Heat-resistant MLV reverse transcriptase mutant as well as preparation method and application thereof

By performing site-directed mutations at three points (Q290I, L332P, and D338E) on MLV reverse transcriptase, the enzyme's thermostability and RNA binding capacity were improved. This solved the problem of easy inactivation of wild-type MLV reverse transcriptase at medium and high temperatures, achieving efficient reverse transcription and low RNase H activity, making it suitable for molecular biology research and nucleic acid detection.

CN121852353AActive Publication Date: 2026-04-14BEIJING TRANSGEN BIOTECH CO LTD +1
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202610147234.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-03
Publication Date
2026-04-14
Estimated Expiration
2046-02-03

Smart Images

  • Figure CN121852353A_ABST
    Figure CN121852353A_ABST
Patent Text Reader

Abstract

The invention discloses a heat-resistant MLV reverse transcriptase mutant as well as a preparation method and application thereof. The invention discloses an MLV reverse transcriptase mutant with an amino acid sequence as shown in SEQ ID NO.1 at first. The invention further discloses a preparation method and application of the MLV reverse transcriptase mutant. According to the MLV reverse transcriptase mutant, key amino acid sites of wild type MLV reverse transcriptase are modified through site-specific mutagenesis, the thermal stability of the MLV reverse transcriptase in the range of 45-65 DEG C is improved, the optimum temperature in the reverse transcription process is increased to 65 DEG C from 45 DEG C, meanwhile, the low RNase H activity of the MLV reverse transcriptase mutant is kept, degradation of RNA-cDNA hybrid chains is reduced, and the MLV reverse transcriptase mutant has the advantages of being high in yield and high in stability. The technical effects of improving the reverse transcription reaction efficiency, enhancing the reverse transcription capability on a complex secondary structure RNA template and reducing the non-specific reaction are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and protein engineering. More specifically, it relates to a heat-resistant MLV reverse transcriptase mutant, its preparation method, and its applications. Background Technology

[0002] Reverse transcriptase (RT) is a key functional enzyme that synthesizes cDNA using RNA as a template. As a core tool in molecular biology research and nucleic acid detection technology, its performance directly determines the accuracy, efficiency, and application scope of experimental results. Since its discovery, reverse transcriptase has been widely used in various fields such as reverse transcription polymerase chain reaction (RT-PCR), cDNA library construction, real-time quantitative RT-PCR (qRT-PCR), gene cloning, and RNA sequencing, supporting a series of key tasks in basic biological research, clinical disease diagnosis, food safety testing, and environmental microbial monitoring.

[0003] Among the many sources of reverse transcriptases, murine leukemia virus (MLV)-derived reverse transcriptase has become the mainstream choice for laboratory and industrial applications due to its unique advantages. Its core advantages include: highly efficient RNA-dependent DNA polymerase activity, enabling rapid and specific catalysis of the conversion of RNA templates to cDNA; low RNase H activity, reducing degradation of the RNA-cDNA hybrid chain and ensuring the integrity of the cDNA product; and the well-defined gene sequence and mature heterologous expression system of MLV reverse transcriptase, allowing for large-scale production using engineered strains such as *E. coli*, resulting in significantly lower production costs compared to reverse transcriptases from other sources. These characteristics have led to its widespread adoption in research and clinical testing.

[0004] However, existing wild-type MLV reverse transcriptases have a significant technical drawback: poor thermostability. This problem severely limits the expansion of their applications and performance improvement. The optimal reaction temperature for wild-type MLV reverse transcriptase is typically limited to 37-42℃. When the reaction temperature exceeds 45℃, its spatial conformation undergoes irreversible changes, leading to a rapid decline in enzyme activity. Experimental data shows that after incubation at 50℃ for 10 minutes, the activity of wild-type MLV reverse transcriptase can be reduced by more than 80%, while after incubation at 60℃ for the same time, the enzyme activity is almost completely lost. This low thermostability triggers a series of chain reactions: on the one hand, in core applications such as RT-PCR, the relatively low reverse transcription temperature makes it difficult to effectively unravel the secondary structure of the RNA template. Due to complementary base pairing, RNA molecules easily form complex secondary structures such as hairpins and stem-loops, especially in regions rich in GC base pairs, where these structures are more stable. Wild-type MLV reverse transcriptase cannot fully disrupt these secondary structures at reaction temperatures of 37-42℃, making it difficult for enzyme molecules to effectively bind to template RNA. This results in incomplete cDNA synthesis, low amplification efficiency, and even missed detection of target genes, severely impacting the reliability of detection results. Furthermore, its low thermostability makes the reaction system extremely sensitive to temperature fluctuations. In actual experiments, whether using small-scale laboratory PCR instruments or large-scale industrial detection equipment, slight temperature deviations or fluctuations may occur. Wild-type MLV reverse transcriptase has extremely poor tolerance to such fluctuations, easily triggering non-specific reverse transcription reactions, producing heterogeneous bands or false positive results, increasing the difficulty of result interpretation and the risk of error. Moreover, in scenarios requiring high-sensitivity detection (such as trace viral RNA detection and rare gene expression analysis), insufficient enzyme activity due to low thermostability further amplifies experimental errors and lowers the detection limit of the detection method.

[0005] To address the aforementioned issues, various improvement schemes have been attempted in existing technologies, but all have significant limitations. Some schemes compensate for activity loss by increasing the enzyme dosage or extending the reaction time, such as increasing the enzyme amount by 2-3 times in the conventional reaction system, or extending the reverse transcription reaction time from 30 minutes to 60-90 minutes. However, this approach not only significantly increases experimental costs, making it difficult to implement in large-scale detection scenarios, but also fails to fundamentally solve the core problems of RNA template secondary structure interference and non-specific reactions, and may even further exacerbate non-specific binding due to excessively high enzyme concentrations. Another approach is to use thermostable reverse transcriptases from other sources, such as reverse transcriptase derived from avian myeloblastosis virus (AMV). AMV reverse transcriptase has an optimal reaction temperature of 48-55℃, exhibits superior thermostableness compared to wild-type MLV reverse transcriptase, and has a stronger ability to break down RNA secondary structures. However, this enzyme has significant drawbacks: its RNase H activity is high, which easily degrades the RNA-cDNA hybrid chain during reverse transcription, resulting in reduced cDNA yield and decreased fragment integrity; at the same time, AMV reverse transcriptase has high gene complexity, making heterologous expression difficult, and its preparation cost is 3-5 times that of MLV reverse transcriptase, making it difficult to meet the cost control requirements for large-scale industrial applications.

[0006] In addition, some researchers have modified MLV reverse transcriptase through random mutation and site-directed mutagenesis in an attempt to improve its heat resistance. However, these modification schemes are mostly designed with a single mutation site and have failed to deeply analyze the relationship between the spatial structure of the enzyme molecule and its thermal stability. As a result, the improvement in heat resistance is limited, usually only increasing the enzyme's tolerance temperature by 3-5°C. Moreover, these modifications are often accompanied by side effects such as decreased catalytic efficiency and reduced specificity, failing to achieve simultaneous optimization of heat resistance and catalytic performance.

[0007] With the rapid development of molecular biology technology, the market has placed higher demands on the performance of reverse transcriptases. For example, in rapid clinical diagnostic scenarios, the entire process from sample processing to result interpretation needs to be completed within 30-60 minutes, which requires reverse transcriptases to react rapidly at higher temperatures. In the detection of complex RNA samples (such as viral RNA and long non-coding RNA), enzymes need to have stronger secondary structure breaking capabilities and stability.

[0008] Therefore, developing an MLV reverse transcriptase mutant that combines high heat resistance, low RNase H activity, high catalytic efficiency, and controllable cost has become a key technical problem that urgently needs to be solved in this field, and is of great significance to promoting the development of molecular biology research and nucleic acid detection technology. Summary of the Invention

[0009] One objective of this invention is to provide a heat-resistant MLV reverse transcriptase mutant (MLV RT mutant) to address the problems of poor thermal stability, easy inactivation at medium and high temperatures, low reverse transcription efficiency, weak ability to break down RNA template secondary structures, and numerous non-specific products of existing wild-type MLV reverse transcriptase (wild-type MLV RT).

[0010] Another object of the present invention is to provide the application of the above-mentioned MLV reverse transcriptase mutant.

[0011] To achieve the above objectives, the present invention adopts the following technical solution: The present invention first provides a heat-resistant MLV reverse transcriptase mutant, the amino acid sequence of which is shown in SEQ ID NO.1.

[0012] This invention is based on site-directed mutagenesis of wild-type MLV reverse transcriptase (amino acid sequence shown in SEQ ID NO.3). The mutation sites are glutamine at position 290 to isoleucine (Q290I), leucine at position 332 to proline (L332P), and aspartic acid at position 338 to glutamic acid (D338E). The simultaneous mutation at these three sites creates a synergistic effect, resulting in an enzyme activity residual rate of ≥60% after incubation at 65℃ for 30 minutes, raising the optimal reverse transcription temperature to 65℃, and achieving RNase H activity of 80%-90% of the wild type.

[0013] The polynucleotides encoding the above-mentioned MLV reverse transcriptase mutants are also within the scope of protection of this invention.

[0014] In a specific embodiment of the present invention, the polynucleotide encoding the above-mentioned MLV reverse transcriptase mutant is shown in SEQ ID NO.2.

[0015] Recombinant vectors containing the aforementioned polynucleotides are also within the scope of protection of this invention.

[0016] In a specific embodiment of the present invention, the recombinant vector is pET-21a-MLVRTTS4; pET-21a-MLVRTTS4 is obtained by inserting a polynucleotide encoding an MLV reverse transcriptase mutant, as shown in SEQ ID NO.2, between the BamHI and XhoI restriction sites of the pET-21a plasmid, while keeping the other sequences of pET-21a unchanged.

[0017] Recombinant cells containing the above-mentioned polynucleotides or recombinant vectors are also within the scope of protection of this invention.

[0018] In a specific embodiment of the present invention, the host cell of the recombinant cell is a modified BL21 Escherichia coli.

[0019] This invention further provides a method for preparing the above-mentioned MLV reverse transcriptase mutant, the method comprising the following steps: a1) Construct a recombinant vector containing the polynucleotide shown in SEQ ID NO.2; a2) Transform the recombinant vector into host cells, induce expression, and obtain bacterial cells; a3) The bacterial cells were broken, centrifuged, and the supernatant was obtained. The supernatant was then purified to obtain the MLV reverse transcriptase mutant.

[0020] In a specific embodiment of the present invention, the recombinant vector is the above-mentioned pET-21a-MLVRTTS4; the host cell is BL21(DE3) competent cells.

[0021] In a specific embodiment of the present invention, the method for constructing the recombinant vector pET-21a-MLVRTTS4 includes the following steps: b1) Using the cloning vector pET-21a-MLVRT containing the wild-type MLV reverse transcriptase (as shown in SEQ ID NO.4) as a template, segmental PCR amplification was performed using primer pairs BamHI-RT-F / Q290I-R and Q290I-F / XhoI-RT-R to obtain two gene fragments containing the Q290I mutation. These fragments were mixed at a 1:1 molar ratio and used as templates for splicing PCR with primer pairs BamHI-RT-F / XhoI-RT-R to obtain the full-length gene containing the Q290I mutation. Using the full-length gene containing the Q290I mutation as a template, segmental PCR was performed using primer pairs BamHI-RT-F / L332P-R and L332P-F / XhoI-RT-R to obtain two gene fragments containing the Q290I / L332P double mutation. These fragments were then spliced ​​PCR. The full-length gene containing the Q290I / L332P double mutation was obtained. Using the full-length gene containing the Q290I / L332P double mutation as a template, segmental PCR was performed using primer pairs BamH I-RT-F / D338E-R and D338E-F / Xho I-RT-R to obtain two gene fragments containing the Q290I / L332P / D338E double mutation. The PCR product of the full-length gene containing the MLVRT mutant with the Q290I / L332P / D338E triple mutation was obtained by splicing PCR. b2) The pET-21a empty vector was digested with BamHI and XhoI and then ligated with the PCR product using T4 DNA ligase to obtain the ligation product; b3) The ligation product was transformed into E. coli DH5α competent cells, and positive clones were obtained through resistance selection; plasmids were extracted and sequenced for verification, and the recombinant vector pET-21a-MLVRTTS4 was successfully constructed.

[0022] In a specific embodiment of the present invention, the purification includes nickel ion affinity chromatography and ion exchange chromatography.

[0023] The present invention further provides the use of the above-mentioned MLV reverse transcriptase mutant, and / or, the above-mentioned polynucleotide, and / or, the above-mentioned recombinant vector, and / or, recombinant cells in reverse transcription reactions and / or in the preparation of reverse transcription reaction products.

[0024] The present invention further provides a reverse transcription kit comprising an MLV reverse transcriptase mutant.

[0025] The beneficial effects of this invention are as follows: This invention utilizes site-directed mutagenesis to modify key amino acid sites of wild-type MLV reverse transcriptase, improving its thermostability within the 45-65℃ range. After incubation at this temperature for 30 minutes, the MLV reverse transcriptase mutant retains over 60% of its activity. The optimal temperature for reverse transcription is increased from 45℃ to 65℃, while maintaining low RNase H activity, reducing degradation of the RNA-cDNA hybrid chain. Ultimately, this achieves the technical effects of improving reverse transcription efficiency, enhancing the ability to reverse transcribe complex secondary structure RNA templates, and reducing non-specific reactions. Attached Figure Description

[0026] The specific embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.

[0027] Figure 1 This is an SDS-PAGE gel image of wild-type MLV RT and MLV reverse transcriptase mutant (MLV RT mutant) of the present invention.

[0028] Figure 2 A comparison of the thermostability of wild-type MLV reverse transcriptase and MLV reverse transcriptase mutant.

[0029] Figure 3 This is a comparison of the reverse transcription activities of wild-type MLV RT and MLV RT mutants.

[0030] Figure 4 The reverse transcription activity of wild-type MLV RT and MLV RT mutant was detected by qRT-PCR. Detailed Implementation

[0031] To more clearly illustrate the present invention, the following description, in conjunction with preferred embodiments and accompanying drawings, further explains the invention. Similar components in the drawings are indicated by the same reference numerals. Those skilled in the art should understand that the specific description below is illustrative rather than restrictive and should not be construed as limiting the scope of protection of the present invention.

[0032] Example 1: Preparation of MLV reverse transcriptase mutant (MLV RT mutant) This invention systematically analyzes the amino acid sequence and crystal structure of wild-type MLV reverse transcriptase (wild-type MLV RT), combines protein structure prediction and molecular dynamics simulation, screens out key sites closely related to thermal stability, and constructs MLV RT mutants through site-directed mutagenesis. The specific technical solution is as follows: I. Screening and Determination of Mutation Sites Based on the crystal structure of wild-type MLV RT (amino acid sequence as shown in SEQ ID NO.3) (PDB ID: 1MLV), structural analysis was performed using PyMOL software. Combined with GROMACS molecular dynamics simulations (simulation temperatures 37℃, 45℃, 55℃, and 65℃, simulation duration 100 ns), the Root Mean Square Deviation (RMSD) and Root Mean Square Fluctuation (RMSF) values ​​of the enzyme molecule at different temperatures were analyzed. It was determined that the following three sites are directly related to the thermal stability of RT, and their conformational changes significantly affect enzyme activity: 1) Amino acid at position 290: The wild type is glutamine (Q). This site is located in the core domain of RT (palm region, amino acid sequence positions 280-300), belonging to the hydrophobic pocket region surrounding the enzyme active site. Molecular dynamics simulations show that the side chain at this site is prone to flexible wobble at high temperatures, leading to conformational relaxation and disrupting the spatial structural stability of the enzyme active site. The mutation of glutamine (Q) to isoleucine (I) has a longer and more hydrophobic hydrophobic side chain (isopropyl) than the amide group of glutamine, which can enhance the hydrophobic interaction of the enzyme core domain (palm region). This reduces the RMSD value of this region from 0.35 nm to 0.22 nm at 55 °C, effectively inhibiting conformational relaxation at high temperatures and improving the overall structural stability of the enzyme. At the same time, the spatial conformation of the isoleucine side chain forms a more compact hydrophobic stack with the surrounding amino acid residues (L288, V302), further reinforcing the spatial structure of the active site.

[0033] 2) Amino acid at position 332: The wild-type amino acid is leucine (L), located in the thumb region of RT (amino acid positions 320-340). This region is responsible for binding and localization to the RNA template. At high temperatures (≥50℃), this site is prone to conformational drift, causing the enzyme-template binding constant to decrease from 1.2 × 10⁻⁶. 6 M - ¹ Reduced to 3.5 × 10 5 M - ¹, significantly weakening binding stability; the mutation of leucine (L) to proline (P), with its pyrrolidine ring structure, restricts the flexible rotation of the peptide chain, enhancing the rigidity of the peptide backbone in the thumb region and reducing conformational drift at high temperatures. Molecular dynamics simulations show that this mutation reduces the RMSF value in the thumb region from 0.3 nm to 0.18 nm, and increases the binding constant of the enzyme to the RNA template to 2.8 × 10¹². 6 M - ¹, significantly enhances the stability of the enzyme-template complex; in addition, the introduction of proline does not change the key binding site between the enzyme and the template, ensuring that the catalytic activity is not affected.

[0034] 3) Amino acid at position 338: The wild type is aspartic acid (D), also located in the thumb region of RT, about 5 Å away from amino acid at position 332. The two form a synergistic effect to participate in template binding. At high temperatures, the carboxyl side chain at this site is prone to charge rearrangement, which disrupts the electrostatic interaction with the phosphate group of the template RNA, further aggravating the dissociation of the enzyme-template complex. The mutation of aspartic acid (D) to glutamic acid (E) results in an additional methylene group on the side chain of glutamic acid, with a more uniform charge distribution. This allows for a more stable electrostatic interaction with the phosphate group of the RNA template, while also optimizing the local charge environment in the thumb region. This synergistic effect with the L332P mutation further stabilizes the enzyme-template complex. In addition, the side chain conformation of glutamic acid is more stable and less prone to charge rearrangement at high temperatures, ensuring the catalytic sustainability of the enzyme under medium and high temperature conditions.

[0035] By screening a saturated mutation library for the above sites, the optimal mutation combination was finally determined to be: Q290I (glutamine → isoleucine), L332P (leucine → proline), and D338E (aspartic acid → glutamic acid). The three sites work synergistically to improve the enzyme’s thermostability from two core dimensions: structural stability (Q290I) and template binding (L332P, D338E). This achieves simultaneous optimization of thermostability and catalytic performance, avoiding the performance imbalance caused by a single mutation.

[0036] II. Construction of Mutants 1. Primer design and synthesis Site-directed mutagenesis primers were designed for the aforementioned mutation sites. The forward primer contained the mutated bases, and the reverse primer contained complementary sequences. All primers were 25-30 bp in length, with GC content controlled at 45%-55%, and a Tm value of 58±2℃. Both ends of the primers were homologous to the wild-type MLV RT gene sequence to ensure PCR amplification specificity. The specific primer sequences are as follows (underlined bases are mutated bases). The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and purified by HPLC with a purity ≥99%.

[0037] BamH I-RT-F: 5'-GGATCCCTAAATATAGAAGATG-3', SEQ ID NO.5 Xho I-RT-R: 5'- TCCCCCCGGGTTATATGAGGAGGGTA -3', SEQ ID NO.6 Q290I-F: 5'- GATGGGG ATA CCTACTCCGAAGACCCTCG-3', SEQ ID NO.7 Q290I-R: 5'-GTAGGTATCCCCATCACAGTCTCTTTTCTGG-3', SEQ ID NO.8 L332P-F: 5'- GGGGACT CCG TTTAATTGGGGCCCAGACC-3', SEQ ID NO.9 L332P-R: 5'-TTAAACGGAGTCCCCGTTTTGGTGAGAG-3', SEQ ID NO.10 D338E-F: 5'- GGGCCCA GAA CAACAAAAGGCCTATCAAGAAATC-3', SEQ ID NO.11 D338E-R: 5'- TGTTGTTCTGGGCCCCAATTAAACAGAGTC-3', SEQ ID NO.12 2. Plasmid construction (introducing three mutations in sequence) First round of PCR (introducing the Q290I mutation): Using pET-21a-MLVRT plasmid (concentration 50 ng / μL) containing the wild-type MLV RT gene (polynucleotide sequence as shown in SEQ ID NO.4) as a template, segmental PCR amplification was performed using primer pairs BamH I-RT-F / Q290I-R and Q290I-F / Xho I-RT-R to obtain two gene fragments containing the Q290I mutation (fragment 1: 1-870 bp, fragment 2: 871-2013 bp). Amplification system (50 μL): 1 μL template, 1 μL each of forward and reverse primers (concentration 10 μM), 25 μL 2×Pfu PCR Master Mix (containing dNTPs and buffer), 22 μL ddH2O. Amplification program: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 30 seconds, 58℃ annealing for 30 seconds, 72℃ extension for 1 minute (fragment 1) / 1.2 minutes (fragment 2), for a total of 30 cycles; 72℃ final extension for 10 minutes.

[0038] Fragment splicing and second-round PCR (introduction of L332P mutation): The two PCR products were recovered and mixed at a molar ratio of 1:1 as templates. Splicing PCR was performed using primer pairs BamHI-RT-F / XhoI-RT-R to obtain the full-length gene containing the Q290I mutation. Using the full-length gene containing the Q290I mutation as a template, segmental PCR was performed using primer pairs BamHI-RT-F / L332P-R and L332P-F / XhoI-RT-R. The amplification system and procedure were the same as in the first round, obtaining two gene fragments containing the Q290I / L332P double mutation. Splicing PCR was then performed to obtain the full-length gene with the Q290I / L332P double mutation.

[0039] The third round of PCR (introducing the D338E mutation): Using the full-length gene with the Q290I / L332P double mutation as a template, the same segmented PCR + splice PCR strategy as described above was adopted, using primer pairs BamHI-RT-F / D338E-R and D338E-F / XhoI-RT-R, to finally obtain the PCR product of the full-length gene of the MLV RT mutant containing the Q290I / L332P / D338E triple mutation.

[0040] 3. Connection and Transformation: Enzyme digestion: The PCR product of the full-length gene of the MLV RT mutant containing the Q290I / L332P / D338E triple mutation was double-digested with BamHI (10 U / μL) and XhoHI (10 U / μL), respectively. The digestion system (50 μL) consisted of 30 μL of PCR product or pET-21a empty vector, 5 μL of 10× digestion buffer, 1 μL of each enzyme, and 13 μL of ddH2O. The mixture was incubated at 37°C for 1 hour. The digested products were separated by 1% agarose gel electrophoresis and recovered using a DNA gel recovery kit (purchased from TransGen Biotech, catalog number EE101-01). The elution volume was 30 μL, and the concentration was ≥50 ng / μL as determined by Nanodrop. Finally, the digested PCR product and linearized pET-21a vector were recovered.

[0041] Ligation reaction: Mix the enzyme-digested PCR product and linearized pET-21a vector at a molar ratio of 3:1, add T4 DNA ligase (5U / μL), and the ligation system (20μL) is as follows: 2μL linearized pET-21a vector, 6μL enzyme-digested PCR product, 2μL 10×T4 ligation buffer, 1μL T4 DNA ligase, and 9μL ddH2O. Incubate at 25℃ for 10 minutes to complete the ligation and obtain the ligated product.

[0042] Transformation and screening: All ligation products were added to 50 μL of *E. coli* DH5α competent cells (purchased from TransGen Biotech, catalog number CD201-01), incubated on ice for 30 minutes, heat-shocked at 42°C for 90 seconds, immediately incubated on ice for 2 minutes, and then added to 800 μL of antibiotic-free LB medium. The cells were incubated at 37°C and 220 rpm for 1 hour. 200 μL of the recovery solution was spread onto LB agar plates containing 50 μg / mL ampicillin and incubated upside down at 37°C for 12 hours. 3-5 single colonies were picked and inoculated into 5 mL of LB medium containing ampicillin and incubated at 37°C and 220 rpm for 8 hours.

[0043] 4. Plasmid purification and validation Plasmids were extracted using a plasmid miniprep kit (TransGen Biotech, catalog number EP101-01). The plasmid size (target plasmid approximately 7.4 kb) was initially verified by 1% agarose gel electrophoresis. Subsequently, the plasmids were sent to Sangon Biotech (Shanghai) Co., Ltd. for bidirectional sequencing (sequencing primers were T7 promoter primers and T7 terminator primers). The sequencing results were compared with the wild-type MLV RT gene sequence using DNAMAN software to ensure that the mutations at the three sites Q290I, L332P, and D338E were correctly introduced, and that there were no other base mutations, deletions, or insertions. This yielded the recombinant vector pET-21a-MLVRTTS24 (i.e., the polynucleotide encoding the MLV RT mutant, as shown in SEQ ID NO.2, was inserted between the BamHI and XhoI restriction sites of the pET-21a plasmid, while keeping the other sequences of pET-21a unchanged).

[0044] 5. Protein expression Transformation of competent cells: Take 1 μL of the recombinant vector pET-21a-MLVRTTS4, which has been verified by sequencing, and add 50 μL of E. coli BL21(DE3) competent cells (purchased from TransGen Biotech, catalog number CD601-01). Incubate on ice for 30 minutes, heat shock at 42°C for 45 seconds, immediately incubate on ice for 2 minutes, add 800 μL of antibiotic-free LB medium, and recover at 37°C and 220 rpm for 30 minutes. Take 100 μL and spread it on an LB agar plate containing 50 μg / mL ampicillin, and incubate at 37°C overnight.

[0045] Seed culture: Pick a single colony and inoculate it into 5 mL of LB medium (containing 50 μg / mL ampicillin), and incubate at 37℃ and 220 rpm until OD600 = 0.6-0.8 (about 6 hours) to obtain the seed culture.

[0046] Expanded culture and induced expression: The seed culture was transferred to 1L LB medium (containing 50μg / mL ampicillin) at a ratio of 1:100 and cultured at 37℃ and 220rpm until OD600=0.6-0.8 (about 3 hours). IPTG was added to a final concentration of 0.5mM, the temperature was adjusted to 25℃ and the rotation speed was 180rpm, and expression was induced for 16 hours.

[0047] 6. Protein purification (two-step purification method) Cell collection and disruption: Cells were collected by centrifugation at 8000 rpm for 10 minutes at 4°C. The cells were resuspended in 50 mL of equilibration buffer (20 mM Tris-HCl, 500 mM NaCl, 20 mM imidazole, pH 8.0), and the protease inhibitor PMSF was added to a final concentration of 1 mM. Cell disruption was performed using a JY92-IIN ultrasonic cell disruptor (Ningbo Xinzhi). The parameters were set as follows: power 300 W, 3 seconds on, 5 seconds off, total duration 20 minutes. The sample was kept on ice during disruption. After disruption, the cells were centrifuged at 12000 rpm for 30 minutes at 4°C. The supernatant was collected and filtered through a 0.45 μm filter to remove impurities.

[0048] Ni-NTA affinity chromatography: Load the filtered supernatant onto a Ni-NTA affinity chromatography column (5 mL, purchased from TransGen Biotech, catalog number CR100-01) pre-equilibrated with 3 column volumes of equilibration buffer, at a flow rate of 1 mL / min. After loading, wash with 5 column volumes of equilibration buffer to remove contaminating proteins, then elute with equilibration buffer containing 100 mM imidazole to remove some weakly bound contaminating proteins, and finally elute with equilibration buffer containing 500 mM imidazole. Collect the elution peaks at 1 mL / tube and determine the protein concentration using a UV spectrophotometer (280 nm). Combine the eluates with a protein concentration ≥ 0.5 mg / mL.

[0049] Dialysis and ion exchange chromatography: The combined eluent was loaded onto a Q Sepharose Fast Flow ion exchange chromatography column (5 mL, GE Healthcare) pre-equilibrated with 3 column volumes of dialysis buffer. A linear gradient elution was performed using dialysis buffer containing 100 mM-1 M NaCl (elution volume 20 times column volume, flow rate 1 mL / min). The main peak was collected, and protein purity was verified by SDS-PAGE electrophoresis (12% separating gel, 5% stacking gel). Fractions with a purity ≥95% were collected. The collected protein solution was transferred to a dialysis bag with a molecular weight cutoff of 10 kDa and dialyzed overnight at 4°C in dialysis buffer (50 mM Tris-HCl, 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT, pH 7.5, 50% glycerol), with the dialysis buffer changed twice during the process.

[0050] Protein preservation: Aliquot the dialyzed protein into 1.5mL centrifuge tubes and store at -80℃ for later use. SDS-PAGE gel assay results are as follows. Figure 1As shown in the figure, the protein sample obtained in this embodiment is 75 kDa, which is consistent with the expected size of the MLV RT mutant, indicating that the protein sample finally obtained in this embodiment is the MLV RT mutant (named MLV RT mutant TS24, abbreviated as RT TS24).

[0051] Example 2 Performance Verification Method for Mutants I. Heat resistance verification (enzyme activity residue test) 1. Enzyme treatment Wild-type MLV RT and mutant MLV RT were diluted to 1 μg / μL, and 10 μL of each was aliquoted into PCR tubes. The tubes were incubated in metal baths at 45℃, 55℃, and 65℃ for 0, 10, 20, and 30 minutes, respectively. Two replicates were set up for each temperature and time point. After incubation, the tubes were immediately cooled in an ice bath for 10 minutes to obtain the processed enzyme solution.

[0052] 2. Reverse transcription reaction Reaction system (20 μL): 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 0.5 mM dNTP, 0.5 μg poly (A) template (1 kb in length, purchased from Sigma), 0.2 μg oligo (dT) 18 Primers, 1 μL of treated enzyme solution.

[0053] Reverse transcription procedure: react at 42℃ for 30 minutes, add 1 μL RNase H (1 U / μL) and treat at 37℃ for 15 minutes to remove residual RNA template and obtain cDNA.

[0054] 3. PCR Amplification and Detection Using cDNA as a template, a 500bp fragment was amplified. The PCR system (20μL) consisted of: 2μL cDNA, 0.5μL each of forward and reverse primers (10μM concentration), 10μL 2×Taq PCR Master Mix, and 7μL ddH2O. The amplification program was: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, and 72℃ extension for 30 seconds, for a total of 30 cycles; and a final extension at 72℃ for 10 minutes. The amplified products were detected by 1.5% agarose gel electrophoresis, and the band gray values ​​were analyzed using ImageJ software. The residual enzyme activity was calculated as (residual activity / initial activity × 100%), where the initial activity was the enzyme activity at 0 minutes of incubation.

[0055] The results are as follows Figure 2As shown, the mutant MLV RT (represented as "RT TS24" in the figure) retained more than 85% of its enzyme activity after incubation at 45℃ for 30 minutes, 70% after incubation at 55℃ for 30 minutes, and 62% after incubation at 65℃ for 30 minutes; while the wild-type MLV RT (represented as "WT RT" in the figure) had enzyme activity retention rates of only 45%, 20%, and 5% under the same conditions, respectively. The heat resistance of the mutant MLV RT was improved by 2-3 times.

[0056] II. Verification of Reverse Transcription Activity 1. Reverse transcription reaction Wild-type MLV RT and mutant MLV RT (concentration 1 μg / μL) were reverse transcribed using poly(A)-oligo(dT) as templates at three temperatures: 45℃, 55℃, and 65℃. Two parallel replicates were set up for each temperature, and other conditions were the same as the reverse transcription reaction steps in the heat resistance verification.

[0057] 2. Product Quantitative Detection: cDNA yield was detected by PCR.

[0058] PCR system (20 μL): 0.5 μL each of forward and reverse primers (10 μM concentration), 10 μL of 2×Taq PCR Super Mix (purchased from TransGen Biotech, catalog number AS111-11), and 7 μL of ddH2O.

[0059] Amplification program: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for a total of 30 cycles; final extension at 72℃ for 10 minutes. The amplified products were detected by 1.5% agarose gel electrophoresis, and the band gray values ​​were analyzed using ImageJ software to calculate the residual enzyme activity (residual activity / initial activity × 100%). The initial activity was the enzyme activity at 0 minutes of incubation.

[0060] The results are as follows Figure 3 As shown, using poly(A)-oligo(dT) as a template, PCR amplification and band grayscale analysis revealed that the relative yields of cDNA synthesized by the mutant MLV RT (represented as "RT TS24" in the figure) at reaction temperatures of 45℃, 55℃, and 65℃ were 1.5 times, 1.8 times, and 2.3 times that of the wild-type MLV RT (represented as "WT RT" in the figure) at the corresponding temperatures. With increasing reaction temperature, the product yield of the mutant significantly increased, reaching a peak at 65℃, confirming that its optimal reverse transcription temperature was 65℃. Meanwhile, the activity of the WT enzyme decreased significantly with increasing temperature, essentially becoming inactive at 65℃.

[0061] III. qRT-PCR Activity Verification 1. Template preparation Total RNA was extracted from human hepatocellular carcinoma cells HepG2 (using an RNA extraction kit purchased from Tiangen Biotech, catalog number DP430). RNA purity was detected by Nanodrop (A260 / A280 = 1.8-2.0), and RNA integrity was verified by agarose gel electrophoresis (clear 28S and 18S bands, no degradation). The RNA concentration was adjusted to 100 ng / μL.

[0062] 2. Reverse transcription reaction The reaction mixture (20 μL) consisted of 1 μL (100 ng) total RNA, 4 μL 5× reverse transcription buffer, 0.5 mM dNTPs, 10URNase inhibitor, 1 μL enzyme solution (wild-type MLV RT and mutant MLV RT, concentration 1 μg / μL), and ddH2O to a final volume of 20 μL. The mutant MLV RT was reacted at 65 °C, and the wild-type MLV RT at 42 °C for 30 minutes, followed by inactivation at 95 °C for 5 minutes.

[0063] qPCR detection: Using the β-actin gene as an internal control (primer sequences: forward 5'-AGCGAGCATCCCCCAAAGTT-3', reverse 5'-GGGCACGAAGGCTCATCATT-3'), the qPCR system consisted of a 20 μL standard reaction system. The core components included 10.0 μL of 2×SYBR Green qPCR Master Mix (containing enzyme, dNTPs, and fluorescent dye), 0.8 μL of 10 μM β-actin forward primer and 0.8 μL of 10 μM reverse primer (both with a final concentration of 0.4 μM). If required by the instrument, 0.4 μL of 50×ROX Reference Dye could be added to correct fluorescence fluctuations. Then, 4.0 μL of cDNA template diluted 1:5 was added, and finally, RNase-free enzyme-free water was added to bring the total volume to 20 μL. The system preparation should be carried out on ice. First, mix all components except the template according to the total required amount + 10% redundancy. After aliquoting, add the corresponding template, gently pipette and mix well, and briefly centrifuge to avoid bubble generation and loss of enzyme activity. Record the Ct value and calculate the amplification efficiency and relative expression level.

[0064] The results are as follows Figure 4As shown, the mutant MLV RT (represented as "RT TS24" in the figure) showed significantly higher reverse transcription efficiency for complex cellular total RNA templates at 65℃ than the wild-type MLV RT (represented as "WT RT" in the figure) at 42℃. Its cDNA yield increased by about 2.1 times, and its amplification curve was steeper with a lower Ct value, indicating that it has higher reverse transcription activity and stronger ability to break down complex secondary structure templates.

[0065] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is impossible to exhaustively list all the implementation methods here. All obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. A heat-resistant MLV reverse transcriptase mutant, characterized in that, The amino acid sequence of the MLV reverse transcriptase mutant is shown in SEQ ID NO.

1.

2. A polynucleotide encoding the MLV reverse transcriptase mutant of claim 1.

3. The polynucleotide according to claim 2, characterized in that, The polynucleotide is shown in SEQ ID NO.

2.

4. A recombinant vector comprising the polynucleotide of claim 2 or 3.

5. Recombinant cells comprising the polynucleotide of claim 1 or 2 or the recombinant vector of claim 4.

6. The method for preparing the MLV reverse transcriptase mutant according to claim 1, characterized in that, The preparation method includes the following steps: a1) Construct a recombinant vector containing the polynucleotide shown in SEQ ID NO.2; a2) Transform the recombinant vector into host cells, induce expression, and obtain bacterial cells; a3) The bacterial cells were broken, centrifuged, and the supernatant was obtained. The supernatant was then purified to obtain the MLV reverse transcriptase mutant.

7. The preparation method according to claim 6, characterized in that, The purification process includes nickel ion affinity chromatography and ion exchange chromatography.

8. The use of the MLV reverse transcriptase mutant of claim 1, and / or the polynucleotide of claim 2 or 3, and / or the recombinant vector of claim 4, and / or the recombinant cell of claim 5 in reverse transcription reactions.

9. The use of the MLV reverse transcriptase mutant of claim 1, and / or the polynucleotide of claim 2 or 3, and / or the recombinant vector of claim 4, and / or the recombinant cell of claim 5 in the preparation of products by reverse transcription reaction.

10. A reverse transcription kit, characterized in that, The kit includes the MLV reverse transcriptase mutant as described in claim 1.

Citation Information

Patent Citations

  • Connecting block for interconnecting wires and with two matable connector parts and slotted beam contacts

    EP0000434A1

  • M-MLV reverse transcriptase mutant and application thereof

    CN113355303A

  • Mutant recombinant reverse transcriptase as well as preparation method and application thereof

    CN118931870A

  • M-MLV reverse transcriptase mutant as well as preparation method and application thereof

    CN119709683A

  • Thermostable reverse transcriptase and application thereof

    CN119895035A