Molecular markers closely linked to wheat starch value major QTL-qWSd-4D and their applications

Abstract

This invention discloses a molecular marker tightly linked to the major QTL for wheat starch value, qWSd-4D, and its application, belonging to the fields of wheat molecular biotechnology and breeding technology. The molecular marker, WSD-ID-29.9, is tightly linked to the major QTL for wheat starch value located on wheat chromosome 4D, and its nucleotide sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4. It can be amplified using the primer pairs shown in SEQ ID NO: 1 and SEQ ID NO: 2. The molecular marker WSD-ID-29.9 provided by this invention fully reflects the major QTL for starch (dry basis) value in wheat varieties (lines), enabling rapid and accurate determination of whether wheat varieties (lines) contain the major QTL for starch (dry basis) value, providing excellent gene resources and selection tools for molecular breeding of wheat starch (dry basis) trait.

Description

Technical Field

[0001] This invention relates to a molecular marker and its application, specifically to a molecular marker closely linked to wheat starch value major QTL-qWSd-4D and its application in wheat-assisted breeding and genetic improvement, belonging to the field of wheat molecular biotechnology and breeding technology. Background Technology

[0002] Wheat is a vital staple crop worldwide, and its production is crucial for ensuring national food security. The functional properties of starch directly influence the nutritional value and processing quality of wheat. As the core component of wheat grains (accounting for 65-75% of dry weight), starch's content (straight / branched chain ratio) and structure (chain length distribution, crystallinity) synergistically regulate processing characteristics. Starch, through parameters such as gelatinization temperature and expansion potential, dominates the textural properties of flour products, such as the specific volume of steamed buns and the tensile strength of noodles. In the food industry, flour can be used to make steamed and boiled foods like steamed buns, noodles, and dumplings, as well as baked goods like biscuits, bread, and cakes, and fried foods like fried dough sticks and twisted dough sticks. Furthermore, wheat starch (dry basis) value has relatively high heritability. Identifying superior alleles controlling wheat starch (dry basis) value and developing closely linked molecular markers can provide excellent genetic resources and selection tools for molecular breeding genetic improvement of wheat quality traits.

[0003] Wheat starch (dry basis) value is a quantitative trait controlled by multiple genes, with a relatively complex genetic basis and is influenced by the environment, making it difficult to elucidate its genetic mechanisms using traditional research methods. With the development of molecular biology and biostatistics, quantitative trait loci (QTL) mapping techniques based on molecular marker genetic maps and various statistical models have provided effective means to study the genetic basis of quantitative traits. QTLs can be used to detect the location of target traits on chromosomes, their effects, and their interactions with other genes. Therefore, continuously enriching the diversity of wheat starch (dry basis) value genes and studying and developing wheat starch (dry basis) value-related genes through molecular marker technology is of paramount importance in breeding work.

[0004] Wu Yunpeng et al. used recombinant inbred lines resulting from a cross between wheat variety PH82-2 and Neixiang 188 as experimental materials to perform quantitative trait locus mapping for wheat starch viscosity, ultimately detecting 4 QTLs related to peak starch viscosity and 5 QTLs related to starch disintegration value. Sun et al. performed QTL mapping for rapid viscosity analyzer parameters of wheat starch, ultimately detecting related QTLs on chromosomes 3D, 6B, and 7B. Zhang et al. used RIL populations to perform QTL mapping for wheat starch gelatinization characteristics, detecting loci related to peak starch viscosity on chromosomes 1A, 5B, and 5D; loci related to final starch viscosity on chromosomes 1B, 5B, 5D, 6B, and 7A; and loci related to retrogradation value (the difference between final and trough starch viscosity) on chromosomes 1B, 4B, and 5D.

[0005] However, there are still relatively few reports on starch (dry basis) value QTLs on chromosome 4D. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker closely linked to the major QTL-qWSd-4D of wheat starch (dry basis) value and its application. By obtaining the molecular marker closely linked to the major QTL of wheat starch (dry basis) value, it is possible to detect whether wheat varieties (lines) contain QTL sites that increase wheat starch (dry basis) value, so as to accelerate the breeding process of high-quality new wheat varieties.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The application of a molecular marker tightly linked to a major QTL for wheat starch value in identifying the wheat starch value trait, wherein the molecular marker is WSD-ID-29.9, tightly linked to the major QTL for wheat starch value located on wheat chromosome 4D, and the nucleotide sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4, and can be amplified by the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO: 2, both of which are single-stranded DNA molecules.

[0009] The application of a molecular marker tightly linked to a major QTL for wheat starch value in the breeding of wheat containing alleles that increase wheat starch value, wherein the molecular marker is WSD-ID-29.9, tightly linked to a major QTL for wheat starch value located on wheat chromosome 4D, and the nucleotide sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4, and can be amplified by the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO: 2, wherein both the upstream and downstream primers are single-stranded DNA molecules.

[0010] The advantages of this invention are:

[0011] (1) The molecular marker WSD-ID-29.9 developed in this invention fully reflects the major QTL-qWSd-4D of starch (dry basis) value of wheat varieties (lines). Using the genomic DNA of the wheat varieties (lines) to be tested as a template, the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO: 2 are used to perform PCR amplification on the wheat varieties (lines). This can quickly and accurately determine whether wheat varieties (lines) contain the major QTL of starch (dry basis) value, providing excellent gene resources and selection tools for molecular breeding of wheat starch (dry basis) value traits.

[0012] (2) The molecular marker WSD-ID-29.9, which is closely linked to the major QTL-qWSd-4D of wheat starch (dry basis) value developed in this invention, can be used for wheat molecular breeding, which can greatly reduce the work of phenotypic identification, save breeding costs, improve breeding efficiency, and open up more new genetic resources for starch (dry basis) value traits in wheat breeding. Attached Figure Description

[0013] Figure 1 This figure shows the confidence interval of the major-effect QTL-qWSd-4D for wheat starch (dry basis) values ​​on chromosome 4D. The hollow rectangles represent chromosomes, the markers on the left side of the chromosome indicate the genetic location of the molecular markers on the chromosome (in cM), and the markers on the right side of the chromosome indicate the names of the molecular markers. There are two types of molecular markers in the figure: WSD-ID-29.9 is an InDel marker, and the rest are SNP markers. The black rectangles on the right side of the chromosome represent the QTL confidence intervals for starch (dry basis) values ​​under various environmental conditions.

[0014] Figure 2 This is a graph showing the PCR amplification results of molecular marker WSD-ID-29.9 in some families of the RIL population. In the graph, M represents a 2000bp DNA Marker, YN15 represents the amplification result of wheat variety Yannong 15, YN1212 represents the amplification result of wheat variety Yannong 1212, and numbers 1-22 represent the amplification results of some families of the RIL population.

[0015] Figure 3 This is a single-marker analysis result of starch (dry basis) values ​​of 188 families of RIL populations under different environments based on the molecular marker WSD-ID-29.9. In the figure, the black bars are alleles from Yannong 15, the white bars are alleles from Yannong 1212, *** indicates extremely significant difference (P<0.001), ** indicates very significant difference (P<0.01), * indicates significant difference (P<0.05), and ns indicates no significant difference. Detailed Implementation

[0016] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0017] I. Obtaining RIL Group

[0018] YN15 (Yannong 15): Approved variety, approval number is Guoshenmai 1991001.

[0019] YN1212 (Yannong 1212): Approved variety, approval number is National Approval Wheat 20180023.

[0020] Using Yannong 1212, a wheat variety with a high starch (dry basis) value, as the female parent and Yannong 15, a wheat variety with a low starch (dry basis) value, as the male parent, hybrid F1 was obtained. F1 was self-pollinated to obtain F2. F2 was self-pollinated generation by generation to form the F6 generation RIL population containing 188 families.

[0021] II. Field planting and phenotypic identification of RIL populations under different experimental environments.

[0022] The RIL population was field-planted and phenotypically identified in seven experimental environments, and the starch (dry basis) values ​​of each strain were examined in different years and locations.

[0023] E1: 2022-2023, Laishan Bathing Village.

[0024] E2: 2022-2023, Yantai Academy of Agricultural Sciences.

[0025] E3: 2022-2023, Boxing County, Binzhou.

[0026] E4: 2023-2024, Hengshui, Hebei.

[0027] E5: 2023-2024, Yantai Academy of Agricultural Sciences.

[0028] E6: 2023-2024, Yantai Pulagu.

[0029] E7: 2023-2024, Boxing County, Binzhou.

[0030] Wheat planting method: Plant 2 rows per family, sow 15 seeds per row; row length 1.5m, row spacing 25cm, normal growth and harvest.

[0031] Method for determining wheat starch (dry basis) value: The quality index of wheat starch (dry basis) value was determined using an INFRATEC NOVA near-infrared grain analyzer. Specifically, the near-infrared grain analyzer was first turned on and preheated for 30 minutes. After preheating, wheat seeds were poured into the test tray, compacted and leveled with a scraper, and placed on the sample stage of the instrument for scanning.

[0032] III. Initial localization of wheat starch (dry basis) QTL values ​​on wheat chromosomes

[0033] High-density genetic linkage maps of 188 families in the RIL population were constructed using JOINMAP 2.0 software. Starch (dry basis) values ​​directly obtained from seven experimental environments were processed according to the BIP module format requirements of IciMapping v4.1, and then additive QTL mapping was performed. 1000 permutation tests were conducted in 1 Mb increments to detect the LOD peak value under different environments and determine the LOD threshold.

[0034] QTL analysis was performed using a high-density genetic linkage map of 188 families in the RIL population and starch (dry basis) values ​​from 7 environmental sources. A major-effect QTL controlling starch (dry basis) values, qWSd-4D, was detected in the wheat 4D chromosome segment from AX-109951021 to AX-110015970 (genetic location: 35.5-46.2 cM). (Table 1) Figure 1 It can be stably detected in 5 environments (E1, E2, E3, E4, E6), with LOD values ​​of 3.95-12.94, explaining 5.80-22.56% of the phenotypic variation in starch (dry basis) value. The starch (dry basis) value is increased by 0.09-0.98% from the tobacco farmer 1212 allele.

[0035] Table 1. QTL results of starch (dry basis) values ​​in 5 environments based on 188 families.

[0036]

[0037] IV. Discovering molecular markers closely linked to major QTLs of wheat starch (dry basis) and designing specific primers.

[0038] Based on the alignment results of the resequencing data of Yannong 15 and Yannong 1212 genomes, an InDel marker (WSD-ID-29.9, SEQ ID NO: 3 or SEQ ID NO: 4) was designed in the AX-109951021 to AX-110015970 region (genetic location: 35.5-46.2 cM) of wheat chromosome 4D. Its location within the target region is as follows: Figure 1 As shown.

[0039] Based on the molecular marker WSD-ID-29.9, corresponding specific primer pairs were designed. The sequences of the designed specific primer pairs are as follows:

[0040] Upstream primer WSD-ID-29.9-F: AGAGCACACCTCAGACCAA (SEQ ID NO: 1);

[0041] Downstream primer WSD-ID-29.9-R: CTCAGTTTTTAATAAGACCCCGC (SEQ ID NO: 2).

[0042] V. Genotypic analysis of the RIL population

[0043] 1. DNA was extracted from each line of the RIL population using a modified CTAB method.

[0044] The specific method for extracting DNA from each line of the RIL population using the modified CTAB (hexadecyltrimethylammonium bromide) method is as follows:

[0045] (1) Take a steel ball and 0.2g of fresh wheat leaves and put them into a 2.0mL centrifuge tube. Then quickly put the centrifuge tube into liquid nitrogen and shake the centrifuge tube to grind the wheat leaves into fine powder.

[0046] (2) Continue to add 0.8 mL of CTAB extraction solution to the centrifuge tube, shake well, and incubate in a 65°C water bath for 60 min, inverting the tube 4 times during the process.

[0047] (3) Place the centrifuge tube at room temperature to cool, add an equal volume of chloroform-isoamyl alcohol (volume ratio 24:1), shake vigorously for 1 min to mix, and centrifuge at 8000 rpm for 10 min.

[0048] (4) Transfer 600 μL of supernatant to another 1.5 mL centrifuge tube, add 0.8 times the volume of pre-cooled isopropanol (pre-cooled at -20°C) to precipitate DNA, and centrifuge at 12000 rpm for 6 min;

[0049] (5) Discard the supernatant, add an appropriate amount of 70% ethanol to wash the precipitate twice, place the centrifuge tube at an angle in a fume hood to dry, and after there is no alcohol smell, add 400 μL TE to dissolve it, and store it in a -20℃ refrigerator for a long time.

[0050] 2. Genotyping analysis of the RIL population was performed using the InDel marker WSD-ID-29.9.

[0051] (1) PCR amplification of DNA from the RIL population

[0052] Leaf DNA from the RIL population was amplified by PCR using specific primer pairs WSD-ID-29.9-F / R (SEQ ID NO: 1, SEQ ID NO: 2) for the molecular marker WSD-ID-29.9.

[0053] The PCR amplification system is 10 μL, specifically consisting of: 1 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 5 μL 2×Taq PCR premixed reagent, and 2 μL ddH2O.

[0054] The PCR amplification program used a standard procedure, specifically: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, repeated 34 times; 72℃ extension for 5 min; amplification ended, and the sample was stored at 12℃.

[0055] (2) Electrophoresis of PCR amplification products

[0056] The PCR amplification products were subjected to electrophoresis on a 6.0% non-denaturing polyacrylamide gel (preparation method: dissolve 5.85g acrylamide and 0.15g methylene acrylamide in 100mL distilled water) with 1×TBE as the electrophoresis buffer and electrophoresis at a constant voltage of 140V for 2h20min.

[0057] PCR amplification results of some families in the RIL population are shown below. Figure 2 .

[0058] (3) Analyze the electrophoresis results

[0059] The amplified fragment size of wheat variety Yannong 15 (which does not contain alleles that increase wheat starch (dry basis) value) is 480 bp (SEQ ID NO: 3), and the amplified fragment size of wheat variety Yannong 1212 (which contains alleles that increase wheat starch (dry basis) value) is 469 bp (SEQ ID NO: 4). Among the 188 families in the RIL population, 90 families had the same banding pattern as Yannong 15 (none of which contained alleles that increase wheat starch (dry basis) value), 83 families had the same banding pattern as Yannong 1212 (all of which contained alleles that increase wheat starch (dry basis) value), 15 families were heterozygous, and 0 families had deletions.

[0060] VI. Analysis of QTL under different environments - Starch (dry basis) effect of qWSd-4D

[0061] Using the linkage between the molecular marker WSD-ID-29.9 and the QTL-qWSd-4D, and based on the genotyping results of 188 families in the RIL population using the molecular marker WSD-ID-29.9, the starch (dry basis) effect of QTL-qWSd-4D under different environmental conditions was analyzed. The differences in starch (dry basis) values ​​among the 188 families in the RIL population were analyzed using SPSS 25.0 for significance.

[0062] Single-marker analysis results based on starch (dry basis) values ​​of molecular marker WSD-ID-29.9 for 188 families in 7 environments are shown in Table 2 and [Table 2 is missing from the original text]. Figure 3 .

[0063] Table 2. Starch (dry basis) values ​​of various lines in the RIL population.

[0064]

[0065] The results showed that, compared with the starch (dry basis) value reduction effect of the allele from Yannong 15, the starch (dry basis) value of the allele from Yannong 1212 was increased (by 0.121-1.527%), and this result could be replicated in multiple environments.

[0066] QTL analysis revealed that the major-effect QTL qWSd-4D, which stably expresses starch (dry basis) values ​​across multiple environments, was detected in the 4D chromosome segment of IciMapping 4.1. The LOD peak occurred in the range of 35.5-46.2 cM (corresponding to the physical location of Chinese Spring 2.0 as 17.40-33.04 Mb) from AX-109951021 to AX-110015970 on chromosome 4D, with LOD values ​​of 3.95-12.94. This LOD value could explain 5.80-22.56% of the starch (dry basis) value phenotypic variation. Alleles from Yannong 1212 increased starch (dry basis) values ​​by 0.09-0.98%.

[0067] The above results demonstrate that the molecular marker WSD-ID-29.9 is a molecular marker closely linked to wheat starch (dry basis) value, and this molecular marker can be effectively applied to the molecular marker-assisted selection breeding program for wheat starch (dry basis) value.

[0068] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.

Claims

1. The application of a molecular marker closely linked to a major QTL for wheat starch value in the identification of wheat starch value traits, characterized in that, The molecular marker, WSD-ID-29.9, is tightly linked to the major QTL for wheat starch value located on wheat chromosome 4D, and its nucleotide sequence is shown in SEQ ID NO: 3 or SEQ ID NO:

4. The application involves using the genomic DNA of the wheat sample as a template, and performing PCR amplification on the wheat genomic DNA using the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO:

2. If the genomic DNA contains wheat with the sequence shown in SEQ ID NO: 4, it is identified as containing an allele that increases wheat starch value; if the genomic DNA contains wheat with the sequence shown in SEQ ID NO: 3, it is identified as not containing an allele that increases wheat starch value.

2. The application of a molecular marker tightly linked to a major QTL for wheat starch value in the breeding of wheat containing alleles that increase wheat starch value, characterized in that, The molecular marker is WSD-ID-29.9, which is closely linked to the major QTL for wheat starch value located on wheat chromosome 4D, and its nucleotide sequence is shown in SEQ ID NO: 3 or SEQ ID NO:

4. The application involves using the genomic DNA of the wheat to be tested as a template, and amplifying it with the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO:

2. Wheat whose genomic DNA contains the sequence shown in SEQ ID NO: 4 is selected, which is wheat containing alleles that increase wheat starch value.

Images