Transcription factor CsNF-YA and application thereof in positive regulation of CsCBCAS gene expression of China-hemp

By providing the transcription factor CsNF-YA to specifically bind to the promoter of the hemp CsCBCAS gene, the lack of transcriptional regulation in the promoter region of the CBCAS gene was solved, achieving positive regulation of the CsCBCAS gene and promoting the synthesis of hemp CBCs, which has the potential for application in genetic improvement.

CN121800898APending Publication Date: 2026-04-07QIQIHAR UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610059779.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-16
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Current technologies lack transcription factors that regulate transcription in the promoter region of the CBCAS gene, resulting in an unclear regulatory mechanism for hemp CBC synthesis.

Method used

The transcription factor CsNF-YA is provided. By specifically binding to the promoter of the hemp CsCBCAS gene, CsNF-YA is overexpressed to promote the expression of the CsCBCAS gene. Recombinant vectors and recombinant bacteria are constructed for transfection of hemp plants to achieve positive regulation of the CsCBCAS gene.

Benefits of technology

It significantly promotes the expression of the CsCBCAS gene in hemp and enhances CBC synthesis, showing potential for application in the genetic improvement of hemp.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121800898A_ABST
    Figure CN121800898A_ABST
Patent Text Reader

Abstract

The invention provides a transcription factor CsNF-YA and application thereof in positive regulation of CsCBCAS gene expression of China-hemp, and belongs to the technical field of gene engineering. The invention provides a transcription factor CsNF-YA, and the nucleotide sequence of the transcription factor CsNF-YA is as shown in SEQ ID No.2. The transcription factor CsNF-YA is screened from a China-hemp yeast cDNA library, the transcription factor CsNF-YA can be specifically combined with a China-hemp CsCBCAS gene promoter, expression of the CsCBCAS gene can be remarkably promoted by overexpression of the transcription factor CsNF-YA, and the transcription factor CsNF-YA can be applied to synthesis genetic improvement of China-hemp CBC.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a transcription factor CsNF-YA and application thereof in positive regulation of expression of a hemp CsCBCAS gene. BACKGROUND

[0002] Hemp is a monoecious annual dicotyledonous herb of the family Cannabaceae. More than 500 chemical components have been isolated and identified from hemp, such as cannabinoids, phenolic terpenoids, flavonoids, steroids, fatty acids, alkaloids, etc. Cannabichromene (CBC) is one of the main cannabinoids and has various medicinal effects, and can be used for developing drugs for treating diseases such as pain, inflammation and depression.

[0003] CBCAS gene is a key enzyme for catalyzing synthesis of cannabinoid CBC, but the transcriptional regulation mechanism thereof is still unclear. In the regulation network at the transcriptional level, a promoter is a core and key regulatory element, which provides specific binding sites for various transcriptional regulatory factors by forming a specific spatial conformation. After specific binding of a transcriptional factor and a cis-acting element in the promoter region, a transcription initiation complex is assembled by recruiting RNA polymerase and transcriptional auxiliary factors, and then the transcriptional process of a downstream target gene is activated or inhibited to realize specific regulation of gene expression. It can be seen that gene expression is largely regulated by specific transcriptional factors. However, there is currently a lack of transcriptional factors having transcriptional regulation effect on the promoter region of CBCAS. SUMMARY

[0004] The application aims to provide a transcription factor CsNF-YA and application thereof in positive regulation of expression of a hemp CsCBCAS gene, and the transcription factor CsNF-YA provides a basis for research on a molecular regulation mechanism of CBC genetic improvement.

[0005] The application provides a transcription factor CsNF-YA, and the nucleotide sequence is shown in SEQ ID No. 2.

[0006] The application further provides a recombinant vector, which is inserted with the transcription factor CsNF-YA described in the above scheme.

[0007] Preferably, the backbone plasmid of the recombinant vector comprises pCAMBIA1300-RUBY.

[0008] The application further provides a recombinant bacterium comprising the transcription factor CsNF-YA described in the above scheme or comprising the recombinant vector.

[0009] The application further provides application of the transcription factor CsNF-YA described in the above scheme in positive regulation of expression of a hemp CsCBCAS gene.

[0010] The application also provides the use of the recombinant vector or the recombinant bacteria in promoting the expression of the CsCBCAS gene of the hemp.

[0011] Preferably, the expression of the CsCBCAS gene of the hemp includes the expression of the CsCBCAS gene in the hemp hairy roots.

[0012] The application also provides the use of the transcription factor CsNF-YA, the recombinant vector or the recombinant bacteria in the genetic improvement of the CBC synthesis of the hemp.

[0013] The application also provides a method for the genetic improvement of the CBC synthesis, including the following steps: transfecting the hemp plant with the recombinant bacteria.

[0014] The application also provides a transgenic hemp overexpressing the transcription factor CsNF-YA; the nucleotide sequence of the transcription factor CsNF-YA is shown in SEQ ID No. 2.

[0015] The application provides a transcription factor CsNF-YA, and the nucleotide sequence is shown in SEQ ID No. 2. The application screens the transcription factor CsNF-YA from a hemp yeast cDNA library, the transcription factor CsNF-YA can specifically bind to the CsCBCAS gene promoter of the hemp, overexpression of the transcription factor CsNF-YA can significantly promote the expression of the CsCBCAS gene, and can be used in the genetic improvement of the CBC synthesis of the hemp. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description only some embodiments of the application, and for those skilled in the art, other drawings can also be obtained without creative labor.

[0017] Figure 1 It is a double enzyme digestion identification diagram of the recombinant plasmid pMD18-T-CsCBCASp, wherein M is DL2000Marker, 1 is a PCR amplification band of CsCBCASp promoter, and 2 is a double enzyme digestion identification of the recombinant plasmid pMD18-T-CsCBCASp; Figure 2 It is a double enzyme digestion identification diagram of the recombinant plasmid pMD18-T-CsCBCASp, wherein M is DL2000Marker, 1 is a PCR amplification band of CsCBCASp promoter, and 2 is a double enzyme digestion identification of the recombinant plasmid pMD18-T-CsCBCASp; Figure 3Figure for PCR identification result of the decoy strain; wherein, M is DL2000 Marker, 1~4: pAbAi-CsCBCASp yeast colony PCR; Figure 4 Figure for self-activation detection result of the decoy vector; wherein, p53-AbAi is Y1HGold[p53-AbAi] positive control strain, pAbAi-CsCBCASp is Y1HGold[pAbAi-CsCBCASp] decoy strain; Figure 5 Figure for identification result of the secondary library insert size and recombination rate; wherein, M is DL2000 Marker, 1~24: 24 single colonies of colony PCR identification; Figure 6 Figure for PCR amplification of CsNF-YA gene CDS sequence and double enzyme digestion of recombinant plasmid pGADT7-CsNF-YA; wherein, M is DL15000 Marker, 1 is the PCR amplification band of CsNF-YA gene CDS sequence, and 2 is the double enzyme digestion identification of recombinant plasmid pGADT7-CsNF-YA; Figure 7 Figure for yeast one-hybrid back verification result; Figure 8 Figure for PCR amplification of CsNF-YA gene CDS sequence and double enzyme digestion of recombinant plasmid pET32a-CsNF-YA; wherein, M is DL15000 Marker, 1 is the PCR amplification band of CsNF-YA gene CDS sequence, and 2 is the double enzyme digestion identification of recombinant plasmid pET32a-CsNF-YA; Figure 9 Figure for induction and purification result of CsNF-YA recombinant protein; wherein, M: low molecular weight protein Marker, 1: CsNF-YA uninduced bacteria; 2: CsNF-YA bacteria after induction; 3: CsNF-YA bacteria induction broken supernatant; 4: CsNF-YA bacteria induction broken precipitate; 5: effluent; 6~7: eluent; Figure 10The image shows the binding results of CsNF-YA protein and probe; where 1: Probe 1, 2: CsNF-YA protein + Probe 1, 3: CsNF-YA protein + Probe 1 + 20× cold probe 1, 4: CsNF-YA protein + Probe 1 + 50× cold probe 1, 5: Probe 2, 6: CsNF-YA protein + Probe 2, 7: CsNF-YA protein + Probe 2 + 20× cold probe 2, 8: CsNF-YA protein + Probe 2 + 50× cold probe 2, 9: Positive protein + positive probe, 10: Probe 3, 11: CsNF-YA protein + Probe 3; Figure 11 The image shows the PCR amplification of the CDS sequence of the CsNF-YA gene and the double enzyme digestion results of the recombinant plasmid pCAMBIA1300-CsNF-YA-RUBY; where M is the DL15000 Marker, 1 is the PCR amplification band of the CDS sequence of the CsNF-YA gene, and 2 is the double enzyme digestion identification of the recombinant plasmid pCAMBIA1300-CsNF-YA-RUBY. Figure 12 The figure shows the results of qRT-PCR detection of gene expression in hemp hairy roots; where A: relative expression level of CsNF-YA gene, and B: relative expression level of CsCBCAS gene. Detailed Implementation

[0018] This invention provides a transcription factor CsNF-YA, the nucleotide sequence of which is shown in SEQ ID No. 2, specifically: .

[0019] This invention screened the transcription factor CsNF-YA from a hemp yeast cDNA library.

[0020] The present invention also provides a recombinant vector into which the transcription factor CsNF-YA described in the above scheme is inserted.

[0021] In one embodiment, the backbone plasmid of the recombinant vector includes pCAMBIA1300-RUBY; the insertion site of the transcription factor CsNF-YA on the backbone plasmid is... Kpn I and Hind Between III.

[0022] The present invention also provides a recombinant bacterium containing the transcription factor CsNF-YA described in the above scheme or containing the recombinant vector described in the above scheme.

[0023] In one embodiment, the starting strain of the recombinant bacteria includes Agrobacterium rhizogenes, and more specifically Agrobacterium rhizogenes K599.

[0024] This invention also provides the application of the transcription factor CsNF-YA described in the above scheme in the positive regulation of hemp CsCBCAS gene expression.

[0025] In this invention, the transcription factor CsNF-YA can specifically bind to the promoter of the hemp CsCBCAS gene, and overexpression of the transcription factor CsNF-YA can significantly promote the expression of the CsCBCAS gene.

[0026] The present invention also provides the application of the above-described recombinant vector or the recombinant bacteria in promoting the expression of the hemp CsCBCAS gene.

[0027] In one embodiment, the expression of the hemp CsCBCAS gene includes the expression of the CsCBCAS gene in the hairy roots of hemp.

[0028] This invention also provides the application of the transcription factor CsNF-YA, the recombinant vector, or the recombinant bacteria described above in the genetic improvement of hemp CBC synthesis.

[0029] CBC is one of the main cannabinoids with various medicinal properties, and CBCAS is a key enzyme in CBC biosynthesis. Overexpression of the transcription factor CsNF-YA can significantly promote the expression of the CsCBCAS gene, which can be used for genetic improvement of hemp CBC synthesis.

[0030] The present invention also provides a method for CBC synthesis genetic improvement, comprising the following steps: transfecting hemp plants with the recombinant bacteria described in the above scheme.

[0031] In one implementation, the hemp plant is a hemp seedling with the roots removed.

[0032] The present invention also provides a transgenic hemp that overexpresses transcription factor CsNF-YA; the nucleotide sequence of the transcription factor CsNF-YA is shown in SEQ ID No. 2.

[0033] This invention does not have any special requirements for the variety of hemp plants used to construct the transgenic hemp.

[0034] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes the transcription factor CsNF-YA provided by the present invention and its application in positively regulating the expression of the hemp CsCBCAS gene, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0035] The embodiments of this invention clarified the specific binding of CsNF-YA to the CsCBCAS gene promoter through electrophoretic mobility shift assays, and determined the binding site of transcription factor CsNF-YA on the CsCBCAS promoter. In hemp hairy roots, it was demonstrated that CsNF-YA can significantly promote CsCBCAS gene expression, clarifying the positive transcriptional regulatory role of transcription factor CsNF-YA on the CsCBCAS gene. This provides a deeper understanding of the expression regulation of the CsCBCAS gene and can be applied to the genetic improvement of hemp CBC synthesis, showing promising application prospects.

[0036] Example 1 1. Cloning and cis-element analysis of the CsCBCAS gene promoter sequence Total DNA was extracted from fresh hemp 'Changjingyuan No. 1', following the instructions of the Tiangen Plant Genome Extraction Kit. The 500 bp upstream of the 5' end of the hemp CsCBCAS gene (XM_030625046.2) ATG was searched in NCBI. Upstream and downstream primers were designed using Primer Premiere 5.0 software. The upstream primer was introduced... Xho I restriction sites are SF(5'-GGG) CTCGAG TTTGCATGACTATATTTCTACCTTACC-3' (SEQ ID No. 3) and SR (5'-TTTTCTTCAGTCCTAATGATATTTTGA-3', SEQ ID No. 4). PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 56℃ annealing for 40 s, 72℃ extension for 1 min, for a total of 30 cycles; followed by a final extension at 72℃ for 10 min. PCR amplification yielded a sequence approximately 500 bp in length, named CsCBCASp ( Figure 1 The PCR-amplified fragment was ligated into the pMD18-T cloning vector to obtain the recombinant plasmid pMD18-T-CsCBCASp, which was then identified by double enzyme digestion. Figure 1 The sequencing results from Genewiz indicate that the sequence is 100% homologous to the 500 bp upstream of the 5' end of the CsCBCAS gene ATG in NCBI. The sequencing results are shown in SEQ ID No. 1. tttgcatgactatatttctaccttaccaagttttttatctgataacaccctttcacttattattttcttatttttaatttatttatttttaccatattctatttatactaatcttaagtggta cattacctccctgtggatacgacatataatctgtttactatcgtgaccgaagtataactaattgggcgacatcacacctatatcccacaaactagctactatagtcaatttcttgttttttttttc caatagccaattttaaatgatgccaaactattcaatgtataatgtacatttattttaaataagggcttcacctaacaaatgtgcctaattttagttaatttatttttttatcgcatctgactatt taaaggaactatcaaattataaaatatttatgtctattcatttgccccaactccaatatataatattataaataggatagttctctattcataataattcaaaatatcattaggactgaagaaaa.

[0037] Bioinformatics predictive analysis showed that the CsCBCASp sequence contains hormone-response elements: CARE (response to gibberellin GA element, CAACTC, 1 element) and ERE (response to ethylene element, ATTTTAAA, 1 element); transcription factor binding sites: WRKY binding site W-box (TGAC, 1 element), MYC binding site (CANNTG, 1 element), DOF binding site (AAAG, 1 element), and NF-YA binding site (CCAAT, 3 sites).

[0038] 2. Construction, transformation, and self-activation detection of decoy carriers use Xho I and Hind III. Restriction endonucleases were used to ligate the small fragment obtained by double digestion of the pMD18-T-CsCBCASp vector with the double-digested pAbAi vector using T4 ligase overnight at 16°C. The recombinant vector was named pAbAi-CsCBCASp and transformed into E. coli. DH5α competent cells, plasmid extraction, double enzyme digestion identification ( Figure 2 The sequence was verified to be correct by Genewiz.

[0039] The correctly sequenced bait vector (pAbAi-CsCBCASp) and the p53-AbAi positive control vector were respectively used... Bst BI single enzyme digestion, so that it can be in URA3 Linearization of genes, referencing Coolaber Biosciences Y1HGold Transform yeast cells into competent cells according to the instructions. Using a sterile pipette tip, pick up a 1-2 mm size, robust single colony and add it to 25 μL of sterile water. Mix well by pipetting, then add 25 μL of Matchmarker Insert Check PCR Mix 1 and mix thoroughly. Place the mixture in a PCR instrument. After the reaction, detect the insert band size by electrophoresis. The band size should be 1350 bp + CsCBCASp fragment length. Figure 3 As shown, PCR amplification of the bait strain yielded a band of approximately 1850. The verified bait yeast single colony was prepared into glycerol bacteria and stored at -80℃.

[0040] Select correctly identified Y1HGold single colonies and spread them on SD / -Ura plates containing different concentrations of AbA (0, 100, 200, 300, 400, 500 ng / mL). The results are as follows. Figure 4 As shown, when the concentration of antibiotic AbA was 100 ng / mL, a small amount of yeast grew on the plate, but when the concentration was 200 ng / mL, yeast could not grow. In order to ensure the positive rate of library screening, the final concentration of AbA was 200 ng / mL for subsequent yeast cDNA library screening and rotation verification experiments.

[0041] 3. Construction of yeast cDNA library Yeast cDNA libraries were constructed using gateway technology from female hemp plants' flowers, bracts, leaves, and young leaves. Based on the isolation and purification of mRNA, three types of double-stranded cDNA with different reading frames were synthesized, and corresponding primary libraries were constructed using the BP reaction. The total library size was 1.92 × 10⁻⁶. 7 CFU was then used to construct a high-quality secondary library via LR reaction, with a total library size of 1.60 × 10⁻⁶. 7CFU. Primers (P1: 5'-GTAAAACGACGGCCAG-3', SEQ ID No. 5 and P2: 5'-CAGGAAACAGCTATGAC-3', SEQ ID No. 6) and universal primers on the pGADT7 vector (T7: 5'-TAATACGACTCACTATAGGGC-3', SEQ ID No. 7 and 3'AD: 5'-AGATGGTGCACGATGCACAG-3', SEQ ID No. 8) were designed based on the sequence of the entry vector pDONR222. Twenty-four clones were randomly selected, and colony PCR identification showed that the length of the inserted fragment in both the primary and secondary libraries was greater than 750 bp. Figure 5 All of the clones were positive clones with bands, and the recombination rate was 100%, indicating that the primary and secondary libraries were of high quality and could be used for subsequent experiments.

[0042] 4. Yeast single-hybrid screening In the yeast library single-hybrid screening, the secondary library plasmid was transformed into the prepared bait yeast competent cells pAbAi-CsCBCASp using the PEG / LiAc method. The bacterial culture was resuspended in 6 mL of 0.9% NaCl, and 10 μL of the solution was serially diluted at concentrations of 1 / 10, 1 / 100, and 1 / 1000 and plated onto SD / -Leu solid medium. Based on the number of colonies grown, the transformation efficiency was calculated to be 2.5 × 10⁻⁶. 6 CFU / μg can be used for further screening. The remaining bacterial culture was plated on SD / -Leu / AbA. 200 Secondary screening was performed on plates using the same culture medium. Single clones were picked and inoculated into 3 mL of SD / -Leu liquid medium. Yeast plasmids were extracted using the Omega yeast extraction kit. Using the yeast plasmids as templates, positive clones were identified using T7 and 3′AD primers. PCR products >500 bp were sent to a biotechnology company for sequencing. Sequence alignment and functional annotation were performed using BLAST in NCBI. A total of 47 binding proteins were screened, including 8 uncharacterized sequences, 1 transcription factor (NF-YA, a member of the NF-Y family, nucleotide sequence as shown in SEQ ID No. 2), which appeared 6 times, and the rest were structural proteins and enzymes.

[0043] 5. Cloning and rotation verification of the CDS sequence of the hemp CsNF-YA gene Based on the CDS sequence of candidate transcription factor CsNF-YA and the multiple cloning site of the pGADT7 vector, a design was created to introduce... Nde I and EcoR Specific primers for the I restriction site (H1: 5'-GGG) CATATGATGACGTCTCTGTGCATGAAC-3', SEQ IDNo.9 and H2: 5'-GGG GAATTC TCAAGTTGTGCCATCTGCAGG-3', SEQ ID No. 10), T4 ligase will amplify the fragment ( Figure 6 ) and double enzyme digestion ( Nde I and EcoR Following step I), the pGADT7 vector was ligated, and the recombinant vector was named pGADT7-CsNF-YA. Double enzyme digestion was used for identification. Figure 6 After sequencing, the sequencing results showed 100% homology with the sequences in NCBI.

[0044] The verified positive clone plasmid pGADT7-CsNF-YA was transformed into the pAbAi-CsCBCASp bait vector. Y1HGold In competent cells, yeast strains co-transformed with two plasmids were obtained by screening on SD / -Leu medium. After positive clones grew, single colonies were picked and cultured overnight at 30°C with shaking in SD / -Leu liquid medium. After serial dilution, 3 μL of the bacterial solution was spotted onto SD / -Leu auxotrophic medium containing 200 ng / mL AbA. The results are as follows: Figure 7 As shown, the positive control P53-AbAi+pGADT7-53 and the co-transformed yeast strain pAbAi-CsCBCASp+pGADT7-CsNF-YA were able to grow on SD / -Leu medium supplemented with 200 ng / mL AbA, while the negative control pAbAi-CsCBCASp+pGADT7 could not grow. This indicates that the binding of the CsNF-YA protein to the CsCBCASp promoter sequence activates the expression of the AbAr reporter gene in the pAbAi vector, and there is an interaction between the transcription factors CsNF-YA and CsCBCASp. Furthermore, as the yeast culture concentration gradually decreased, the colony distribution became sparser.

[0045] Example 2 Electrophoretic Mobility Assay (EMSA) Based on the CDS sequence of the CsNF-YA gene obtained in Example 1 and the multiple cloning site of the vector pET32a, a design was created to introduce... EcoR I and Hind Specific primers for the K1: 5'-GGG restriction site (K1: 5'-GGG) GAATTC ATGACGTCTCTGTGCATGAAC-3', SEQ ID No. 11 and K2: 5'-GGG AAGCTT TCAAGTTGTGCCATCTGCAGG-3', SEQ ID No. 12), T4 ligase will amplify the fragment ( Figure 8 ) and double enzyme digestion (EcoR I and Hind III) Following the ligation of the pET32a vector, the recombinant vector was named pET32a-CsNF-YA and transformed into E. coli. Transetta ( DE3 competent cells, plasmid extraction, double enzyme digestion identification Figure 8 After sequencing, the sequencing results showed 100% homology with the sequences in NCBI.

[0046] IPTG at a final concentration of 0.2 mM was added at 16℃ to fully induce... Transetta recombinant pET32a- CsNF-YA Protein expression. The target protein was purified by Ni column affinity chromatography and analyzed by SDS-PAGE and Coomassie Brilliant Blue staining. SDS-PAGE analysis results showed ( Figure 9 The CsNF-YA recombinant protein showed a significantly thickened band at around 40 kDa (Lane 2), consistent with the expected size. Uninduced cells did not show a significantly thickened band at 40 kDa (Lane 1), indicating that the CsNF-YA recombinant protein, after IPTG induction, can... Transetta ( DE3 The protein was stably and effectively expressed in the strain. The protein was expressed in both the supernatant and the precipitate (Lane 3, 4). The supernatant was selected for purification. After purification by Ni column, high-purity CsNF-YA recombinant protein was obtained in the eluent (Lane 6, 7).

[0047] Based on the binding characteristics of the NF-Y transcription factor family, three possible binding sites, CCAAT elements, were found in the CsCBCASp sequence. Based on the upstream and downstream sequences of the three binding elements, biotin was used to label their 5′ ends to form binding probes (Probe 1: 5′-TGTTTTTTTTTCCAATAGCCAATTTTAAATGATG-3′, SEQ ID No. 13; Probe 2: 5′-TCATTTGCCCCAACTCCAATATATAATA TTATAAA-3′, SEQ ID No. 14). The unlabeled element was used as a cold competitive probe, and the reverse complementary sequence of CCAAT was used to synthesize a probe (Probe 3: 5′-ACCGAAGTATAACTAATTGGGCGACATCACACCTA-3′, SEQ ID No. 15).

[0048] Separation was achieved by 6% non-denaturing polyacrylamide gel electrophoresis, followed by transfer to a nylon membrane for detection using a chemiluminescence imaging system. Results are as follows: Figure 10As shown: positive proteins and positive probes can specifically bind, forming a hysteresis band (Lane 9); no hysteresis band forms in lanes where the free probe is present alone (Lane 1, 5, 10); when CsNF-YA protein is mixed with Probe 1 and Probe 2 probes respectively, the recombinant protein specifically binds to the CCAAT probe, forming a DNA-protein complex, resulting in a distinct hysteresis band at the top of the lane (Lane 2, 6), and the hysteresis band weakens with increasing cold competitive probe concentration, indicating that the binding of labeled probes and proteins can be inhibited by unlabeled cold competitive probes (Lane 3, 4, Lane 7, 8). Conversely, when CsNF-YA protein is mixed with Probe 3 probe, no DNA-protein complex is formed, and no hysteresis band forms in the lane (Lane 11). These results indicate that CsNF-YA protein can specifically bind to CCAAT elements in vitro, but cannot bind to its reverse complementary sequence.

[0049] Example 3: Transcription factor CsNF-YA promotes CsCBCAS gene expression in hemp hairy roots. The CDS sequence of the CsNF-YA gene was constructed into the pCAMBIA1300-RUBY vector, and upstream primers were introduced. Kpn I restriction site, namely K3: 5'-GGG GGTACC ATGACGTCTTCTGTGCATGAAC-3, SEQ ID No. 16, with K2 as the downstream primer, and T4 ligase will amplify the fragment ( Figure 11 ) and double enzyme digestion ( Kpn I and Hind Following step III), the pCAMBIA1300-RUBY vector (purchased from Fenghui Biotechnology Co., Ltd.) was ligated, and the recombinant vector was named pCAMBIA1300-CsNF-YA-RUBY. Double enzyme digestion was used for identification. Figure 11 After sequencing, the sequencing results showed 100% homology with the sequences in NCBI.

[0050] Positive plasmids were selected and transformed into Agrobacterium rhizogenes K599. Healthy hemp seedlings approximately one month old were selected, roots were removed, and the seedlings were inserted into the bacterial culture. The seedlings were sonicated at 30 Hz for 1 min, and then infected in the dark for 1 day. After infection, the seedlings were cultured under a 16 h / 8 h light / dark cycle. After approximately 60 days of culture, roots that had turned red after infection were selected. qRT-PCR primers were designed based on the gene sequences of CsNF-YA and CsCBCAS, as follows: E1: 5'-AGATGCCGTTGAGGAACCTG-3', SEQ ID No. 17; E2: 5'-G AACCTGCCTCCACATCCTC-3', SEQ ID No. 18; F1: 5'-GCTCACGACTCACTTCAGAACTAG-3', SEQ ID No. 19; F2: 5'-GTAGAAGATGGTTGTATCAATCCAGCTC-3', SEQ ID No. 20; The internal reference gene is CsEF1a; The upstream primer was W1: 5'-TGTTTTGCACGGATCAGTTTG-3', SEQ ID No. 21; The downstream primer is W2: 5'-AATGCCGACCGCTACAGTTC-3', SEQ ID No. 22; qRT-PCR was used to detect the expression of CsNF-YA and CsCBCAS genes in CK (roots transfected with pCAMBIA1300-RUBY vector) and CsNF-YA-RUBY (roots transfected with pCAMBIA1300-CsNF-YA-RUBY vector), respectively. The results showed that in hemp roots transfected with CsNF-YA-RUBY, the CsNF-YA gene was overexpressed, with a significantly increased expression level, 3.56 times that of the control CK. Figure 12 The relative expression level of the CsCBCAS gene in hairy roots overexpressing CsNF-YA was 6.21 times that of the control CK. Figure 12 The B in the figure indicates that CsNF-YA can significantly positively regulate the expression of the CsCBCAS gene, which can be applied to the genetic improvement of hemp CBC synthesis.

[0051] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A transcription factor CsNF-YA, characterized in that, The nucleotide sequence is shown in SEQ ID No.

2.

2. A recombinant vector, characterized in that, The transcription factor CsNF-YA as described in claim 1 is inserted.

3. The recombinant vector according to claim 2, characterized in that, The backbone plasmid of the recombinant vector includes pCAMBIA1300-RUBY.

4. A recombinant bacterium, characterized in that, It contains the transcription factor CsNF-YA as described in claim 1 or the recombinant vector as described in claim 2 or 3.

5. The application of the transcription factor CsNF-YA as described in claim 1 in the positive regulation of hemp CsCBCAS gene expression.

6. The application of the recombinant vector of claim 2 or 3 or the recombinant bacteria of claim 4 in promoting the expression of the hemp CsCBCAS gene.

7. The application according to claim 5 or 6, characterized in that, The expression of the CsCBCAS gene in hemp includes the expression of the CsCBCAS gene in the hairy roots of hemp.

8. The application of the transcription factor CsNF-YA of claim 1, the recombinant vector of claim 2, or the recombinant bacteria of claim 3 in the genetic improvement of hemp CBC synthesis.

9. A method for genetically modifying CBC synthesis, characterized in that, The procedure includes the following steps: transfecting hemp plants with the recombinant bacteria described in claim 3.

10. A genetically modified hemp, characterized in that, Overexpression of transcription factor CsNF-YA; the nucleotide sequence of the transcription factor CsNF-YA is shown in SEQ ID No. 2.