SNP (Single Nucleotide Polymorphism) molecular marker related to early maturing character of chicken and application of SNP molecular marker in breeding
By detecting eight SNP sites in the chicken CHADL gene and utilizing SNP molecular markers and mass spectrometry array technology, the problems of long cycle and high cost of conventional genotyping identification technology have been solved, enabling rapid screening and breeding improvement of the precocious trait in chickens and improving breeding efficiency.
Patent Information
- Application Number
- CN202610020299.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-08
- Publication Date
- 2026-04-21
AI Technical Summary
In existing technologies, conventional genotyping techniques have long operation cycles and high costs, making it difficult to meet the needs of modern breeding for rapid screening of large numbers of samples, especially in the application of CHADL genes related to comb development and sexual maturity.
To develop a molecular marker based on single nucleotide polymorphisms (SNPs) in the chicken CHADL gene, specific primer pairs were designed to amplify the eight SNP sites in the chicken CHADL gene, and mass spectrometry array technology was used to rapidly identify the SNP sites, thereby enabling rapid screening and breeding guidance for the precocious trait in chickens.
By detecting eight SNP sites in the chicken CHADL gene, we can quickly identify the precocious puberty performance of chickens, significantly improve breeding efficiency, and achieve significant improvements in comb height, length, and thickness, meeting the needs of modern breeding for rapid screening of large batches of samples.
Smart Images

Figure CN121896362A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker technology, and more specifically, to an SNP molecular marker associated with the precocious puberty trait in chickens and its application in breeding. Background Technology
[0002] Sexual maturity determines the market price of broiler chickens. The closer a chicken is to sexual maturity, the more fat it deposits, resulting in more delicious meat and a richer flavor. Although the sexual maturity of chickens is affected by feeding conditions such as light, temperature, humidity, ventilation, and feed nutrition, it is mainly related to genetics, and therefore it is receiving increasing attention in the breeding of high-quality chickens.
[0003] The development of the comb is the most obvious and important secondary sexual characteristic in chickens, and can be used as an indicator of sexual maturity. Currently, there is limited research on the growth, development, and genetic patterns of high-quality comb height and length in chickens, and their developmental mechanisms are not yet fully understood.
[0004] The rooster comb, a derivative of the skin on a chicken's head, is not only an important physical characteristic but also a key indicator of sexual maturity. As one of the secondary sexual characteristics of chickens, the development of the comb is closely related to sexual maturity. Studies have shown that comb development is closely related to various factors such as sex hormone levels, genetic background, and light exposure. In recent years, with the development of molecular biology techniques, several candidate genes related to comb development have been identified, among which... CHADL ( Chondroadherin-like Genes have attracted much attention due to their role in cartilage differentiation and extracellular matrix regulation. CHADL The gene encodes a small extracellular matrix protein rich in leucine, belonging to the chondroitin family. This protein regulates collagen fiber formation by binding to collagen, thereby affecting the structure and function of cartilage tissue. In chicken comb tissue, CHADL Changes in gene expression levels are closely related to the morphological development of chicken combs. Liu et al. compared the transcriptomes of large-combed and small-combed chickens using RNA-seq technology and found... CHADL The gene expression was significantly upregulated in the large comb group, suggesting that it may promote comb development. Further qPCR validation also confirmed the differential expression of this gene in different comb types. Wang Kun et al.'s study on the comb tissues of roosters of different ages found that... CHADL Gene expression levels gradually increase with age, peaking at full sexual maturity (26 weeks of age), indicating that... CHADL Genes play a positive regulatory role in the continuous development of the chicken comb. Cao Ting et al. analyzed the comb tissues of Danzhou chickens with different comb types and at different ages using Western blotting. CHADL Protein expression. Results showed that, despite differences in age and coronary type... CHADL While protein expression showed no significant difference, its expression trend was consistent with mRNA levels, exhibiting an upward trend, further supporting this finding. CHADL The role of genes in promoting comb development in chickens. CHADL Genes and BMP2 The synergistic / antagonistic effects of genes further refine the regulation of the comb development process.
[0005] However, directly CHADL The use of genes in breeding presents the following problems: Conventional genotyping techniques have limitations such as long operation cycles and high costs, making it difficult to meet the needs of modern breeding for rapid screening of large numbers of samples.
[0006] To address this technical bottleneck, establishing a molecular marker system based on single nucleotide polymorphisms (SNPs) is of great significance.
[0007] Based on this, the present invention provides an SNP molecular marker related to the precocious puberty trait in chickens, which has important practical significance. Summary of the Invention
[0008] In view of this, the present invention proposes a SNP molecular marker related to early maturity in chickens and its application in breeding, aiming to solve the technical problems mentioned in the background art.
[0009] This invention proposes a SNP molecular marker associated with the precocious puberty trait in chickens, wherein the SNP molecular marker is a chicken CHADL Single nucleotide polymorphism sites in genes, the CHADL The gene sequence is shown in SEQ ID NO:1.
[0010] Furthermore, chicken CHADL Single nucleotide polymorphism sites in genes include: site 1, site 2, site 3, site 4, site 5, site 6, site 7, and site 8.
[0011] Furthermore, locus 1 is located at position g.49793685 on chromosome 1 of the whole genome (reference genome: bGalGal1.mat.broiler.GRCg7b); locus 2 is located at position g.49793806 on chromosome 1 of the whole genome; locus 3 is located at position g.49794002 on chromosome 1 of the whole genome; locus 4 is located at position g.49794431 on chromosome 1 of the whole genome; locus 5 is located at position g.49794441 on chromosome 1 of the whole genome; locus 6 is located at position g.49795003 on chromosome 1 of the whole genome; locus 7 is located at position g.49797766 on chromosome 1 of the whole genome; and locus 8 is located at position g.49798159 on chromosome 1 of the whole genome.
[0012] Furthermore, the base variation at site 1 is C / A, and the genotypes include CC, CA, and AA; the base variation at site 2 is C / T, and the genotypes include CC, TC, and TT; the base variation at site 3 is C / T, and the genotypes include CC, CT, and TT; the base variation at site 4 is C / T, and the genotypes include CC, CT, and TT; the base variation at site 5 is A / G, and the genotypes include AA, GA, and GG; the base variation at site 6 is C / T, and the genotypes include CC, TC, and TT; the base variation at site 7 is A / G, and the genotypes include AA, AG, and GG; and the base variation at site 8 is T / G, and the genotypes include TT, GT, and GG.
[0013] Furthermore, the dominant genotype at locus 1 is AA; the dominant genotype at locus 2 is CC; the dominant genotype at locus 3 is TT; the dominant genotype at locus 4 is CC; the dominant genotype at locus 5 is GG; the dominant genotype at locus 6 is CC; there is no dominant genotype at locus 7; and the dominant genotype at locus 8 is TT.
[0014] The present invention also provides a primer pair for amplifying the SNP molecular markers associated with the precocious puberty trait in chickens.
[0015] Furthermore, the primer pair sequences for amplifying the SNP molecular marker containing site 1 are shown in SEQ ID NO:2 and SEQ ID NO:3; The primer pair sequences for amplifying the SNP molecular marker containing site 2 are shown in SEQ ID NO:4 and SEQ ID NO:5; The primer pair sequences for amplifying the SNP molecular marker containing site 3 are shown in SEQ ID NO:6 and SEQ ID NO:7; The primer pair sequences for amplifying the SNP molecular marker containing site 4 are shown in SEQ ID NO:8 and SEQ ID NO:9; The primer pair sequences for amplifying the SNP molecular marker containing site 5 are shown in SEQ ID NO:10 and SEQ ID NO:11; The primer pair sequences for amplifying the SNP molecular marker containing site 6 are shown in SEQ ID NO:12 and SEQ ID NO:13; The primer pair sequences for amplifying the SNP molecular marker containing site 7 are shown in SEQ ID NO:14 and SEQ ID NO:15; The primer pair sequences for amplifying the SNP molecular marker containing site 8 are shown in SEQ ID NO:16 and SEQ ID NO:17.
[0016] The present invention also provides a detection reagent for detecting SNP molecular markers, the detection reagent comprising primer pairs for amplifying the SNP molecular markers associated with the precocious puberty trait in chickens.
[0017] The present invention also provides an application of the SNP molecular marker or the detection reagent in breeding.
[0018] Furthermore, the applications include: (1) Prediction of precocious puberty traits in chickens; (2) Screening or identifying chicken breeds, wherein the chicken breeds have the characteristic of early maturity; (3) Selection and breeding of chickens with early maturity traits; (4) Marker-assisted breeding related to precocious puberty in chickens; (5) Breed improvement related to the early maturity trait of chickens.
[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention utilizes chickens CHADL Single nucleotide polymorphism (SNP) site analysis of the gene revealed CHADLThe eight SNP loci of the gene are g.49793685C>A, g.49793806C>T, g.49794002C>T, g.49794431C>T, g.49794441A>G, g.49795003C>T, g.49797766A>G, and g.49798159T>G. Individuals with the AA genotype (supposedly located at position 49793685 bp on chromosome 1) had significantly higher crown height, crown length, and crown thickness than individuals with the CC and CA genotypes (P<0.05). The crown height, crown length, and crown thickness of individuals with the SNP locus g.49793806C>T (located at position 49793806 bp on chromosome 1) were significantly higher than those with the TT and TC genotypes (P<0.05). Similarly, the crown height, crown length, and crown thickness of individuals with the SNP locus g.49794002C>T (located at position 49794002 bp on chromosome 1) were significantly higher than those with the CC and CT genotypes (P<0.05). Finally, the crown height, crown length, and crown thickness of individuals with the SNP locus g.49794431C>T (located at position 49794431 bp on chromosome 1) were significantly higher than those with the TT and CT genotypes (P<0.05). The crown height, crown length, and crown thickness of individuals with the SNP locus g.49794441A>G (located at position 49794441 bp on chromosome 1) GG genotype were significantly higher than those with the AA and GA genotypes (P<0.05). The crown height, crown length, and crown thickness of individuals with the SNP locus g.49795003C>T (located at position 49795003 bp on chromosome 1) CC genotype were significantly higher than those with the TT and TC genotypes (P<0.05). There were no significant differences in crown height, crown length, and crown thickness among individuals with the SNP locus g.49797766A>G (located at position 49797766 bp on chromosome 1) AA, GG, and AG genotypes (P>0.05). The SNP locus g.49798159T>G (located at position 49798159 bp on chromosome 1 of the whole genome) showed that individuals with the TT genotype had significantly higher crown height, crown length, and crown thickness than individuals with the GG and GT genotypes (P<0.05). The SNP locus described in this invention can be used to rapidly identify precocious puberty performance in chickens. Attached Figure Description
[0020] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Furthermore, the same reference numerals denote the same parts throughout the drawings. In the drawings: Figure 1Provided for embodiments of the present invention CHADL Sanger sequence mapping of 8 SNP sites in a gene; Figure 2 This is the mass spectrometry genotype of the g.49793685 site provided in this embodiment of the invention; Figure 3 This is the mass spectrometry genotype of the g.49793806 site provided in this embodiment of the invention; Figure 4 This is the mass spectrometry genotype of the g.49794002 site provided in this embodiment of the invention; Figure 5 This is the mass spectrometry genotype of the g.49794431 site provided in this embodiment of the invention; Figure 6 This is the mass spectrometry genotype of the g.49794441 site provided in this embodiment of the invention; Figure 7 This is the mass spectrometry genotype of the g.49795003 site provided in this embodiment of the invention; Figure 8 This is the mass spectrometry genotype of the g.49797766 site provided in this embodiment of the invention.
[0021] Figure 9 This is the mass spectrometry genotype of the g.49798159 site provided in this embodiment of the invention. Detailed Implementation
[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention. It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the present invention.
[0023] Furthermore, regarding the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0024] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0025] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0026] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0027] This invention proposes a SNP molecular marker associated with the precocious puberty trait in chickens, wherein the SNP molecular marker is a chicken CHADL Single nucleotide polymorphism sites in genes, the CHADL The gene sequence is shown in SEQ ID NO:1.
[0028] In this invention, chicken CHADL Single nucleotide polymorphism sites in genes include: site 1, site 2, site 3, site 4, site 5, site 6, site 7, and site 8.
[0029] In this invention, locus 1 is located at position g.49793685 on chromosome 1 of the whole genome (reference genome: bGalGal1.mat.broiler.GRCg7b); locus 2 is located at position g.49793806 on chromosome 1 of the whole genome; locus 3 is located at position g.49794002 on chromosome 1 of the whole genome; locus 4 is located at position g.49794431 on chromosome 1 of the whole genome; locus 5 is located at position g.49794441 on chromosome 1 of the whole genome; locus 6 is located at position g.49795003 on chromosome 1 of the whole genome; locus 7 is located at position g.49797766 on chromosome 1 of the whole genome; and locus 8 is located at position g.49798159 on chromosome 1 of the whole genome.
[0030] In this invention, the base variation at site 1 is C / A, and the genotypes include CC, CA, and AA; the base variation at site 2 is C / T, and the genotypes include CC, TC, and TT; the base variation at site 3 is C / T, and the genotypes include CC, CT, and TT; the base variation at site 4 is C / T, and the genotypes include CC, CT, and TT; the base variation at site 5 is A / G, and the genotypes include AA, GG, and GA; the base variation at site 6 is C / T, and the genotypes include CC, TC, and TT; the base variation at site 7 is A / G, and the genotypes include AA, AG, and GG; and the base variation at site 8 is T / G, and the genotypes include TT, GT, and GG.
[0031] In this invention, the dominant genotype at locus 1 is AA; the dominant genotype at locus 2 is CC; the dominant genotype at locus 3 is TT; the dominant genotype at locus 4 is CC; the dominant genotype at locus 5 is GG; the dominant genotype at locus 6 is CC; there is no dominant genotype at locus 7; and the dominant genotype at locus 8 is TT.
[0032] The present invention also provides a primer pair for amplifying SNP molecular markers associated with precocious puberty traits in chickens.
[0033] In this invention, the primer pair sequences for amplifying the SNP molecular marker containing site 1 are shown in SEQ ID NO:2 and SEQ ID NO:3; The primer pair sequences for amplifying the SNP molecular marker containing site 2 are shown in SEQ ID NO:4 and SEQ ID NO:5; The primer pair sequences for amplifying the SNP molecular marker containing site 3 are shown in SEQ ID NO:6 and SEQ ID NO:7; The primer pair sequences for amplifying the SNP molecular marker containing site 4 are shown in SEQ ID NO:7 and SEQ ID NO:8; The primer pair sequences for amplifying the SNP molecular marker containing site 5 are shown in SEQ ID NO:9 and SEQ ID NO:10; The primer pair sequences for amplifying the SNP molecular marker containing site 6 are shown in SEQ ID NO:11 and SEQ ID NO:12; The primer pair sequences for amplifying the SNP molecular marker containing site 7 are shown in SEQ ID NO:13 and SEQ ID NO:14; The primer pair sequences for amplifying the SNP molecular marker containing site 8 are shown in SEQ ID NO:15 and SEQ ID NO:16.
[0034] The present invention also provides a detection reagent for detecting SNP molecular markers, the detection reagent comprising primer pairs for amplifying SNP molecular markers associated with precocious puberty traits in chickens.
[0035] The present invention also provides an application of the SNP molecular marker or the detection reagent in breeding.
[0036] In this invention, the application includes: (1) Prediction of precocious puberty traits in chickens; (2) Screening or identifying chicken breeds, wherein the chicken breeds have the characteristic of early maturity; (3) Selection and breeding of chickens with early maturity traits; (4) Marker-assisted breeding related to precocious puberty in chickens; (5) Breed improvement related to the early maturity trait of chickens.
[0037] Specifically, SEQ ID NO:1 refers to: Specifically, SEQ ID NO:2 is: ACGTTGGATGCTGGAGAGGGTGGAGGAAG.
[0038] Specifically, SEQ ID NO:3 is: ACGTTGGATGCTGGTAGAGAACAGTAATGC.
[0039] Specifically, SEQ ID NO:4 is: ACGTTGGATGCAGAACAACCTGGAGGAGA.
[0040] Specifically, SEQ ID NO:5 is: ACGTTGGATGGTCTGGAAGATAGACCAAGG.
[0041] Specifically, SEQ ID NO:6 is: ACGTTGGATGTCCATGTGCTGGGCAACGAG.
[0042] Specifically, SEQ ID NO:7 is: ACGTTGGATGAGCTGTGCCAGAGCCTCACT.
[0043] Specifically, SEQ ID NO:8 is: ACGTTGGATGCCTCTGAGATGAAGTGTGG.
[0044] Specifically, SEQ ID NO:9 is: ACGTTGGATGTTGTGTGGTGGAATTCAGGG.
[0045] The specific SEQ ID NO:10 is: ACGTTGGATGCCTCTGAGATGAAGTGTGG.
[0046] Specifically, SEQ ID NO:11 is: ACGTTGGATGTTGTGTGGTGGAATTCAGGG; Specifically, SEQ ID NO:12 is: ACGTTGGATGGAACGCTATCAGGAGCATTG.
[0047] Specifically, SEQ ID NO:13 is: ACGTTGGATGAGTTCCTCTCCAGGTGCAG.
[0048] Specifically, SEQ ID NO:14 is: ACGTTGGATGCCTCTGGCTTCTTCCTTCAT.
[0049] The specific SEQ ID NO:15 is: ACGTTGGATGCTTGCTTTGGAACCCAGAAC.
[0050] The specific SEQ ID NO:16 is: ACGTTGGATGTCTGCTCAGAAAGATGCCTC.
[0051] Specifically, SEQ ID NO:17 is: ACGTTGGATGCCTTAGCAAACAGACTCCAG.
[0052] Example 1 Using the terminal sire line (S09 strain) of the slaughter-grade "Sanhuang" high-quality broiler chickens as the research object, the comb height, comb length, and comb thickness of male and female chickens were measured at 7 weeks of age. 1 ml of blood was collected, and DNA was extracted using the phenol-chloroform method. The DNA was then screened using the Sanger sequencing combined with Sequenom MassARRAY system in 192 male and 192 female S09 strain chickens. CHADL The SNP loci were analyzed to determine their association with crown height, crown length, and crown thickness in the S09 line's paternal and maternal parents. Dominant genotypes were screened to provide molecular breeding markers for the selection of early-maturing traits in slaughter-type "Sanhuang" high-quality broiler chickens.
[0053] Comb height: The vertical distance from the base of the comb to the highest crown tooth. Comb length: The straight-line distance between the foremost and rearmost points of the comb. Comb thickness: The thickest point at the base of the comb. Measured using vernier calipers, unit: millimeters.
[0054] (a) Primer design Sanger sequencing primers were based on chicken sequencing data published in GenBank. CHADL The DNA sequence of the gene, as shown in SEQ ID NO:1, was analyzed in chicken using Primer 5.0 software. CHADL Four pairs of primers were designed for the gene mRNA region. Primer information is shown in Table 1. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0055] Table 1 CHADL Information on Sanger sequencing primers for gene mRNA regions
[0056] In addition, for the eight identified by Sanger sequencing CHADL For the gene SNP sites, the MassARRAY SNP primer set was designed using the primer design software Assay Design 3.1 from Sequenom. The primer information is shown in Table 2. The primers were synthesized by Genewiz Biotechnology (Beijing) Co., Ltd.
[0057] Table 2 CHADLInformation related to sequencing primers for gene mRNA region SNP sites using mass spectrometry array technology
[0058] (II) PCR amplification, first-generation sequencing and SNP site determination DNA samples from 384 individuals of the S09 line were each 1 µL and placed in a 5 ml sterile centrifuge tube. After mixing, the samples were used as DNA templates for PCR amplification using first-generation sequencing primers. The amplification system consisted of 25 µL, including 2.5 µL of 10×PCR buffer (containing Mg2+), 1.0 µL each of 10 µmol / L forward and reverse primers, 2.0 µL of 2 mmol / L dNTPs, 0.5 µL of 5.0 U / µL Taq DNA polymerase, 1.0 µL of 50 ng / µL DNA template, and ultrapure water to a final volume of 25 µL. PCR amplification conditions were as follows: 94℃ pre-denaturation for 5 min; followed by 94℃ denaturation for 30 s, annealing for 15 s (annealing temperatures are shown in Table 1), and 72℃ extension for 30 s, for 35 cycles; finally, 72℃ extension for 10 min, and storage at 4℃. After PCR products were detected by 1.5% agarose gel electrophoresis, they were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing using an ABI3730 sequencer. The sequencing results were analyzed using DNAstar software to determine the SNP sites.
[0059] (III) Determination of Sequenom MassARRAY-SNPs Multiplex PCR was used to amplify DNA fragments containing multiple target sites (primers are shown in Table 2). Excess primers and dNTPs in the multiplex PCR reaction system were purified using shrimp alkaline phosphatase (SAP). Single-base extension reactions were performed using dideoxynucleotides (ddNTPs) as substrates with iPLEX enzyme and extension primers designed for each target site (primers are shown in Table 2). The extension products were diluted 3-fold, desalted on resin, and transferred to a 384-well SpectroCHIP chip for matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF-MS) on a Sequenom mass spectrometer. Different alleles at the same target site formed different detection peaks due to their different molecular weights. The mass spectrometry peaks were detected using Typer 4.0 software, and the SNP genotype of each site was determined based on the size of the detection peaks.
[0060] The reaction systems are shown below: Multiplex PCR reaction system: HPLC-grade water 972.5 μL, 10×Buffer 331.25 μL, 25 mM MgCl2 172.25 μL, 25 mM dNTP 53 μL, 0.5 μM forward and reverse primer mixture 530 μL, 5 U / μL Taq polymerase 106 μL. After mixing, add 4 μL / well to a 384-well plate, then add 1 μL of 10 ng / μL DNA template to each well. Multiplex PCR amplification program: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 20 s, 56℃ annealing for 30 s, 72℃ extension for 60 s, for a total of 45 cycles of denaturation, annealing, and extension; 72℃ extension for 3 min. SAP digestion system: 810.9 μL HPLC-grade water, 90.1 μL 10×Buffer, 159 μL 1.7 U / μL SAP, mixed and added 24 μL / well to a 384-well plate. SAP reaction program: 37℃ for 40 min, 85℃ for 5 min; Extension reaction system: 400.2 μL HPLC-grade water, 106 μL 10×iPLEX Buffer plus, 106 μL iPLEX stop solution, 426.1 μL 1.0 μM primers, 21.7 μL iPLEX enzyme, mixed and added 2 μL / well to a 384-well plate. Extension reaction program: 94℃ pre-denaturation for 30 s; 94℃ denaturation for 5 s, 1 cycle; 52℃ annealing for 5 s; 80℃ extension for 5 s; annealing and extension for 5 cycles; then denaturation, annealing and extension for another 40 cycles; 72℃ extension for 3 min.
[0061] (iv) Statistical Analysis Using Excel software to statistically analyze S09 series chickens CHADL Gene frequencies, genotype frequencies, heterozygosity (He), polymorphism information content (PIC), and effective allele count (Ne) of the g.49793685, g.49793806, g.49794002, g.49794431, g.49794441, g.49795003, g.49797766, and g.49798159 loci were analyzed using the Hardy-Weinberg chi-square test. Linkage disequilibrium analysis of the eight SNP loci was performed using Hapoview 4.1 software.
[0062] Association analysis of the S09 line genotype with precocious traits (crown height, crown length, and crown thickness) was performed using univariate ANOVA in a general linear model within IBM SPSS Statistics 27.0 software. All data are expressed as mean ± standard deviation. Fixed factors: different genotypes of the SNP marker; dependent variables: crown height, crown length, and crown thickness. Multiple comparisons using the LSD method were employed to assess the significance of differences in crown height, crown length, and crown thickness among different marker genotypes, with P < 0.05 indicating statistical significance.
[0063] (v) Results 1. Sequencing results Sequencing of the amplification products of the sample using primer P1-4 revealed... CHADL The gene has mutations at 8 sites, such as Figure 1 As shown, a C→A mutation occurs at position g.49793685, a C→T mutation occurs at position g.49793806, a C→T mutation occurs at position g.49794002, a C→T mutation occurs at position g.49794431, an A→G mutation occurs at position g.49794441, a C→T mutation occurs at position g.49795003, an A→G mutation occurs at position g.49797766, and a T→G mutation occurs at position g.49798159.
[0064] 2. CHADL Mass spectrometry analysis of gene SNP sites 384 S09 series CHADL Mass genotyping maps of the 8 SNP loci of the gene, as shown Figure 2-9 As shown; Depend on Figure 2-9 It can be seen that the following genotypes are present at locus g.49793685: CC, CA, AA; locus g.49793806: CC, TC, TT; locus g.49794002: CC, CT, TT; locus g.49794431: CC, CT, TT; locus g.49794441: AA, GA, GG; locus g.49795003: CC, TC, TT; locus g.49797766: AA, AG, GG; and locus g.49798159: TT, GT, GG.
[0065] 3. CHADL Population genetic analysis of gene SNP loci Based on the genotyping results of the eight SNP loci, the genotype frequencies and allele frequencies of the eight loci in the paternal and maternal parents of the S09 line were statistically analyzed. The results are shown in Table 3-4. Table 3. Parentage of S09 lineage CHADL Allelic frequencies and genotype frequencies of 8 SNP loci of a gene
[0066] Table 4. S09 series parent plants CHADL Allelic frequencies and genotype frequencies of 8 SNP loci of a gene
[0067] Tables 3 and 4 show that at the g.49793685 locus, both the paternal and maternal parents of the S09 lineage had three genotypes: CC, AA, and CA, with CC being the predominant genotype and the C allele frequency significantly higher than the A allele frequency. At the g.49793806 locus, both the paternal and maternal parents of the S09 lineage had three genotypes: CC, TT, and TC, with TC being the predominant genotype and the C allele frequency significantly higher than the T allele frequency. At the g.49794002 locus, both the paternal and maternal parents of the S09 lineage had three genotypes: CC, TT, and CT, with CC being the predominant genotype and the C allele frequency significantly higher than the T allele frequency. At the g.49794431 locus, both the paternal and maternal parents of the S09 lineage had three genotypes: CC, TT ... The C allele frequency was significantly higher than the T allele frequency in the paternal parent of the S09 line, with the CT genotype being the predominant type. In the maternal parent of the S09 line, the T allele frequency was significantly higher than the C allele frequency. At the g.49794441 locus, three genotypes were found in both the paternal and maternal parents of the S09 line: AA, GG, and GA, with the GG genotype being the predominant type. The G allele frequency was significantly higher than the A allele frequency. At the g.49795003 locus, three genotypes were found in both the paternal and maternal parents of the S09 line: CC, TT, and TC, with the T allele being the predominant type. The T genotype was predominant, with the T allele frequency significantly higher than the C allele frequency. At the g.49797766 locus, three genotypes were found in both the paternal and maternal parents of the S09 line: AA, GG, and AG. The AA genotype was predominant in the paternal parent, while the AG genotype was predominant in the maternal parent. The A allele frequency was significantly higher than the G allele frequency in both parents. At the g.49798159 locus, three genotypes were found in both the paternal and maternal parents of the S09 line: TT, GG, and GT. The GT genotype was predominant, with the G allele frequency significantly higher than the T allele frequency.
[0068] Meanwhile, the Hardy-Weinberg equilibrium test results for 8 loci in the paternal and maternal lines of the S09 line are shown in Table 5-6: Table 5. Hardy-Weinberg equilibrium detection and population genetic parameters of 8 SNP loci in the paternal line of the S09 line.
[0069] Table 6. Hardy-Weinberg equilibrium detection and population genetic parameters of 8 SNP loci in the S09 line maternal parent.
[0070] Tables 5 and 6 show that the Hardy-Weinberg equilibrium test indicated that all eight SNP loci in the paternal and maternal parents of the S09 line were in Hardy-Weinberg equilibrium (P>0.05). The expected heterozygosity values of the eight SNP loci all fell within the range of 0.25 to 0.5, and the polymorphism information content values of the eight SNP loci were also within the range of 0.25 to 0.5. Therefore, these eight SNP loci are all moderately polymorphic. 4. CHADL Association analysis of gene unit point polymorphism with early maturity trait in S09 line The male and female parents of the S09 series were respectively CHADL Association analysis was performed on eight polymorphic sites of the gene with the precocious trait, and the results are shown in Table 7-8: Table 7. Parentage of S09 lineage CHADL Association analysis of different genotypes at 8 SNP loci of a gene with the comb trait in chickens
[0071] Note: Within the same locus, the differences in means among those with the same letter epigraph are not significant. P >0.05), while those with different letter subheadings showed significant differences ( P <0.05).
[0072] Table 8. S09 series parent plants CHADL Association analysis of different genotypes at 8 SNP loci of a gene with the comb trait in chickens
[0073] Note: Within the same locus, the differences in means among those with the same letter epigraph are not significant. P >0.05), while those with different letter subheadings showed significant differences ( P <0.05).
[0074] As shown in Tables 7 and 8, the C→A mutation at the g.49793685 locus of the CHADL gene resulted in three genotypes: CC, CA, and AA. The crown height of the AA genotype individuals from the S09 paternal line was significantly higher than that of the CC and CA genotype individuals (P<0.05). Although there were no significant differences in crown length and thickness among the three genotypes, the AA genotype individuals exhibited the highest crown length and thickness. Similarly, there were no significant differences in crown height, length, and thickness among the three genotypes in the S09 maternal line, but the AA genotype individuals had the highest crown height, length, and thickness. Therefore, the AA genotype is the dominant genotype at this locus. A C→T mutation at the g.49793806 locus of the CHADL gene across the entire genome revealed three genotypes: CC, TC, and TT. At this locus, individuals with the CC genotype in both the father and mother of S09 showed significantly higher crown height, crown length, and crown thickness than those with the TC and TT genotypes (P<0.05). Therefore, the CC genotype is the dominant genotype at this locus. Similarly, a C→T mutation at the g.49794002 locus of the CHADL gene also revealed three genotypes: CC, CT, and TT. At this locus, individuals with the TT and CT genotypes in both the father and mother of S09 showed significantly higher crown height, crown length, and crown thickness than those with the CC genotype (P<0.05). Although there was no significant difference in crown length and crown thickness between the TT and CT genotypes, the TT genotype exhibited the highest crown height, crown length, and crown thickness. Therefore, the TT genotype is the dominant genotype at this locus. A C→T mutation at the g.49794431 locus of the CHADL gene revealed three genotypes: CC, CT, and TT. At this locus, individuals with the CC and CT genotypes in both the father and mother of S09 showed significantly higher crown height, crown length, and crown thickness than those with the TT genotype (P<0.05). Although there was no significant difference in crown length and crown thickness between the CC and CT genotypes, the CC genotype exhibited the highest crown height, crown length, and crown thickness. Therefore, the CC genotype is the dominant genotype at this locus. A A→G mutation at the g.49794441 A>G locus of the CHADL gene revealed three genotypes: AA, GA, and GG. At this locus, individuals with the GG genotype in both the father and mother of S09 showed significantly higher crown height, crown length, and crown thickness than those with the AG and AA genotypes (P<0.05). Therefore, the GG genotype is the dominant genotype at this locus. The C→T mutation at the g.49795003 locus of the CHADL gene in the whole genome revealed three genotypes: CC, TC, and TT. At this locus, the crown height, crown length, and crown thickness of individuals with the CC and TC genotypes in both the father and mother of the S09 parent were significantly higher than those with the TT genotype (P<0.05). Although there was no significant difference in crown length and crown thickness between individuals with the CC and CT genotypes, individuals with the CC genotype had the highest crown height, crown length, and crown thickness. Therefore, the CC genotype is the dominant genotype at this locus.A mutation A→G at the g.49797766 site of the CHADL gene across the entire genome revealed three genotypes: AA, AG, and GG. There were no significant differences in crown height, crown length, and crown thickness between the three genotypes in the S09 parent population (P>0.05). Therefore, there is no dominant genotype at this site. A mutation of T→G at the g.49798159T>G site in the CHADL gene across the entire genome revealed three genotypes: TT, GT, and GG. In the S09 paternal parent, there was no significant difference in crown height among the three genotypes, with the TT genotype individuals exhibiting the highest crown height. In the S09 maternal parent, the TT genotype individuals had significantly higher crown height than the GG and GT genotype individuals (P<0.05). The crown length of the TT genotype individuals was significantly higher than that of the GG genotype individuals (P<0.05), but not significantly different from the GT genotype individuals; however, the TT genotype individuals had the longest crown length. There was no significant difference in crown thickness among the three genotypes, but the TT genotype individuals had the thickest crown. Therefore, the TT genotype is the dominant genotype at this locus.
[0075] The above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention. The scope of protection of the present invention is determined by the appended claims.
[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the specific implementation of the present invention. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.
Claims
1. A SNP molecular marker associated with precocious puberty in chickens, characterized in that, The SNP molecular marker is chicken. CHADL Single nucleotide polymorphism sites in genes, the CHADL The gene sequence is shown in SEQ ID NO:
1.
2. The SNP molecular marker related to precocious puberty in chickens according to claim 1, characterized in that, chicken CHADL Single nucleotide polymorphism sites in genes include: site 1, site 2, site 3, site 4, site 5, site 6, site 7, and site 8.
3. The SNP molecular marker related to precocious puberty in chickens according to claim 1, characterized in that, Locus 1 is located at position g.49793685 on chromosome 1 of the whole genome; Locus 2 is located at position g.49793806 on chromosome 1 of the whole genome; Locus 3 is located at position g.49794002 on chromosome 1 of the whole genome; Locus 4 is located at position g.49794431 on chromosome 1 of the whole genome; Locus 5 is located at position g.49794441 on chromosome 1 of the whole genome. The locus 6 is located at the g.49795003 site on chromosome 1 of the whole genome; the locus 7 is located at the g.49797766 site on chromosome 1 of the whole genome; and the locus 8 is located at the g.49798159 site on chromosome 1 of the whole genome.
4. The SNP molecular marker related to precocious puberty in chickens according to claim 1, characterized in that, The base variation at locus 1 is C / A, and the genotypes include CC, CA, and AA. The base variation at locus 2 is C / T, and the genotypes include CC, TC, and TT. The base variation at locus 3 is C / T, and the genotypes include CC, CT, and TT. The base variation at locus 4 is C / T, and the genotypes include CC, CT, and TT. The base variation at locus 5 is A / G, and the genotypes include AA, GA, and GG. The base variation at locus 6 is C / T, and the genotypes include CC, TC, and TT. The base variation at locus 7 is A / G, and the genotypes include AA, AG, and GG. The base variation at locus 8 is T / G, and the genotypes include TT, GT, and GG.
5. The SNP molecular marker related to precocious puberty in chickens according to claim 1, characterized in that, The dominant genotype at locus 1 is AA; the dominant genotype at locus 2 is CC; the dominant genotype at locus 3 is TT; the dominant genotype at locus 4 is CC; the dominant genotype at locus 5 is GG; the dominant genotype at locus 6 is CC; there is no dominant genotype at locus 7; and the dominant genotype at locus 8 is TT.
6. A primer pair for amplifying the SNP molecular markers associated with the precocious puberty trait in chickens as described in any one of claims 1-5.
7. The primer pair according to claim 6, characterized in that, The primer pair sequences for amplifying the SNP molecular marker containing site 1 are shown in SEQ ID NO:2 and SEQ ID NO:3; The primer pair sequences for amplifying the SNP molecular marker containing site 2 are shown in SEQ ID NO:4 and SEQ ID NO:5; The primer pair sequences for amplifying the SNP molecular marker containing site 3 are shown in SEQ ID NO:6 and SEQ ID NO:7; The primer pair sequences for amplifying the SNP molecular marker containing site 4 are shown in SEQ ID NO:8 and SEQ ID NO:9; The primer pair sequences for amplifying the SNP molecular marker containing site 5 are shown in SEQ ID NO:10 and SEQ ID NO:11; The primer pair sequences for amplifying the SNP molecular marker containing site 6 are shown in SEQ ID NO:12 and SEQ ID NO:13; The primer pair sequences for amplifying the SNP molecular marker containing site 7 are shown in SEQ ID NO:14 and SEQ ID NO:15; The primer pair sequences for amplifying the SNP molecular marker containing site 8 are shown in SEQ ID NO:16 and SEQ ID NO:
17.
8. A detection reagent for detecting SNP molecular markers, characterized in that, The detection reagent includes the primer pair as described in claim 7.
9. The application of an SNP molecular marker as described in any one of claims 1-5 or the detection reagent as described in claim 8 in breeding.
10. The application according to claim 9, characterized in that, include: (1) Prediction of precocious puberty traits in chickens; (2) Screening or identifying chicken breeds, wherein the chicken breeds have the characteristic of early maturity; (3) Selection and breeding of chickens with early maturity traits; (4) Marker-assisted breeding related to precocious puberty in chickens; (5) Breed improvement related to the early maturity trait of chickens.