibitory effect increased with increasing salt concentration. However, the growth of the OE line was better than that of the WT line. Figure 4 A). And WT and Figure 4 Germination rate, cotyledon growth rate, and root length of the overexpression lines under different NaCl concentrations showed no difference among the lines under 0 mM NaCl conditions; however, under NaCl treatment, the germination potential, cotyledon growth rate, and root length of WT were significantly lower than those of OE. LbZFP8 (BD). Therefore, it can be inferred that... Figure 4 It enhanced the salt tolerance of Arabidopsis seedlings.

[0045] WT and LbZFP晓 Overexpression lines were treated with 216 mM mannitol (isotonic with 120 mM NaCl) and 12 mM lithium chloride (LiCl) (isotonic with 120 mM NaCl), respectively. Germination rate, cotyledon emergence rate, and root length were recorded for each line. Results showed that under mannitol and lithium chloride treatments, WT and... 遗漏了一个8 The growth of overexpression lines varied, with lithium chloride treatment showing more significant differences. LbZFP8 EH). From this, we can infer that... [[ID=9J]]LbZFP8 Enhanced resistance to salt stress by increasing the dual resistance of Arabidopsis to osmotic and ion stress, with the improvement in ion resistance being more significant.

[0046] WT and LbZFP8 Phenotypic results were observed after two weeks of normal culture and treatment with 100 mM NaCl for the overexpression lines. WT and t-weight ratios were statistically analyzed. Figure 4 Overexpression lines height. Under normal conditions, WT and LbZFP8 There was no significant difference in the growth status of overexpressing lines; under salt stress, WT plants were significantly stunted and showed weakened growth; while LbZFP8The growth inhibition of overexpression lines was significantly reduced, indicating that overexpression... LbZFP8 It can enhance the salt tolerance of plants. Under salt stress, the plant height of WT was significantly reduced, and although the plant height of the overexpression lines also decreased, it was significantly higher than that of WT, further verifying the effect of overexpression. LbZFP8 Protective effect on plant growth under salt stress ( LbZFP8 A and B). Salt tolerance-related physiological indicators, such as MDA, ion content, and proline, were measured. The results showed that in the control group, there were no significant differences among different strains; however, under NaCl treatment, the physiological indicators showed that the MDA content of the overexpressing strains treated with NaCl was lower than that of the control. LbZFP8 C), the relative content of proline increased ( LbZFP8 D), containing less Na + And more K + The opposite is true for knockout strains. Figure 5 EF). This indicates... Figure 5 It plays a positive regulatory role in the salt tolerance of *Limonium bicolor*. Overexpression of transcription factors... Figure 5 It can reduce cell membrane damage, enhance osmotic regulation (proline accumulation), and inhibit Na+. + Accumulate and retain K + and reduce Na + / K + Through methods such as ratios, the salt tolerance of plants can be significantly improved.

[0047] Figure 5 Screening of C2H2 family genes regulating salt gland development. (A): A phylogenetic tree shows the evolutionary relationships of C2H2 family genes, which can be roughly divided into 6 subfamilies based on their evolutionary relationships. A heatmap shows the relative expression levels of C2H2 family genes at five leaf developmental stages; a bar chart shows the relative expression levels of C2H2 family genes at different time points after salt treatment; (B): LbZFP8 Conservative structural domain pattern diagram; (C): LbZFP8 Phylogenetic trees were constructed using proteins from multiple closely related species. Arabidopsis protein sequences were obtained from the TAIR website, and protein sequences from other species were obtained from the NCBI website; (D): Figure 1 In situ hybridization analysis; (E): LbZFP8 Subcellular localization analysis. pCAMBIA1300-GFP driven by the 35S promoter and LbZFP8 -GFP fusion protein was transiently expressed in tobacco epidermal cells and observed using a confocal microscope; (F): LbZFP8 Promoter element analysis; (G): LbZFP8 Expression levels (H) during salt and drought treatments from 0 to 48 h; LbZFP8Expression of salicylic acid, abscisic acid, and gibberellin after treatment for 0–48 h; (I): LbZFP8 GUS staining results of promoter transfection in Arabidopsis thaliana. Values ​​are expressed as mean ± SD. Each group had three biological replicates. Duncan's multiple range test was used. Different letters (af) indicate differences between groups (p < 0.05).

[0048] LbZFP8 for LbZFP8 Regulating the salt gland density and salt secretion capacity of *Limonium bicolor*. (A) Observation of wild-type (WT) under ultraviolet light (358 nm). LbZFP8 Representative images of salt glands in the leaves of overexpression and knockout lines are presented. (B) Observation of wild-type and knockout lines using scanning electron microscopy. Figure 2 (C) Epidermal cells of overexpression and knockout lines are presented in representative images. (D) Under NaCl treatment conditions, droplets secreted by salt glands on the leaf surface are photographed, and representative images are presented. LbZFP8 The number of salt glands on leaves of overexpression and knockout lines was determined, and the salt gland density was calculated. (E) Wild-type and knockout lines were determined and plotted. LbZFP8 Epidermal cell area of ​​overexpression and knockout lines. (F) Collect and quantify droplets secreted by salt glands on the surface of each leaf disc. (G) Calculate Na+ content of individual salt glands. + Secretion rate. Error bars represent standard deviation. Different letters indicate significant differences between groups according to Duncan's multiple comparison test (p<0.05).

[0049] LbZFP晓 for 遗漏了一个8 DAB and NBT staining and physiological parameters were measured in gene overexpression and knockout lines. (A): Whole plant phenotype of different lines under control and NaCl treatment; (B): Total leaf area of ​​different lines under control and NaCl treatment; (C): DAB and NBT staining of different lines under control and NaCl treatment; (D): Mean optical density measurement of DAB staining in different lines; (E): Mean optical density measurement of NBT staining in different lines; (FK): Physiological parameters of different lines under control and NaCl treatment. Values ​​are expressed as mean ± SD. Each group had three biological replicates. Duncan's multiple range test was used, and differences between groups were indicated by different letters (ae) (p < 0.05).

[0050] LbZFP8 for LbZFP8 Enhancing Arabidopsis thaliana seedling resistance to NaCl through osmosis and ionization effects, (A): Effects of different NaCl concentrations on Arabidopsis thaliana WT and Figure 3Effects of overexpression on germination stage seedlings; (BD): Statistical analysis of germination rate (1d), cotyledon emergence rate (3d), and root length (5d) of seedlings under different NaCl concentrations. Root length was measured using ImageJ; (E): Effects of mannitol and lithium chloride treatments on Arabidopsis thaliana WT and LbZFP8 Effects of overexpression lines on seedling germination (FH): Statistical analysis of germination rate (1d), cotyledon emergence rate (3d), and root length (5d) of seedlings treated with mannitol and lithium chloride. Values ​​are expressed as mean ± SD. Each group had three biological replicates. Duncan's multiple range test was used, and different letters (ah) were used to indicate differences between groups (p < 0.05).

[0051] Figure 4 For WT and LbZFP8 Determination of NaCl treatment phenotypes and physiological parameters of OE lines during seedling stage, (A): WT and LbZFP8 Phenotypes of overexpression lines after normal culture and 2 weeks of treatment with 100 mM NaCl; (B): WT and LbZFP8 Figure 5 LbZFP8 LbZFP8 LbZFP8 说明:原文中“LbZFP晓 遗漏了一个8 ”和“LbZFP晓 遗漏了一个8 ”以及“LbZFP晓 遗漏了一个8 ”这种表述不太清晰准确,我按照原样翻译了,但不确定其确切含义。如果这部分内容有更准确清晰的表述,请告知我以便我能更准确地翻译。 Plant height statistics of overexpression lines; (CG): measurements of physiological indicators of each line. Values ​​are expressed as mean ± SD. Each group had 3 biological replicates. Duncan's multiple range test was used. Different letters (ad) indicate differences between groups (p<0.05).

[0052] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0053] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Two-colored blood-nourishing herb gene LbZFP8 Its characteristics are, It is a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO:

1.

2. Containing the gene of claim 1 LbZFP8 The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacteria.

3. The gene according to claim 1 LbZFP8 Or the application of the biomaterial described in claim 2 in the preparation of transgenic plants.

4. The gene according to claim 1 LbZFP8 Or any of the following applications of the biomaterial described in claim 2: (1) Used to improve the salt tolerance of plants; (2) Used for plant variety improvement; (3) Used for the improvement of saline-alkali land.

5. The application according to claim 4, characterized in that, The plant in question is either *Limonium bicolor* or *Arabidopsis thaliana*.

6. A method for improving the salt tolerance of plants, characterized in that, The method is selected from either ① or ②: ① To make a plant express the gene of claim 1 LbZFP8 The encoded protein; ② Overexpression of the gene of claim 1 in plants LbZFP8 The overexpression mode is selected from the following 1) to 5), or any combination thereof: 1) By importing a plasmid containing the gene; 2) By increasing the copy number of the aforementioned genes on plant chromosomes; 3) By altering the promoter sequence of the aforementioned genes on plant chromosomes; 4) By operatively linking a strong promoter to the gene; 5) By importing enhancers.

7. The method according to claim 6, characterized in that, The plant in question is either *Limonium bicolor* or *Arabidopsis thaliana*.

8. A method for improving the salt tolerance of Arabidopsis thaliana, characterized in that, The gene described in claim 1 LbZFP8 Salt tolerance of Arabidopsis can be improved by introducing plasmids into Arabidopsis or by integrating them into the Arabidopsis chromosome through genetic engineering.

9. Any of the following applications of the transgenic plant obtained by the method according to claim 8: i. Used in plant breeding; ii. Used for planting in saline-alkali land, among which, The plant in question is either *Limonium bicolor* or *Arabidopsis thaliana*.

10. The application according to claim 9, characterized in that, Breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

Citation Information

Cited By

  • Limonium bicolorum gene lbmyb75 and application thereof

    CN122278869A