A chimeric enzyme and its application in synthesis of isocoumarin compounds
By constructing a chimeric enzyme ColB-TerA-Ⅳ for heterologous expression in Aspergillus oryzae, the problems of low yield and difficult synthesis of natural isocoumarin compounds were solved, and the efficient synthesis of orthosporain, an isocoumarin compound, was achieved, expanding its application potential in the field of agricultural conservation.
Patent Information
- Application Number
- CN202610267228.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-06
- Publication Date
- 2026-07-24
- Estimated Expiration
- 2046-03-06
AI Technical Summary
The low yield and high extraction cost of natural isocoumarins, coupled with the cumbersome and poor stereoselectivity of traditional chemical synthesis methods, limit their industrial application.
The chimeric enzyme was constructed by replacing the acyl carrier protein domain and thioesterase domain of polyketide synthase ColB with the corresponding domains of TerA, and then heterologously expressed in Aspergillus oryzae to form the chimeric enzyme ColB-TerA-Ⅳ, thus successfully synthesizing the isocoumarin compound orthosporain.
This study expands the biosynthetic pathway of orthosporain, an isocoumarin compound, providing lead compounds for novel herbicides and related drugs, improving synthesis efficiency and reducing costs.
Smart Images

Figure CN121825924B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioenzyme and microbial technology, specifically relating to a chimeric enzyme and its application in the synthesis of isocoumarin compounds. Background Technology
[0002] Isocromuels are a class of aromatic polyketide compounds with important biological activities, exhibiting excellent properties in anti-inflammatory, antifungal, and antitumor activity. They also possess selective toxicity against plant pathogens and pests, and have good environmental compatibility, making them important resources for pharmaceutical and biopesticide development. Among them, orthosporin (6,8-Dihydroxy-3-(2-hydroxypropyl)-1H-2-benzopyran-1-one, CAS No.: 159980-40-2) belongs to the isocromuel derivative class and possesses very strong phytotoxic activity. It is a microbial pesticide molecule with great development potential and can be used as a herbicide or herbicide lead compound. Furthermore, it exhibits certain acetylcholinesterase (AChE) inhibitory activity (IC50). 50 (The concentration is 21.18±1.53 μM), which has important value for production research.
[0003] However, the yield of isocoumarins in their natural state is extremely low, and the extraction cost is high. Traditional chemical synthesis faces problems such as complicated synthesis steps and poor stereoselectivity due to the presence of multiple substituted aromatic rings and chiral centers in their structure, which seriously limits their industrial application. Summary of the Invention
[0004] To address the shortcomings of the prior art, this invention provides a chimeric enzyme and its application in the synthesis of isocoumarin compounds. Specifically, through phylogenetic analysis of the previously obtained polyketide synthase ColB, this invention discovered that this enzyme, along with Aspergillus terreus (… Aspergillus terreus The polyketide synthase TerA derived from [source name] has sequence consistency. The acyl carrier protein domain (ACP) and thioesterase domain (TE) of polyketide synthase ColB were replaced with the corresponding domains of polyketide synthase TerA, and linked with the initiation transfer domain (SAT), β-ketone synthase domain (KS), acyltransferase domain (AT), and product template domain (PT) of ColB to form a chimeric enzyme. This chimeric enzyme was then heterologously expressed in *Aspergillus oryzae*, resulting in the successful synthesis of the isocomonasin compound orthosporacin. Based on the above research results, this invention is completed.
[0005] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows:
[0006] In a first aspect, the present invention provides a chimeric enzyme, wherein the amino acid sequence of the chimeric enzyme is any one of the following (a1)-(a3): (a1) The amino acid sequence shown in SEQ ID NO.1; (a2) The amino acid sequence of an enzyme derived from (a1) by substitution and / or deletion and / or addition of one or more amino acid residues, and having the same biological activity; (a3) Other genes that encode an enzyme that has 80% or more of the same amino acid sequence composition as the enzyme shown in SEQ ID NO.1 and has the same or similar function as the enzyme shown in (a1) or (a2).
[0007] The enzymes in (a1)-(a3) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0008] In (a2) above, the substitution and / or deletion and / or addition of one or more amino acid residues is the substitution and / or deletion and / or addition of no more than 10 amino acid residues.
[0009] In this invention, amino acid substitution refers to the replacement of an amino acid at a certain position in an amino acid sequence with another amino acid, as long as the altered sequence completely or partially retains the activity of the original amino acid sequence. Amino acid substitution can be conserved amino acid substitution, meaning that compared to the original amino acid sequence, several amino acids are replaced by amino acids with similar or related properties to form a peptide.
[0010] In this invention, amino acid deletion may refer to the deletion of 1, 2 or 3 or more amino acids from the amino acid sequence, as long as the altered sequence completely or partially retains the activity of the original amino acid sequence.
[0011] In this invention, amino acid addition can refer to adding 1, 2 or 3 or more amino acids at any position at the C-terminus, N-terminus or between the C-terminus and N-terminus of the amino acid sequence, as long as the modified sequence completely or partially retains the activity of the original amino acid sequence.
[0012] A second aspect of the present invention provides a nucleic acid molecule that encodes the chimeric enzyme.
[0013] In this invention, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0014] Specifically, the nucleotide sequence of the nucleic acid molecule is any one of the following (b1)-(b4): (b1) The nucleotide sequence shown in SEQ ID NO.2; (b2) The complementary nucleotide sequence to (b1); (b3) A nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (b1) or (b2) and encodes the same functional enzyme; (b4) A nucleotide sequence that, under stringent conditions, can hybridize with any of the nucleotide sequences described in (b1)–(b3) and encode an enzyme with the same or similar function.
[0015] In this invention, the stringent conditions can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA. Hybridization can be performed in a mixed solution of EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS; alternatively, hybridization can be performed at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 65°C in 0.1×SSC and 0.1% SDS; alternatively, hybridization can be performed in a solution of 6×SSC and 0.5% SDS at 65°C, followed by washing once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.
[0016] It should be noted that the term "identity" refers to sequence similarity to an amino acid / nucleotide sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0017] A third aspect of the present invention provides a gene expression cassette, the gene expression cassette comprising at least the aforementioned nucleic acid molecules.
[0018] In a fourth aspect, the present invention provides a genetically engineered bacterium containing the above-mentioned nucleic acid molecule and the above-mentioned gene expression cassette; or, the host cell is capable of expressing the above-mentioned chimeric enzyme.
[0019] The genetically engineered bacteria include bacteria and fungi.
[0020] The fungi include Aspergillus, and more specifically Aspergillus oryzae.
[0021] The genetically engineered bacteria are constructed by transferring the gene expression cassette into the starting strain.
[0022] The starting strain is Aspergillus oryzae ( Aspergillus oryzae RIB40 is widely used for heterologous expression of genes in filamentous fungi.
[0023] A fifth aspect of the present invention provides the use of the above-mentioned chimeric enzyme or genetically engineered bacteria in the synthesis of isocoumarin compounds.
[0024] Specifically, the isocoumarin compound can be orthosporin.
[0025] A sixth aspect of the present invention provides a method for synthesizing isocoumarin compounds, the method comprising culturing the above-mentioned genetically engineered bacteria and isolating and purifying the isocoumarin compounds, wherein the isocoumarin compounds may specifically be orthosporain.
[0026] The beneficial technical effects of one or more of the above technical solutions are as follows: The above technical solution is the first to incorporate olive-colored husks ( Chaetomium olivaceum A polyketide synthase encoding gene in SD-80A ColB With Aspergillus terreus ( Aspergillus terreus A polyketide synthase encoding gene from ( ) TerA Chimeric enzymes were constructed using domain substitution, and heterologous expression cassettes were built to achieve expression of the chimeric enzyme encoding gene. ColB- TerA-Ⅳ The heterologous expression of this chimeric enzyme confirmed its function, expanded the biosynthetic pathway of orthosporain, a fungal metabolite, and helped provide lead compounds for novel herbicides and related drugs, thus having good practical application value. Attached Figure Description
[0027] Figure 1 This invention relates to the chimeric enzyme encoding gene. ColB-TerA-Ⅳ With polyketide synthase encoding gene ColB and TerA HPLC chromatogram of heterologous expression in Aspergillus oryzae.
[0028] Figure 2 This invention relates to the chimeric enzyme encoding gene. ColB-TerA-Ⅳ HPLC chromatograms of heterologous expression of Aspergillus oryzae and orthosporin (i.e., compound 1).
[0029] Figure 3 This is the structural formula of orthosporin.
[0030] Figure 4 This is the mass spectrum of orthosporacin. Detailed Implementation
[0031] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0032] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for the purpose of describing specific embodiments and not for limiting the scope of protection of the present invention.
[0033] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0034] The amino acid sequence of the chimeric enzyme ColB-TerA-Ⅳ of the present invention is shown below: chimeric enzyme encoding gene ColB-TerA-Ⅳ The nucleotide sequence is shown below: Specifically, this invention provides a chimeric enzyme-encoding gene. ColB-TerA-Ⅳ The construction method of the heterologous expression engineered strain of Aspergillus oryzae includes the following steps: (1) Constructing a structure containing ColB-TerA-Ⅳ Heterologous gene expression cassette: with olive-colored hair ( Chaetomium olivaceum Using the SD-80A genome sequence as a template, amplification was performed using primer sequences SEQ ID NO. 3-4. ColB The SAT-KS-AT-PT domain fragment; with Aspergillus terrestris ( Aspergillus terreus Using the genome sequence as a template, amplification was performed using primer sequences SEQ ID NO. 5-6. TerA The ACP-ACP-TE domain fragment was used to construct a heterologous expression cassette by linking the above fragment with the amylase promoter and terminator fragments using fusion PCR technology.
[0035] (2) The constructed heterologous expression cassette and the genimycin G418 resistance fragment were co-transformed into Aspergillus oryzae protoplasts using the PEG method; (3) Screening is performed using genetic mycin G418 resistance, and positive mutants are obtained by colony PCR screening.
[0036] The above construction method obtains ColB-TerA-Ⅳ In the heterologous expression strain of Aspergillus oryzae, the gene was detected in ColB-TerA-Ⅳ After the gene was transferred into Aspergillus oryzae, it achieved ColB-TerA-Ⅳ Gene expression.
[0037] It should be noted that, although this invention provides a method for creating chimeric enzyme-encoded genes based on domain substitution and heterologous expression, ColB-TerA-Ⅳ A method for obtaining Aspergillus oryzae heterologous expression engineered strains for orthosporacin is described, but based on the inventive concept of this invention, other heterologous expression... ColB-TerA-Ⅳ The method for obtaining corresponding genetically engineered bacteria from genes also falls within the scope of protection of this invention.
[0038] Specifically, the present invention provides a chimeric enzyme gene obtained by the above-mentioned domain substitution. ColB-TerA-Ⅳ Applications in any one or more of the following: (c1) Biosynthesis of orthosporacin using chimeric enzymes; (c2) Improve the efficiency of polyketide synthase ColB in producing orthosporin; (c3) Expand the application of orthosporacin in the field of agricultural protection.
[0039] In (c3), the application specifically includes: for based on ColB-TerA-ⅣThis provides a lead compound for the development of new drugs related to the synthesis of orthosporin. Specifically, this application can improve the efficacy of orthosporin in the preparation of novel herbicides or drugs.
[0040] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0041] Sources of biological materials: Olive-colored fur ( Chaetomium olivaceum SD-80A is a strain of the genus *Chaetoceros* screened and identified by our laboratory. Its accession number at the China General Microbiological Culture Collection Center is CGMCC No. 40420. This strain has been disclosed in Chinese patent CN116144637A. *Aspergillus terreus* (… Aspergillus terreus The sample was purchased from the China General Microbiological Culture Collection Center, with accession number CGMCC 3.15736. *Aspergillus oryzae* (…) Aspergillus oryzae RIB40 (ATCC42149) is a widely used standard reference strain of Aspergillus oryzae, which was purchased from Beijing Bio-Bio Biotechnology Co., Ltd.
[0042] Example 1: Chimeric enzyme ColB-TerA-Ⅳ Heterologous expression of genes in Aspergillus oryzae 1. Chimeric enzyme ColB-TerA-Ⅳ Construction of heterologous Aspergillus oryzae engineered strain (1) Construction of heterologous expression boxes Olive-colored scab SD-80A and Aspergillus terrestris were respectively tested. A. terreus CGMCC 3.15736 was inoculated into PDB medium and cultured at 28°C for 3 days. The genome was then extracted using a fungal genome extraction kit. Using this genome as a template, the SAT-KS-AT-PT domain fragment of ColB was amplified using primers (ATGGAGGCCAAACTCGACG, SEQ ID NO.3) and (CAGGAGGTAAGAGTTGGTTGAGCGTGTGGCGCTT, SEQ ID NO.4). The ACP-ACP-TE domain fragment of TerA was amplified using primers (CCACACGCTCAACCAACTCTTACCTCCTGTCAAG, SEQ ID NO.5) and (TCATGCACCGATCAAGCGAT, SEQ ID NO.6). The two chimeric enzyme-encoding gene fragments were then ligated to the amylase promoter and terminator fragments using fusion PCR.
[0043] (2) Preparation of Aspergillus oryzae protoplasts Aspergillus oryzae ( Aspergillus oryzaeRIB40 strain was inoculated onto a sporulation medium plate and placed in a 30°C dark incubator for 7-12 days until a large number of mature spores were formed. Add 5 mL of sterile spore suspension to the sporulation plate. Gently scrape spores from the plate surface using a spreader, transfer the scraping liquid to a sterile filter to collect the spores. Resuspend the spores in sterile suspension and adjust the spore concentration to 1×10⁻⁶. 8 cell / mL.
[0044] Take 1 mL of the spore suspension adjusted above and inoculate it into 100 mL of DPY liquid medium. Place it in a 30 ℃ constant temperature shaking incubator and shake at 200 rpm for 2 days to allow the spores to germinate and form tender mycelial balls.
[0045] Preparation of enzymatic hydrolysate: Weigh 100 mg of lysozyme (Yatalase) and dissolve it in 20 mL of Solution Ⅰ (0.8 M NaCl, 10 m M NaH2PO4, pH 6.0). After preparation, filter the solution through a 0.22 μm filter membrane for sterilization and set aside.
[0046] Mycelial ball treatment: The young mycelial balls obtained from the culture are collected through a sterile filter and washed twice with sterile water to remove residual culture medium; the washed mycelial balls are transferred into the above sterile enzymatic hydrolysate and placed at 30 ℃ and 200 rpm for 1-2 hours of enzymatic hydrolysis with shaking until the supernatant of the enzymatic hydrolysate is turbid.
[0047] Protoplast purification: The enzymatically digested bacterial culture was transferred through a sterile filter to a new 50 mL centrifuge tube and placed in a refrigerated centrifuge at 4 °C. The centrifuge was then centrifuged at 800 × 10⁻⁶. g Centrifuge for 5 minutes; discard the supernatant, resuspend the precipitate in 20 mL of 0.8 M NaCl solution, and repeat the washing process twice. After each washing, incubate at 4 °C and 800 × 10⁻⁶. g Centrifuge for 5 minutes under the specified conditions.
[0048] After the second washing, the number of protoplasts was counted under a microscope using a hemocytometer; subsequently, the cells were heated at 4 ℃ and 800 × 10⁻⁶. g Centrifuge for 5 minutes under the specified conditions, discard the supernatant, and resuspend the protoplasts in a 4:1 volume ratio of Solution II (0.8 M NaCl, 10 mM CaCl2, 10 mM Tris, pH 8.0) to Solution III (40% PEG4000, 50 mM CaCl2, 50 mM Tris, pH 8.0). Adjust the protoplast concentration to 2 × 10⁻⁶. 8 cell / ml.
[0049] (3) Protoplast transformation Take 200 μL of the protoplast suspension after concentration adjustment and add it to a 50 mL sterile centrifuge tube. Add 2 μg of sterile expression cassette and resistance fragment, mix gently, and then place in an ice bath for 20 min.
[0050] Add 1 mL of Solution Ⅲ (40% PEG4000, 50 mM CaCl2, 50 mM Tris, pH 8.0) to a centrifuge tube, gently mix using a sterile pipette tip, and incubate at room temperature for 20 min.
[0051] Add 10 mL of Solution II (0.8 M NaCl, 10 mM CaCl2, 10 mM Tris, pH 8.0), mix gently, and transfer to a refrigerated centrifuge at 4 °C. Centrifuge at 800 × 10⁻⁶. g Centrifuge at a certain speed for 10 minutes.
[0052] Discard the supernatant, add 1 mL Solution II (0.8 M NaCl, 10 mM CaCl2, 10 mM Tris, pH 8.0) to resuspend the precipitate; add 200 μL of the resuspended solution to the center of the corresponding screening medium plate, immediately add 5 mL of top agar, mix quickly and gently, and incubate upside down in a 30 ℃ incubator for 3-5 days.
[0053] (4) Transformant screening After transformation, single colonies were passaged individually onto new selection plates. Young hyphae were picked and lysed to serve as templates. PCR verification was performed using primers SEQ ID NO.3 and SEQ ID NO.6 to confirm whether the colonies had been transformed into the Aspergillus oryzae genome, and sequencing was used to verify the correctness.
[0054] 2. ColB-TerA-Ⅳ Analysis of secondary metabolites of genetically engineered Aspergillus oryzae strains Inoculate the engineered strain of Aspergillus oryzae onto CD solid medium plates and incubate at 30 ℃ for 3-5 days to activate it; pick the activated strain and aseptically inoculate it into MPY liquid medium and incubate at 30 ℃ and 200 rpm in a constant temperature shaking incubator for 3-4 days to prepare seed culture.
[0055] Take the bacterial balls from the seed culture and inoculate them into 70 sterile 500 mL Erlenmeyer flasks containing MPY liquid culture medium (200 mL / flask). Ferment at 30℃ and 200 rpm on a constant temperature shaker for 7 days.
[0056] The fermentation product was collected and ultrasonically extracted five times with an equal volume of ethyl acetate. The extracts were combined and concentrated under reduced pressure to obtain a crude extract. 10 mg of the crude extract was accurately weighed, dissolved in 1 mL of chromatographically pure methanol, filtered through a 0.22 μm syringe filter, and analyzed by high-performance liquid chromatography (HPLC). The chimeric enzyme encoding gene was then analyzed. ColB-TerA-Ⅳ With polyketide synthase encoding gene ColB and TerA HPLC chromatogram of heterologous expression in Aspergillus oryzae as shown in the figure Figure 1 As shown, the chimeric enzyme encoding gene ColB-TerA-Ⅳ The HPLC chromatograms of heterologous expression of Aspergillus oryzae and orthosporin (i.e., compound 1) are as follows: Figure 2 As shown.
[0057] The crude extract was purified by silica gel column chromatography with gradient elution using petroleum ether:ethyl acetate (100:0, 90:10, 70:30, 50:50, 0:100, v / v) as the eluent, resulting in 10 fractions (Fr. 1-10). Fr. 7 was further purified using HPLC preparative column chromatography to obtain orthosporin (…). Figure 3 The compound was then characterized by mass spectrometry. Figure 4 This indicates that the genetically engineered bacteria synthesizes orthosporin.
[0058] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A chimeric enzyme, characterized in that, The amino acid sequence of the chimeric enzyme is shown in SEQ ID NO.
1.
2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the chimeric enzyme of claim 1.
3. The nucleic acid molecule as described in claim 2, characterized in that, The nucleotide sequence of the nucleic acid molecule is any one of the following (b1)-(b2): (b1) The nucleotide sequence shown in SEQ ID NO.2; (b2) is a complementary nucleotide sequence to (b1).
4. A gene expression cassette, characterized in that, The gene expression cassette comprises the nucleic acid molecule as described in claim 2 or 3.
5. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria contain the nucleic acid molecule as described in claim 2 or 3 or the gene expression cassette as described in claim 4.
6. The genetically engineered bacteria as described in claim 5, characterized in that, The genetically engineered bacteria include bacteria and fungi.
7. The genetically engineered bacteria as described in claim 6, characterized in that, The fungus includes Aspergillus oryzae.
8. The genetically engineered bacteria as described in claim 5, characterized in that, The genetically engineered bacteria are constructed by transferring the gene expression cassette into the starting strain. The starting strain is Aspergillus oryzae ( Aspergillus oryzae )RIB40.
9. The use of the chimeric enzyme of claim 1 or the genetically engineered bacteria of any one of claims 5-8 in the synthesis of isocoumarin compounds; wherein the isocoumarin compound is orthosporacin.
10. A method for synthesizing isocoumarin compounds, characterized in that, The method includes culturing the genetically engineered bacteria according to any one of claims 5-8, and isolating and purifying isocoumarin compounds; the isocoumarin compounds are orthosporain.