CFTSR gene, CFTSR gene simulant and application of CFTSR gene simulant

By overexpressing the CFTSR gene and using its mimics CFTSR mimics, fibroblast activation was inhibited, thus addressing the problem of myocardial infarction fibrosis and achieving effective treatment and functional improvement for myocardial infarction injury.

CN121801908APending Publication Date: 2026-04-07MATERNAL & CHILD HEALTH CARE HOSPITAL OF SHANDONG PROVINCE SHANDONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511956906.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Fibrosis caused by myocardial infarction severely affects cardiac function. Current technologies lack effective diagnostic and treatment methods, especially insufficient regulation of fibroblast activation, which leads to rapid and difficult-to-control progression of myocardial infarction damage.

Method used

Effective treatment of myocardial infarction injury can be achieved by overexpressing the CFTSR gene and using its mimics, CFTSR mimics, to inhibit the activation and proliferation of fibroblasts.

Benefits of technology

It significantly inhibits myocardial infarction damage, improves cardiac function, alleviates the prognosis of myocardial infarction patients, and provides an effective treatment for the location of cardiac lesions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121801908A_ABST
    Figure CN121801908A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to a CFTSR gene, a CFTSR gene simulant and application of the CFTSR gene simulant. The nucleic acid sequence of the CFTSR gene is as shown in SEO ID NO. 1. The nucleic acid sequence of the CFTSR gene simulant is as shown in SEO ID NO. 2. The CFTSR gene provided by the invention can be used as a marker for fibroblast activation, and is used for a kit for detecting cardiac fibroblast activation. The CFTSR gene simulant can be used as a therapeutic drug for myocardial infarction injury, and the overexpression of the CFTSR gene can significantly inhibit the proliferation of fibroblasts and activate the repair of damaged myocardial tissues. Based on CFTSR mimics, a simulant of the CFTSR gene is constructed, and the simulant can be conveyed to the position of a heart lesion and can be used as a medicine for treating myocardial infarction injury, so that effective treatment of the lesion is realized.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a CFTSR gene, a CFTSR gene mimic and application thereof. BACKGROUND

[0002] Cardiovascular disease is the leading cause of death worldwide, with increasing prevalence and mortality, imposing a heavy burden on the medical system and the socio-economy of each country. Myocardial infarction is the leading cause of death from cardiovascular disease in China, with a continuously rising incidence and a trend of younger onset. It is acute and progresses rapidly, with a short treatment window. Even if reperfusion is timely, there is still reperfusion injury and difficulty in restoring heart function, posing a severe challenge to clinical prevention and treatment. Therefore, it is crucial to explore the diagnosis and treatment of myocardial infarction.

[0003] tsRNA is a class of small non-coding RNA derived from tRNA, with high conservation and tissue-specific expression. With the widespread application of high-throughput sequencing technology, more and more studies have shown that tsRNA plays an important regulatory role in cancer, metabolic diseases, neurodegenerative diseases and other diseases. Due to its high stability and ease of detection, tsRNA shows potential as a clinical diagnostic and prognostic biomarker. Recent studies have further revealed the role of tsRNA in heart development and the occurrence of congenital heart disease, and found that it has dynamic expression changes in hypertrophic cardiomyopathy, dilated cardiomyopathy, coronary heart disease, myocardial ischemia-reperfusion injury, cardiac fibrosis and heart failure, suggesting that it may be involved in the regulation of related pathological processes.

[0004] Fibrosis is a common pathological change in the process of tissue damage repair, characterized by excessive deposition of extracellular matrix and accumulation of collagen fibers, leading to destruction of tissue structure and impairment of function. In myocardial infarction models, cardiac ischemia can activate fibroblasts, promote the synthesis and deposition of matrix components such as collagen, and further exacerbate myocardial stiffness and diastolic dysfunction, affecting the overall remodeling process of the heart. Studies have shown that inhibitors targeting the fibrosis formation process (such as certain anti-fibrosis drugs) can effectively reduce the degree of fibrosis in myocardial infarction models, improve cardiac function and delay the progression of heart failure. CFTSR, as a member of the tsRNA family, is metabolically stable and usually functions by forming a complex with specific proteins. It can participate in the post-transcriptional regulation of target RNA through base complementary pairing and other methods.

[0005] Gene mimic is a double-stranded small RNA that mimics the endogenous tsRNA in the organism, usually prepared by chemical synthesis method, mainly used to enhance the function of endogenous tsRNA, suitable for drug research and development and related functional research. It can up-regulate the expression of mature tsRNA by transfecting cells, and is expected to become a basic method for treating various infectious, hematological tumors, cardiovascular and neurodegenerative diseases. SUMMARY

[0006] The application is based on controlling the activation of fibroblasts, overexpressing CFTSR gene by gene mimic, which can effectively treat myocardial infarction. By injecting CFTSR gene mimic into the body through intravenous injection, it is delivered to the heart lesion position, which is a promising clinical intervention measure.

[0007] The application aims to provide a CFTSR gene and a CFTSR gene mimic and application thereof.

[0008] The technical scheme adopted by the application is: A CFTSR gene, the nucleic acid sequence of which is shown in SEO ID NO. 1: GGCCGGTTAGCTCAGTTGGTTAGAGCGTGGTGCTAAT.

[0009] Further, the application of the CFTSR gene as a marker for fibroblast activation and in a kit for detecting cardiac fibroblast activation.

[0010] A CFTSR gene mimic, the nucleic acid sequence of which is shown in SEO ID NO. 2: S: GGCCGGUUAGCUCAGUUGGUUAGAGCGUGGUGCUAAU AS: UAGCACCACGCUCUAACCAACUGAGCUAACCGGCCUU The application also provides a kit for detecting myocardial fibrosis, the kit comprising a primer pair for amplifying the RNA transcribed from the CFTSR gene, the nucleic acid sequences of which are shown in SEO ID NO. 3 and SEO ID NO. 4: F: CGGAGCCAGGGAGAGCG R: AGTGCAGGGTCCGAGGTATT The application also provides the use of the above-mentioned CFTSR gene mimic in the preparation of a drug for diagnosing and / or treating heart disease.

[0011] The application has the following beneficial effects: The present application first discovers that the mRNA expression level of CFTSR gene is significantly reduced and highly related to cell fibrosis when myocardial infarction injury occurs; overexpression of CFTSR gene can significantly inhibit myocardial infarction injury, and therefore, CFTSR gene plays an important role in the regulation of fibroblast activation. The CFTSR gene provided by the present application can be used as a marker for fibroblast activation, and can be used in a kit for detecting cardiac fibroblast activation. The CFTSR gene mimics can be used as a therapeutic drug for myocardial infarction injury, and overexpression of the CFTSR gene can significantly inhibit the proliferation of fibroblasts and activate the repair of damaged myocardial tissue. Overexpression of the CFTSR gene effectively alleviates the poor prognosis of myocardial infarction injury patients and the difficulty in treating heart disease. Based on the CFTSR mimics, a CFTSR gene mimic is constructed and delivered to the heart lesion site, which can be used as a drug for treating myocardial infarction injury and achieving effective treatment of the lesion. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 The mRNA expression level of CFTSR in a model of primary fibroblasts of suckling mice treated with TGF-β and in a myocardial infarction injury model of adult mice was determined. Figure 2 The mRNA expression level of CFTSR after overexpression of CFTSR in primary fibroblasts was determined. Figure 3 The expression level of fibrosis RNA indicators in primary fibroblasts after TGF-β treatment and overexpression of CFTSR was determined. Figure 4 The expression level of fibrosis protein indicators in primary fibroblasts after TGF-β treatment and overexpression of CFTSR was determined. Figure 5 The change in cell migration rate of primary fibroblasts after TGF-β treatment and overexpression of CFTSR was determined. DETAILED DESCRIPTION

[0013] The embodiments of the present application will be described in detail below with reference to the embodiments and examples, but those skilled in the art will understand that the following embodiments and examples are only used to illustrate the present application and should not be regarded as limiting the scope of the present application. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without making creative efforts fall within the scope of the present application. If the specific conditions are not specified, the conventional conditions or the conditions recommended by the manufacturer are used. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased on the market.

[0014] The endpoints of the ranges and any values disclosed herein are not limited to the precise values recited as the exact range or value should be understood as being encompassed by the ranges.

[0015] Example 1 The expression level of mRNA of CFTSR in the model of primary fibroblasts of neonatal mice after TGF-β treatment and in the model of myocardial infarction of adult mice.

[0016] (1) Culture of primary fibroblasts of mice Myocardial cells were isolated from 1-2 day old neonatal mice (C57BL / 6), the neonatal mice were washed with 75% alcohol, and the heart was taken out with surgical scissors under sterile conditions and placed in a culture dish containing pre-cooled PBS, the heart was washed with PBS three times, and the heart tissue was cut with surgical scissors, and the heart tissue was transferred to 10 mL of digestion solution (1.2 mg / mL trypsin and 0.14 mg / mL collagenase II), and gently shaken in a 37°C water bath for 6 min, and the supernatant was transferred to a centrifuge tube containing serum, which was stored on ice, and new digestion solution was added again until the heart tissue disappeared. Centrifugation, 1000 rpm / min, 10 min, take the supernatant, resuspend with F12 / DMEM containing 10% serum, centrifuge again, 1000 rpm / min, 10 min, take the supernatant, filter through a 70-mesh cell filter, and filter the myocardial cells, place them in a 10 cm culture dish, and incubate in a 37°C 5% CO2 humidified incubator for 1.5 h, fibroblasts adhere, and continue to culture. According to the experimental design, plate and incubate in a 37°C 5% CO2 humidified incubator. The next day, replace the culture medium in the culture dish and continue to culture for one day.

[0017] (2) Model of fibroblasts treated with TGF-β According to the experimental grouping, TGF-β was added to the fibroblasts for treatment, and the culture was continued for 24 h, and then the subsequent experiments were carried out.

[0018] (3) Mouse myocardial infarction model 8-week-old male C57BL / 6J mice were purchased from Shandong Jinan Pengyue Experimental Animal Breeding Center, and all animal experiments were completed under the guidance of the Qingdao University Experimental Animal Center Ethics Committee. All animals were free to eat during the experiment. All animal studies comply with the European Parliament 2010 / 63 / EU directive and have been approved by the Qingdao University Biomedical Research Ethics Committee (license number: 20200610C576620221208124). After the mice were anesthetized with anesthetic, a respirator was inserted for ventilation. The respirator parameters were set according to the physiological conditions of the mice. At the same time, an electric heating blanket was placed on the back to maintain the body temperature of the mice. The mice were shaved on the chest, and a small gap was carefully opened between the third and fourth ribs with microforceps. After the heart was seen, the pericardium was slowly peeled off. Slowly push the heart to the side and use 6-0 suture to ligate the blood vessel at the left anterior descending branch of the coronary artery. Then, 4-0 suture was used to suture the third and fourth ribs, skin and muscle, and the mice were continued to breathe on the respirator for more than 30 min. After the mice had a reaction, the respirator was removed.

[0019] (4) Real-time fluorescent quantitative PCR (RT-qPCR) TRIZOL reagent was used to extract total RNA from mouse myocardial cells or tissues, and the concentration and purity of total RNA were determined by nanodrop One. AG Evo M-MLV RT Kit reverse transcription kit was used to convert total RNA into cDNA. SYBR Green Kit was used for fluorescent quantitative PCR. RT-qPCR was performed using CFX96 real-time fluorescent quantitative PCR detection system. Reaction conditions: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 30 s, for a total of 40 cycles. The experimental results were qualitatively analyzed by 2 -△△Ct The qPCR primer sequences were as follows: Note: CFTSR-F and CFTSR-R are used for amplification of CFTSR gene transcription RNA; GAPDH-F and GAPDH-R are used for amplification of GAPDH gene transcription RNA.

[0020] Results: As Figure 1 shown, compared with the control group, the mRNA expression level of CFTSR gene in the model of primary fibroblast cells of suckling mice treated with TGF-β was significantly down-regulated by nearly 75% (p<0.0001), and the expression amount in the myocardial infarction injury model of experimental mice was reduced to about one tenth of the control group (p<0.0001).

[0021] Example 2 Expression level of CFTSR mRNA after overexpression of CFTSR in primary fibroblasts.

[0022] (1) Construction of mimics miRNA mimics are artificially synthesized small molecule RNAs that mimic the structure and function of endogenous miRNAs. By specifically binding to the 3' untranslated region (3'UTR) of target gene mRNA, they inhibit its translation or induce degradation, thereby regulating gene expression. They are often used in experiments to enhance or mimic the activity of specific miRNAs.

[0023] (2) Lipofectamine® 3000-mediated cell transfection ① Isolate mouse neonatal primary myocardial cells, and change the liquid before treatment. ② Take one 1.5 mL EP tube and label it. Add 1 mL of DMEM high glucose medium to the 1.5 mL EP tube, add 5 μL of ASO, add 3.75 μL of Lipofectamine® 3000, and mix gently. Put it at room temperature.

[0024] ③ Take out the six-well plate in the cell incubator, discard the original culture medium, and rinse with PBS.

[0025] ④ Add ③ to the corresponding six-well plate, and place the six-well plate in the incubator for 6 h.

[0026] ⑤ After 6 hours of culture, discard the original culture medium, add new culture medium, and continue to culture the six-well plate in the incubator for 24-48 h.

[0027] Results: As shown in Figure 2 , design CFTSR mimics, and detect the expression level of CFTSR mRNA by RT-qPCR to detect its overexpression efficiency. Compared with the control group, the expression level of CFTSR gene in cells was significantly up-regulated by nearly 5 times (p<0.0001). The results show that the mimics are successfully constructed in the cell model.

[0028] Example 3 Primary fibroblasts were treated with TGF-β, and the expression level of fibrosis RNA indicators in cells after overexpression of CFTSR.

[0029] Results: As shown in Figure 3 , compared with the control group, the mRNA levels of COL1A1, COL3A1, ACTA2, CCN2 and FN-1 in fibroblasts after TGF-β treatment were significantly increased by 3 to 4 times. After transfection of CFTSR mimics, the mRNA levels of fibroblast indicators in cells were down-regulated by nearly half compared with the TGF-β treatment group.

[0030] Example 4 Expression levels of fibrosis protein indicators in cells after TGF-β treatment of primary fibroblasts and overexpression of CFTSR.

[0031] Western blotting Total protein was extracted from myocardial cells or tissues with RIPA and PMSF, and the total protein concentration was measured with a BCA kit. The OD value was read by a microplate reader. Protein loading buffer was added to the protein sample according to the concentration, and the sample was incubated at 95°C for 10 min. The protein sample was subjected to SDS-PAGE electrophoresis and transferred to a PVDF membrane, and the protein expression was detected using specific antibodies. The antibodies used were as follows: COL1A1 (Abclone, Cat: A24112, 1:1000); COL3A1 (Abclone, Cat: 10817, 1:1000); ACTA2 (Abclone, Cat: A7248, 1:1000); FN1 (Abclone, Cat: A25907, 1:1000); GAPDH (ABclonal, Cat: A19056, 1:10000).

[0032] Results: As shown in Figure 4 , compared with the control group, the protein levels of COL1A1, COL1A3, ACTA2 and FN-1 in the cells were significantly increased after TGF-β treatment. After transfection of CFTSR mimics, the protein levels of fibroblast indicators in the cells were significantly reduced compared with the TGF-β treatment group.

[0033] Example 5 Changes in cell migration rate after TGF-β treatment of primary fibroblasts and overexpression of CFTSR.

[0034] Cell migration, scratch test 1) Cell inoculation: logarithmic growth phase cells were evenly plated in a 6-well plate and cultured to a confluence of more than 90%; 2) Scratch: sterile 200 μL gun head was vertically scratched, and PBS was used to wash off the detached cells; 3) Culture: drug treatment was added, and photographs were taken at different time points; 4) Analysis: the scratch width was measured using ImageJ software, and the migration rate was calculated.

[0035] Results: As shown in Figure 5 , compared with the control group, the cell migration rate in the cells was significantly increased by about 2 times (p<0.001) after TGF-β treatment. After transfection of CFTSR mimics, the cell migration rate was significantly reduced compared with the TGF-β treatment group (p<0.001).

[0036] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions recorded in the above embodiments can be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A CFTSR gene, characterized in that: Its nucleic acid sequence is shown in SEO ID NO.

1.

2. The use of the CFTSR gene as a marker of fibroblast activation as described in claim 1 in a kit for detecting cardiac fibroblast activation.

3. A kit for detecting cardiomyocyte fibrosis, characterized in that: The kit includes primer pairs for amplifying the RNA transcribed from the CFTSR gene of claim 1, the nucleic acid sequences of which are shown in SEO ID NO.3 and SEO ID NO.

4.

4. A CFTSR gene mimic, characterized in that: The nucleic acid sequence of the CFTSR gene mimic is shown in SEO ID NO.

2.

5. The use of the CFTSR gene mimicry as described in claim 4 in the preparation of medicaments for diagnosing and / or treating heart disease.