Cas enzyme and application thereof

By developing novel Cas enzymes (Cas-sf2201, Cas-sf4274, Cas-sf2771, Cas-sf2586), the shortcomings of existing CRISPR/Cas systems have been addressed, achieving more efficient and precise gene editing and reducing off-target effects.

CN122012464APending Publication Date: 2026-05-12SHANDONG SHUNFENG BIOTECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610278005.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-07-07
Filing Date
2023-07-06
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing CRISPR/Cas systems each have their own advantages and disadvantages, and there is a need to develop a more robust new CRISPR/Cas system with good performance in many aspects to improve the efficiency and accuracy of gene editing.

Method used

A new class of Cas enzymes (Cas-sf2201, Cas-sf4274, Cas-sf2771, and Cas-sf2586) has been developed. These enzymes have specific amino acid sequences and functions, can bind to guide RNA, recognize specific target sequences and perform cleavage, including Cis cleavage and Trans cleavage, and have higher target site specificity and reduced off-target effects.

Benefits of technology

It enables more efficient and precise gene editing, reduces off-target effects, and improves the robustness and multiplexing capabilities of gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012464A_ABST
    Figure CN122012464A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of nucleic acid editing, and particularly relates to the technical field of regularly clustered interval short palindromic repeat (CRISPR). Specifically, the invention provides a novel Cas enzyme, and the Cas enzyme belongs to a class of novel Cas proteins and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese patent application No. 202410827745.9, filed on July 6, 2023, entitled "Cas enzyme and its application".

[0002] This application claims priority to Chinese patent application CN202210791795.7, filed on July 7, 2022. The entire contents of the aforementioned Chinese patent application are incorporated herein by reference. Technical Field

[0003] This invention relates to the field of gene editing, particularly to the field of regularly clustered short palindromic repeats (CRISPR) technology. Specifically, this invention has screened a novel class of Cas enzymes and developed corresponding gene editing tools and their applications based on these novel Cas enzymes. Background Technology

[0004] CRISPR / Cas technology is a widely used gene editing technology that uses RNA to specifically bind to target sequences on the genome and cut DNA to create double-strand breaks, using biological non-homologous end joining or homologous recombination for site-specific gene editing.

[0005] The CRISPR / Cas9 system is the most commonly used type II CRISPR system. It recognizes the 3'-NGG PAM motif and performs blunt-end cleavage on the target sequence. CRISPR / Cas Type V systems are a newly discovered class of CRISPR systems with a 5'-TTN motif, performing sticky-end cleavage on the target sequence; examples include Cpf1, C2c1, CasX, and CasY. However, the different CRISPR / Cas systems currently available each have their own advantages and disadvantages. For example, Cas9, C2c1, and CasX all require two guide RNAs, while Cpf1 only requires one and can be used for multiplex gene editing. CasX is 980 amino acids in size, while common systems like Cas9, C2c1, CasY, and Cpf1 are typically around 1300 amino acids. Furthermore, the PAM sequences of Cas9, Cpf1, CasX, and CasY are relatively complex and diverse, while C2c1 recognizes the strict 5'-TTN, making its target site easier to predict than other systems and reducing potential off-target effects.

[0006] In conclusion, given the limitations of currently available CRISPR / Cas systems, developing a more robust new CRISPR / Cas system with superior performance in multiple aspects is of great significance to the development of biotechnology. Summary of the Invention

[0007] Through extensive experimentation and repeated exploration, the inventors of this application unexpectedly discovered a novel endonuclease (Cas enzyme). Based on this discovery, the inventors developed a new CRISPR / Cas system, as well as gene editing methods and nucleic acid detection methods based on this system.

[0008] Cas effector protein

[0009] On the one hand, the present invention provides a Cas protein, which is an effector protein in the CRISPR / Cas system. In the present invention, it is referred to as Cas-sf2201, Cas-sf4274, Cas-sf2771 and Cas-sf2586, and the amino acid sequences of the above proteins are shown in SEQ ID No. 1-4, respectively.

[0010] In one embodiment, the amino acid sequence of the Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with any of the sequences in SEQ ID Nos. 1-4, and substantially retains the biological function of its derived sequence. Preferably, the Cas protein originates from the same species as Cas-sf2201, Cas-sf4274, Cas-sf2771, or Cas-sf2586.

[0011] In one embodiment, the Cas protein has an amino acid sequence with one or more amino acid substitutions, deletions, or additions compared to any of SEQ ID Nos. 1-4; and substantially retains the biological function of its derived sequence; the one or more amino acid substitutions, deletions, or additions include substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. Preferably, the Cas protein originates from the same species as Cas-sf2201, Cas-sf4274, Cas-sf2771, or Cas-sf2586.

[0012] Those skilled in the art will understand that the structure of a protein can be altered without adversely affecting its activity and function. For example, one or more conserved amino acid substitutions can be introduced into the amino acid sequence of a protein without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Examples and implementations of conserved amino acid substitutions are familiar to those skilled in the art. Specifically, an amino acid residue can be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., replacing another nonpolar amino acid residue with a nonpolar amino acid residue, replacing another polar uncharged amino acid residue with a polar uncharged amino acid residue, replacing another basic amino acid residue with a basic amino acid residue, and replacing another acidic amino acid residue with an acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions, where an amino acid is replaced by another amino acid belonging to the same group, fall within the scope of this invention, provided that the substitution does not lead to inactivation of the protein's biological activity. Therefore, the proteins of this invention can contain one or more conserved substitutions in their amino acid sequences, preferably generated by substitutions according to the table below. Furthermore, this invention also covers proteins that also contain one or more other nonconservative substitutions, provided that such nonconservative substitutions do not significantly affect the desired function and biological activity of the proteins of this invention.

[0013] Conserved amino acid substitutions can occur at one or more predicted non-essential amino acid residues. “Non-essential” amino acid residues are those that can be altered (deleted, substituted, or replaced) without changing their biological activity, while “essential” amino acid residues are required for biological activity. A “conserved amino acid substitution” is a substitution in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Amino acid substitutions can occur in the non-conserved regions of the aforementioned Cas protein. Generally, such substitutions are not performed on conserved amino acid residues, or on amino acid residues located within conserved motifs, where such residues are required for protein activity. However, those skilled in the art will understand that functional variants may have fewer conserved or non-conserved alterations in conserved regions.

[0014]

[0015] As is well known in the art, one or more amino acid residues can be altered (replaced, deleted, truncated, or inserted) from the N and / or C ends of a protein while retaining its functional activity. Therefore, proteins that have one or more amino acid residues altered from their N and / or C ends while retaining their desired functional activity are also within the scope of this invention. These alterations can include those introduced by modern molecular methods such as PCR, which includes PCR amplification that alters or lengthens the protein-coding sequence by means of oligonucleotides containing amino acid-coding sequences used in the PCR amplification.

[0016] It should be recognized that proteins can be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions, and methods for such operations are generally known in the art. For example, amino acid sequence variants of the aforementioned proteins can be prepared by mutating DNA. This can also be accomplished through other forms of mutagenesis and / or directed evolution, for example, using known mutagenesis, recombination, and / or shuffling methods, combined with relevant screening methods, to perform single or multiple amino acid substitutions, deletions, and / or insertions.

[0017] Those skilled in the art will understand that these minor amino acid changes in the Cas protein of the present invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domains of the protein, the properties of the polypeptide may be altered, but the polypeptide may retain its activity. If the mutations are not located near the catalytic domain, active site, or other functional domains, a smaller impact can be expected.

[0018] Those skilled in the art can identify the essential amino acids of the Cas protein of the present invention using methods known in the art, such as localized mutagenesis, protein evolution, or bioinformatics analysis. The catalytic domains, active sites, or other functional domains of the protein can also be determined through physical structural analysis, such as by techniques like nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, combined with mutations in presumed key site amino acids.

[0019] In one embodiment, the Cas protein contains any of the amino acid sequences shown in SEQ ID No. 1-4.

[0020] In one embodiment, the Cas protein is any of the amino acid sequences shown in SEQ ID No. 1-4.

[0021] In one embodiment, the Cas protein is a derivative protein with the same biological function as proteins having the sequences shown in any of SEQ ID No. 1-4.

[0022] The biological functions include, but are not limited to, activities that bind to guide RNA, endonuclease activities, and activities that bind to and cleave target sequences at specific sites under the guidance of guide RNA, including but not limited to Cis cleavage activities and Trans cleavage activities.

[0023] The present invention also provides a fusion protein comprising the Cas protein as described above and other modified portions.

[0024] In one embodiment, the modified portion is selected from other proteins or peptides, detectable markers, or any combination thereof.

[0025] In one embodiment, the modified portion is selected from epitope tags, reporter gene sequences, nuclear localization signal (NLS) sequences, targeting portions, transcriptional activation domains (e.g., VP64), transcriptional repression domains (e.g., KRAB or SID domains), nuclease domains (e.g., Fok1), and domains having activities selected from: nucleotide deaminase, methyltransferase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity, and nucleic acid binding activity; and any combination thereof. The NLS sequences are well known to those skilled in the art, and examples include, but are not limited to, the SV40 large T antigen, EGL-13, c-Myc, and TUS protein.

[0026] In one embodiment, the NLS sequence is located at, near, or close to the end (e.g., N-terminus, C-terminus, or both ends) of the Cas protein of the present invention.

[0027] The epitope tag is well known to those skilled in the art, including but not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art can choose other suitable epitope tags (e.g., for purification, detection or tracing).

[0028] The reporter gene sequences are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0029] In one embodiment, the fusion protein of the present invention includes a domain capable of binding to DNA molecules or intracellular molecules, such as maltose-binding protein (MBP), the DNA-binding domain (DBD) of Lex A, the DBD of GAL4, etc.

[0030] In one embodiment, the fusion protein of the present invention contains a detectable marker, such as a fluorescent dye, such as FITC or DAPI.

[0031] In one embodiment, the Cas protein of the present invention is optionally coupled, conjugated, or fused to the modified portion via a linker.

[0032] In one embodiment, the modified portion is directly connected to the N-terminus or C-terminus of the Cas protein of the present invention.

[0033] In one embodiment, the modified portion is attached to the N-terminus or C-terminus of the Cas protein of the present invention via a linker. Such linkers are well known in the art, and examples include, but are not limited to, linkers containing one or more (e.g., 1, 2, 3, 4, or 5) amino acids (e.g., Glu or Ser) or amino acid derivatives (e.g., Ahx, β-Ala, GABA, or Ava), or PEG, etc.

[0034] The Cas protein, protein derivative, or fusion protein of the present invention is not limited by the manner of its production. For example, it can be produced by genetic engineering methods (recombinant technology) or by chemical synthesis methods.

[0035] Nucleic acid of Cas protein

[0036] On the other hand, the present invention provides an isolated polynucleotide comprising:

[0037] (a) A polynucleotide sequence encoding the Cas protein or fusion protein of the present invention;

[0038] (b) Polynucleotides with sequences as shown in any of SEQ ID No. 5-12;

[0039] (c) A sequence having one or more substitutions, deletions, or additions (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases) compared to any of the sequences shown in SEQ ID No. 5-12;

[0040] (d) A polynucleotide whose nucleotide sequence has ≥80% homology (preferably ≥90%, more preferably ≥95%, most preferably ≥98%) to any of the sequences shown in SEQ ID No. 5-12, and encodes a polypeptide shown in any of SEQ ID No. 1-4; or,

[0041] (e) and any of the polynucleotides complementary to the polynucleotides described in (a)-(d).

[0042] In one embodiment, the nucleotide sequence described in any one of (a)-(e) is codon-optimized for expression in prokaryotic cells. In one embodiment, the nucleotide sequence described in any one of (a)-(e) is codon-optimized for expression in eukaryotic cells.

[0043] In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.

[0044] Direct Repeat Sequence

[0045] On the other hand, the present invention provides an engineered unidirectional repeat sequence that forms a complex with the above-mentioned Cas protein.

[0046] The unidirectional repeat sequence is linked with a guide sequence that can hybridize with the target sequence to form a guide RNA (or gRNA).

[0047] The hybridization of the target sequence with the gRNA represents at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity between the nucleic acid sequences of the target sequence and the gRNA, thereby enabling hybridization to form a complex; or represents that the nucleic acid sequences of the target sequence and the gRNA have at least 12, 15, 16, 17, 18, 19, 20, 21, 22, or more bases that can complement each other to form a complex.

[0048] In some embodiments, the repetitive sequence has at least 90% sequence identity with the sequence shown in SEQ ID No. 13-17. In some embodiments, the repetitive sequence has one or more base substitutions, deletions, or additions (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases) compared to the sequence shown in SEQ ID No. 13-17.

[0049] In some embodiments, the same-direction repeating sequence is as shown in any of SEQ ID No. 13-17.

[0050] Guide RNA (gRNA)

[0051] On the other hand, the present invention provides a gRNA comprising a first segment and a second segment; the first segment is also referred to as a "backbone region", "protein binding region", "protein binding sequence", or "direct repeat sequence"; the second segment is also referred to as a "target sequence for targeting nucleic acids", "target segment for targeting nucleic acids", or "guide sequence for targeting target sequences".

[0052] The first segment of the gRNA can interact with the Cas protein of the present invention, thereby enabling the Cas protein and gRNA to form a complex.

[0053] In one implementation, the first segment is a repeating sequence in the same direction as described above.

[0054] The target sequence or target region of the nucleic acid targeted by this invention comprises a nucleotide sequence complementary to a sequence in the target nucleic acid. In other words, the target sequence or target region of the nucleic acid targeted by this invention interacts with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the target sequence or target region of the nucleic acid can be altered or modified to hybridize with any desired sequence within the target nucleic acid. The nucleic acid is selected from DNA or RNA.

[0055] The percentage of complementarity between the target sequence or target region of the target nucleic acid and the target sequence of the target nucleic acid may be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).

[0056] The "backbone region," "protein-binding region," "protein-binding sequence," or "direct repeat sequence" of the gRNA of this invention can interact with CRISPR proteins (or Cas proteins). The gRNA of this invention guides the interacting Cas protein to a specific nucleotide sequence within the target nucleic acid through the targeting sequence of the target nucleic acid.

[0057] Preferably, the guide RNA comprises a first segment and a second segment in the 5' to 3' direction.

[0058] In this invention, the second segment can also be understood as a guide sequence for hybridization with the target sequence.

[0059] The gRNA of the present invention can form a complex with the Cas protein.

[0060] The gRNA of the Cas-sf4274 protein of the present invention contains a guide sequence for hybridization with a target nucleic acid, wherein the target nucleic acid includes a sequence located at the 3' end of the adjacent motif (PAM) in the prototype spacer region; the aforementioned PAM sequence is 5'-TTN-3', wherein N=A / T / C / G.

[0061] The gRNA of the Cas-sf2201 protein of the present invention contains a guide sequence for hybridization with a target nucleic acid, wherein the target nucleic acid includes a sequence located at the 3' end of the adjacent motif (PAM) in the prototype spacer region; the aforementioned PAM sequence is 5'-TTN-3', wherein N=A / T / C / G.

[0062] The gRNA of the Cas-sf2771 protein of the present invention contains a guide sequence for hybridization with a target nucleic acid, wherein the target nucleic acid includes a sequence located at the 3' end of the adjacent motif (PAM) in the prototype spacer region; the aforementioned PAM sequence is 5'-TTN-3', wherein N=A / T / C / G.

[0063] The gRNA of the Cas-sf2586 protein of the present invention contains a guide sequence for hybridization with a target nucleic acid, wherein the target nucleic acid includes a sequence located at the 3' end of an adjacent motif (PAM) in the prototype spacer region; the aforementioned PAM sequence is 5'-ATT-3' or 5'-ATC-3'.

[0064] carrier

[0065] The present invention also provides a carrier comprising, as described above, a Cas protein, an isolated nucleic acid molecule or a polynucleotide; preferably, it further comprises a regulatory element operatively linked thereto.

[0066] In one embodiment, the regulatory element is selected from one or more of the following: enhancers, transposons, promoters, terminators, leader sequences, polyadenylation sequences, and marker genes.

[0067] In one embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector, and an integration vector.

[0068] In some implementations, the vectors included in the system are viral vectors (e.g., retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated vectors, and herpes simplex vectors), and may also be plasmids, viruses, granules, bacteriophages, etc., which are well known to those skilled in the art.

[0069] CRISPR system

[0070] The present invention provides an engineered, non-naturally occurring vector system, or a CRISPR-Cas system, comprising a Cas protein or a nucleic acid sequence encoding the Cas protein and a nucleic acid encoding one or more guide RNAs.

[0071] In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding one or more guide RNAs are artificially synthesized.

[0072] In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding one or more guide RNAs do not coexist naturally.

[0073] The one or more guide RNAs target one or more target sequences in the cell. The one or more target sequences hybridize to the genomic loci of a DNA molecule encoding one or more gene products and guide the Cas protein to the genomic locus of the DNA molecule of the one or more gene products. Once the Cas protein reaches the target sequence location, it modifies, edits, or cuts the target sequence, thereby altering or modifying the expression of the one or more gene products.

[0074] The cells of this invention include one or more of animals, plants, or microorganisms.

[0075] In some embodiments, the Cas protein is codon-optimized for expression in cells.

[0076] In some embodiments, the Cas protein directs cleavage of one or both strands at the target sequence location.

[0077] In some embodiments, the Cas protein cleaves the complementary and / or non-complementary strands of the target nucleic acid under the mediation of gRNA.

[0078] Preferably, the Cas protein simultaneously cleaves the complementary and non-complementary strands of the target nucleic acid.

[0079] Preferably, the Cas protein preferentially cleaves the non-complementary strand of the target nucleic acid.

[0080] In this invention, the gRNA guides the Cas protein to recognize and bind to the complementary strand, and the non-complementary strand is a nucleic acid strand paired with the complementary strand. The PAM sequence is located on the non-complementary strand, and the complementary strand contains a PAM complementary sequence that pairs with the aforementioned PAM sequence.

[0081] In one embodiment, the cleavage site of the complementary strand of the target sequence by Cas-sf4274 is between the 22nd and 23rd nt of the 5' end of the PAM complementary sequence, and the cleavage site of the non-complementary strand of the target sequence by Cas-sf4274 is between the 23rd and 24th nt, or between the 28th and 29th nt, or between the 30th and 31st nt of the 3' end of the PAM sequence. The gRNA guides the Cas-sf4274 protein to recognize and bind to the aforementioned complementary strand, wherein the aforementioned non-complementary strand is the DNA strand paired with the complementary strand.

[0082] In one embodiment, the cleavage site of Cas-sf2201 on the complementary strand of the target sequence is between 22 and 23 nt from the 5' end of the PAM complementary sequence, and the cleavage site of Cas-sf2201 on the non-complementary strand of the target sequence is between 25 and 26 nt or between 28 and 29 nt from the 3' end of the PAM sequence. The gRNA guides the Cas-sf2201 protein to recognize and bind to the aforementioned complementary strand, wherein the non-complementary strand is the DNA strand paired with the complementary strand.

[0083] In one embodiment, the cleavage site of Cas-sf2771 on the complementary strand of the target sequence is between 22 and 23 nt from the 5' end of the PAM complementary sequence, and the cleavage site of Cas-sf2771 on the non-complementary strand of the target sequence is between 18 and 19 nt from the 3' end of the PAM sequence. The gRNA guides the Cas-sf2771 protein to recognize and bind to the aforementioned complementary strand, wherein the aforementioned non-complementary strand is the DNA strand paired with the complementary strand.

[0084] In one embodiment, the cleavage site of the non-complementary strand of the target sequence by Cas-sf2586 is between the 24th and 25th nt of the 3' end of the PAM sequence. The gRNA guides the Cas-sf2586 protein to recognize and bind to the aforementioned complementary strand, which is a DNA strand paired with the complementary strand.

[0085] The present invention also provides an engineered, non-naturally occurring carrier system, which may include one or more carriers, the one or more carriers comprising:

[0086] a) A first regulatory element, which is operatively linked to the gRNA.

[0087] b) A second regulatory element operatively linked to the Cas protein;

[0088] Components (a) and (b) are located on the same or different carriers in the system.

[0089] The first and second regulatory elements include promoters (e.g., constitutive or inducible promoters), enhancers (e.g., 35S promoters or 35S enhanced promoters), internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and polyU sequences).

[0090] In some embodiments, the vector in the system is a viral vector (e.g., a retroviral vector, lentiviral vector, adenovirus vector, adeno-associated vector, and herpes simplex vector), or it can be a plasmid, virus, granule, bacteriophage, or other type known to those skilled in the art.

[0091] In some embodiments, the system provided herein is a delivery system. In some embodiments, the delivery system is a nanoparticle, liposome, exosome, microbubble, or gene gun.

[0092] In one embodiment, the target sequence is a DNA or RNA sequence derived from prokaryotic or eukaryotic cells. In another embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.

[0093] In one embodiment, the target sequence is present within the cell. In another embodiment, the target sequence is present in the cell nucleus or cytoplasm (e.g., organelles). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.

[0094] In one embodiment, the Cas protein is linked to one or more NLS sequences. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is linked to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.

[0095] On the other hand, the present invention relates to an engineered CRISPR system comprising the aforementioned Cas protein and one or more guide RNAs, wherein the guide RNA comprises a homologous repeat sequence and a spacer sequence capable of hybridizing with a target nucleic acid, and the Cas protein is capable of binding the guide RNA and targeting a target nucleic acid sequence complementary to the spacer sequence.

[0096] In one embodiment, the Cas enzyme is the Cas-sf4274 protein, the target nucleic acid is DNA (preferably double-stranded DNA), the target nucleic acid is located at the 3' end of the protospacer adjacent motif (PAM), and the PAM has the sequence shown as 5'-TTN-3', where N=A / T / C / G.

[0097] In one embodiment, the Cas enzyme is the Cas-sf2201 protein, the target nucleic acid is DNA (preferably double-stranded DNA), the target nucleic acid is located at the 3' end of the protospacer adjacent motif (PAM), and the PAM has the sequence shown as 5'-TTN-3', wherein N=A / T / C / G.

[0098] In one embodiment, the Cas enzyme is the Cas-sf2771 protein, the target nucleic acid is DNA (preferably double-stranded DNA), the target nucleic acid is located at the 3' end of the protospacer adjacent motif (PAM), and the PAM has the sequence shown as 5'-TTN-3', where N=A / T / C / G.

[0099] In one embodiment, the Cas enzyme is the Cas-sf2586 protein, the target nucleic acid is DNA (preferably double-stranded DNA), the target nucleic acid is located at the 3' end of the protospacer adjacent motif (PAM), and the PAM has a sequence shown as 5'-ATT-3' or 5'-ATC-3'.

[0100] Protein-nucleic acid complexes / compositions

[0101] On the other hand, the present invention provides a complex or composition comprising:

[0102] (i) Protein components selected from: the aforementioned Cas proteins, derived proteins, or fusion proteins, and any combination thereof; and

[0103] (ii) A nucleic acid component comprising (a) a guide sequence capable of hybridizing with a target sequence; and (b) a unidirectional repeat sequence capable of binding to the Cas protein of the present invention.

[0104] The protein components and nucleic acid components combine to form a complex.

[0105] In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.

[0106] In one embodiment, the complex or composition is non-natural or modified. In one embodiment, at least one component of the complex or composition is non-natural or modified. In one embodiment, the first component is non-natural or modified; and / or, the second component is non-natural or modified.

[0107] Activated CRISPR complex

[0108] On the other hand, the present invention also provides an activated CRISPR complex comprising: (1) a protein component selected from: the Cas protein, derived protein, or fusion protein of the present invention, and any combination thereof; (2) a gRNA comprising (a) a guide sequence capable of hybridizing with a target sequence; and (b) a homologous repeat sequence capable of binding to the Cas protein of the present invention; and (3) a target sequence bound to the gRNA. Preferably, the binding is a binding between the target sequence of the target nucleic acid on the gRNA and the target nucleic acid.

[0109] The term “activated CRISPR complex”, “activated complex”, or “ternary complex” used in this article refers to the complex formed by the binding or modification of the Cas protein, gRNA, and target nucleic acid in the CRISPR system.

[0110] The Cas protein and gRNA of this invention can form a binary complex, which is activated upon binding to a nucleic acid substrate to form an activated CRISPR complex. The nucleic acid substrate is complementary to the spacer sequence (or, in other words, the guide sequence for hybridization with the target nucleic acid) in the gRNA. In some embodiments, the spacer sequence of the gRNA perfectly matches the target substrate. In other embodiments, the spacer sequence of the gRNA partially (continuously or discontinuously) matches the target substrate.

[0111] In a preferred embodiment, the activated CRISPR complex can exhibit side-branch nuclease cleavage activity, which refers to the non-specific or random cleavage activity of the activated CRISPR complex on single-stranded nucleic acids, also known in the art as trans cleavage activity.

[0112] Delivery and delivery composition

[0113] The Cas proteins, gRNAs, fusion proteins, nucleic acid molecules, vectors, systems, complexes, and compositions of the present invention can be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipid transfection, nuclear transfection, microinjection, acoustic pore effect, gene gun, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipid transfection, puncture transfection, optical transfection, reagent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, artificial viruses, etc.

[0114] Therefore, in another aspect, the present invention provides a delivery composition comprising a delivery vector and selected from one or more of the following: the Cas protein, fusion protein, nucleic acid molecule, vector, system, complex and composition of the present invention.

[0115] In one embodiment, the delivery carrier is a particle.

[0116] In one embodiment, the delivery vector is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene guns, or viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses, or adeno-associated viruses).

[0117] host cells

[0118] The present invention also relates to an in vitro, ex vivo, or in vivo cell or cell line or its progeny comprising: the Cas protein, fusion protein, nucleic acid molecule, protein-nucleic acid complex, activated CRISPR complex, vector, or delivery composition of the present invention.

[0119] In some implementations, the cell is a prokaryotic cell.

[0120] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a non-human mammalian cell, such as cells of non-human primates, cattle, sheep, pigs, dogs, monkeys, rabbits, or rodents (such as rats or mice). In some embodiments, the cell is a non-mammalian eukaryotic cell, such as cells of poultry (such as chickens), fish, or crustaceans (such as clams or shrimp). In some embodiments, the cell is a plant cell, such as cells of monocotyledonous or dicotyledonous plants, or cells of cultivated plants or food crops such as cassava, corn, sorghum, soybeans, wheat, oats, or rice, such as algae, trees, or productive plants, fruits, or vegetables (e.g., trees such as citrus trees, nut trees; nightshade plants, cotton, tobacco, tomatoes, grapes, coffee, cocoa, etc.).

[0121] In some implementations, the cell is a stem cell or stem cell line.

[0122] In some cases, the host cells of the present invention contain genetic or genomic modifications that are not present in their wild type.

[0123] Gene editing methods and applications

[0124] The Cas protein, nucleic acid, the above-described composition, the above-described CRISPR / Cas system, the above-described vector system, the above-described delivery composition, or the above-described activated CRISPR complex or the above-described host cell of the present invention can be used for any or more of the following purposes: targeting and / or editing target nucleic acids; cleaving double-stranded DNA, single-stranded DNA, or single-stranded RNA; non-specifically cleaving and / or degrading side-branched nucleic acids; non-specifically cleaving single-stranded nucleic acids; nucleic acid detection; detecting nucleic acids in target samples; specifically editing double-stranded nucleic acids; base editing double-stranded nucleic acids; base editing single-stranded nucleic acids. In other embodiments, they can also be used to prepare reagents or kits for any or more of the above purposes.

[0125] The present invention also provides the use of the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition, or the above-mentioned activated CRISPR complex in gene editing, gene targeting, or gene cutting; or, in the preparation of reagents or kits for gene editing, gene targeting, or gene cutting.

[0126] In one embodiment, the gene editing, gene targeting, or gene cutting is performed intracellularly and / or extracellularly.

[0127] The present invention also provides a method for editing, targeting, or cleaving a target nucleic acid, the method comprising contacting the target nucleic acid with the aforementioned Cas protein, nucleic acid, the aforementioned composition, the aforementioned CIRSPR / Cas system, the aforementioned vector system, the aforementioned delivery composition, or the aforementioned activated CRISPR complex. In one embodiment, the method comprises editing, targeting, or cleaving the target nucleic acid intracellularly or extracellularly.

[0128] The gene editing or editing of target nucleic acids includes modifying genes, knocking out genes, altering the expression of gene products, repairing mutations, and / or inserting polynucleotides, and gene mutations.

[0129] The editing can be performed in prokaryotic and / or eukaryotic cells.

[0130] On the other hand, the present invention also provides the use of the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned carrier system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex in nucleic acid detection, or in the preparation of reagents or kits for nucleic acid detection.

[0131] On the other hand, the present invention also provides a method for cleaving single-stranded nucleic acids, the method comprising contacting a nucleic acid population with the aforementioned Cas protein and gRNA, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, and the Cas protein cleaving the plurality of non-target single-stranded nucleic acids.

[0132] The gRNA can bind to the Cas protein.

[0133] The gRNA can target the target nucleic acid.

[0134] The contact can be outside the body, outside the body, or inside the cells within the body.

[0135] Preferably, the cleavage of the single-stranded nucleic acid is non-specific.

[0136] On the other hand, the present invention also provides the use of the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition, or the above-mentioned activated CRISPR complex in the non-specific cleavage of single-stranded nucleic acids, or in the preparation of reagents or kits for the non-specific cleavage of single-stranded nucleic acids.

[0137] On the other hand, the present invention also provides a kit for gene editing, gene targeting or gene cutting, the kit comprising the above-mentioned Cas protein, gRNA, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition, the above-mentioned activated CRISPR complex or the above-mentioned host cell.

[0138] On the other hand, the present invention also provides a kit for detecting target nucleic acids in a sample, the kit comprising: (a) a Cas protein, or a nucleic acid encoding the Cas protein; (b) a guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA containing the guide RNA, or a nucleic acid encoding the precursor RNA; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize with the guide RNA.

[0139] As is known in the art, precursor RNA can be cleaved or processed into the aforementioned mature guide RNA.

[0140] On the other hand, the invention provides the use of the above-mentioned Cas protein, nucleic acid, composition, CRISPR / Cas system, vector system, delivery composition, activated CRISPR complex, or host cell in the preparation of formulations or kits, wherein the formulations or kits are used for:

[0141] (i) Gene or genome editing;

[0142] (ii) Target nucleic acid detection and / or diagnosis;

[0143] (iii) Editing target sequences in target loci to modify biological or non-human organisms;

[0144] (iv) Treatment of the disease;

[0145] (v) Target gene.

[0146] Preferably, the above-mentioned gene or genome editing is performed intracellularly or extracellularly.

[0147] Preferably, the target nucleic acid detection and / or diagnosis is performed in vitro.

[0148] Preferably, the treatment of the disease is to treat symptoms caused by defects in the target sequence at the target locus.

[0149] In another aspect, the present invention provides a method for detecting a target nucleic acid in a sample, the method comprising contacting the sample with the Cas protein, gRNA (guide RNA) and a single-stranded nucleic acid detector, the gRNA including a region binding to the Cas protein and a guide sequence for hybridization with the target nucleic acid; detecting a detectable signal generated by the single-stranded nucleic acid detector by the Cas protein cleaving the single-stranded nucleic acid detector, thereby detecting the target nucleic acid; the single-stranded nucleic acid detector not hybridizing with the gRNA.

[0150] Methods for specifically modifying target nucleic acids

[0151] On the other hand, the present invention also provides a method for specifically modifying target nucleic acids, the method comprising: contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex.

[0152] This specific modification can occur in vivo or in vitro.

[0153] This specific modification can occur either inside or outside the cell.

[0154] In some cases, the cells are selected from prokaryotic or eukaryotic cells, such as animal cells, plant cells, or microbial cells.

[0155] In one embodiment, the modification refers to a break in the target sequence, such as a single-strand / double-strand break in DNA or a single-strand break in RNA.

[0156] In some cases, the method further includes contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target nucleic acid.

[0157] In one embodiment, the modification further includes inserting an editing template (e.g., exogenous nucleic acid) into the break.

[0158] In one embodiment, the method further includes contacting the editing template with the target nucleic acid or delivering it to a cell containing the target nucleic acid. In this embodiment, the method repairs the broken target gene by homologous recombination with a foreign template polynucleotide; in some embodiments, the repair results in a mutation, including the insertion, deletion, or substitution of one or more nucleotides of the target gene; in other embodiments, the mutation results in a change in one or more amino acids in a protein expressed from a gene containing the target sequence.

[0159] Detection (non-specific cutting)

[0160] On the other hand, the present invention provides a method for detecting target nucleic acids in a sample, the method comprising contacting the sample with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned carrier system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex and a single-stranded nucleic acid detector; detecting a detectable signal generated by the single-stranded nucleic acid detector by the Cas protein cleaving the single-stranded nucleic acid, thereby detecting the target nucleic acid.

[0161] In this invention, the target nucleic acid includes ribonucleotides or deoxyribonucleotides; including single-stranded nucleic acids and double-stranded nucleic acids, such as single-stranded DNA, double-stranded DNA, single-stranded RNA, and double-stranded RNA.

[0162] In one embodiment, the target nucleic acid is derived from samples such as viruses, bacteria, microorganisms, soil, water sources, humans, animals, and plants. Preferably, the target nucleic acid is a product enriched or amplified by methods such as PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, and RAM.

[0163] In one embodiment, the target nucleic acid is viral nucleic acid, bacterial nucleic acid, disease-related specific nucleic acid, such as specific mutation sites or SNP sites, or nucleic acids that differ from controls; preferably, the virus is a plant virus or animal virus, such as papillomavirus, hepatocyte DNA virus, herpesvirus, adenovirus, poxvirus, parvovirus, or coronavirus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, or Mers-Cov.

[0164] In this invention, the gRNA has at least a 50% match with the target sequence on the target nucleic acid, preferably at least 60%, preferably at least 70%, preferably at least 80%, and preferably at least 90%.

[0165] In one implementation, when the target sequence contains one or more characteristic sites (such as specific mutation sites or SNPs), the characteristic sites perfectly match the gRNA.

[0166] In one embodiment, the detection method may include one or more gRNAs with different guide sequences that target different target sequences.

[0167] In this invention, the single-stranded nucleic acid detector includes, but is not limited to, single-stranded DNA, single-stranded RNA, DNA-RNA hybrids, nucleic acid analogs, base modifiers, and single-stranded nucleic acid detectors containing base-free spacers; "nucleic acid analogs" include, but are not limited to: locked nucleic acids, bridging nucleic acids, morpholine nucleic acids, ethylene glycol nucleic acids, hexitol nucleic acids, threonine nucleic acids, arabinose nucleic acids, 2'-oxymethyl RNA, 2'-methoxyacetyl RNA, 2'-fluoroRNA, 2'-aminoRNA, 4'-thioRNA, and combinations thereof, including optional ribonucleotide or deoxyribonucleotide residues.

[0168] In this invention, the detectable signal is achieved through the following methods: vision-based detection, sensor-based detection, color detection, fluorescence signal-based detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase transition / dispersion, electrochemical detection, and semiconductor-based detection.

[0169] In this invention, preferably, a fluorescent group and a quenching group are respectively disposed at both ends of the single-stranded nucleic acid detector, so that the single-stranded nucleic acid detector can exhibit a detectable fluorescent signal after being cleaved. The fluorescent group is selected from one or any combination of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; the quenching group is selected from one or any combination of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0170] In other embodiments, different labeling molecules are set at the 5' and 3' ends of the single-stranded nucleic acid detector, and the colloidal gold test results of the single-stranded nucleic acid detector before and after being cleaved by the Cas protein are detected by colloidal gold detection. The single-stranded nucleic acid detector will show different color development results on the colloidal gold detection line and control line before and after being cleaved by the Cas protein.

[0171] In some implementations, the method for detecting target nucleic acids may further include comparing the level of a detectable signal with a reference signal level, and determining the amount of target nucleic acid in the sample based on the level of the detectable signal.

[0172] In some implementations, the method for detecting target nucleic acids may also include using RNA reporter nucleic acids and DNA reporter nucleic acids (e.g., fluorescence color) on different channels and determining the level of a detectable signal by measuring the signal levels of the RNA and DNA reporter molecules and by measuring the amount of target nucleic acid in the RNA and DNA reporter molecules, sampling based on the combined (e.g., using minimum or product) level of the detectable signal.

[0173] In one embodiment, the target gene is present within the cell.

[0174] In one embodiment, the cell is a prokaryotic cell.

[0175] In one embodiment, the cell is a eukaryotic cell.

[0176] In one embodiment, the cell is an animal cell.

[0177] In one embodiment, the cell is a human cell.

[0178] In one embodiment, the cell is a plant cell, such as the cell of a cultivated plant (e.g., cassava, corn, sorghum, wheat, or rice), algae, tree, or vegetable.

[0179] In one embodiment, the target gene is present in an in vitro nucleic acid molecule (e.g., a plasmid).

[0180] In one embodiment, the target gene is present in a plasmid.

[0181] Terminology Definition

[0182] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the operational steps used herein, such as molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA, are all conventional steps widely used in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.

[0183] In this invention, amino acid residues can be represented by a single letter or by three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamic acid (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), and arginine (Arg, R).

[0184] Cas protein

[0185] In this invention, Cas protein, Cas enzyme, and Cas effector protein can be used interchangeably; the inventors have for the first time discovered and identified a Cas effector protein having an amino acid sequence selected from the following:

[0186] (i) Any of SEQ ID No. 1-4;

[0187] (ii) A sequence having one or more amino acid substitutions, deletions, or additions (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) compared to any of the sequences shown in SEQ ID No. 1-4; or

[0188] (iii) A sequence having at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any of the sequences shown in SEQ ID No. 1-4.

[0189] Nucleic acid cleavage or cleavage of nucleic acids as used herein includes: DNA or RNA breaks in target nucleic acids produced by the Cas enzyme described herein (Cis cleavage), and DNA or RNA breaks in side-branched nucleic acid substrates (single-stranded nucleic acid substrates) (i.e., non-specific or non-targeted, trans cleavage). In some embodiments, the cleavage is a double-stranded DNA break. In some embodiments, the cleavage is a single-stranded DNA break or a single-stranded RNA break.

[0190] CRISPR system

[0191] As used herein, the terms “regularly clustered short palindromic repeats (CRISPR)-CRISPR-related (Cas) (CRISPR-Cas) system” or “CRISPR system” are used interchangeably and have the meaning commonly understood by those skilled in the art, which typically includes transcripts or other elements relating to the expression of CRISPR-related (“Cas”) genes, or transcripts or other elements capable of directing the activity of said Cas genes.

[0192] CRISPR / Cas complex

[0193] As used herein, the term “CRISPR / Cas complex” refers to a complex formed by the binding of guide RNA or mature crRNA to the Cas protein, which contains a guide sequence that hybridizes to the target sequence and a homologous repeat sequence that binds to the Cas protein. This complex is capable of recognizing and cleaving polynucleotides that hybridize with the guide RNA or mature crRNA.

[0194] Guide RNA (gRNA)

[0195] As used herein, the terms “guide RNA (gRNA),” “mature crRNA,” and “guide sequence” are used interchangeably and have the meanings commonly understood by those skilled in the art. Generally, guide RNA may comprise a direct repeat sequence and a guide sequence, or consist substantially of or composed of a direct repeat sequence and a guide sequence.

[0196] In some cases, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the CRISPR / Cas complex to specifically bind to the target sequence. In one embodiment, the complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% for optimal alignment. Determining the optimal alignment is within the capabilities of a person skilled in the art. For example, publicly available and commercially available alignment algorithms and programs exist, such as, but not limited to, ClustalW, the Smith-Waterman algorithm in MATLAB, Bowtie, Geneious, Biopython, and SeqMan.

[0197] target sequence

[0198] A "target sequence" refers to a polynucleotide targeted by a guide sequence in the gRNA, such as a sequence complementary to that guide sequence, where hybridization between the target and guide sequences will promote the formation of a CRISPR / Cas complex (including the Cas protein and gRNA). Perfect complementarity is not required, as long as sufficient complementarity exists to induce hybridization and promote the formation of a CRISPR / Cas complex.

[0199] The target sequence can contain any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located inside or outside the cell. In some cases, the target sequence is located in the cell nucleus or cytoplasm. In some cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondrion or chloroplast. The sequence or template that can be used for recombination into a target locus containing the target sequence is referred to as an "edit template," "edit polynucleotide," or "edit sequence." In one embodiment, the edit template is a foreign nucleic acid. In one embodiment, the recombination is homologous recombination.

[0200] In this invention, the "target sequence," "target polynucleotide," or "target nucleic acid" can be any endogenous or exogenous polynucleotide for a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or useless DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM).

[0201] Single-stranded nucleic acid detector

[0202] The single-stranded nucleic acid detector described in this invention refers to a sequence containing 2-200 nucleotides, preferably 2-150 nucleotides, more preferably 3-100 nucleotides, more preferably 3-30 nucleotides, more preferably 4-20 nucleotides, and even more preferably 5-15 nucleotides. It is preferably a single-stranded DNA molecule, a single-stranded RNA molecule, or a single-stranded DNA-RNA hybrid.

[0203] The single-stranded nucleic acid detector has different reporter groups or label molecules at both ends. When it is in its initial state (i.e., uncut state), it does not present a reporter signal. When the single-stranded nucleic acid detector is cut, it presents a detectable signal, that is, it shows a detectable difference between before and after cutting.

[0204] In one embodiment, the reporter group or labeled molecule includes a fluorescent group and a quencher group, wherein the fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; and the quencher group is selected from one or any of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0205] In one embodiment, the single-stranded nucleic acid detector has a first molecule (such as FAM or FITC) connected to the 5' end and a second molecule (such as biotin) connected to the 3' end. The reaction system containing the single-stranded nucleic acid detector is used in conjunction with a flow strip to detect target nucleic acids (preferably, colloidal gold detection). The flow strip is designed with two capture lines, with an antibody binding the first molecule (i.e., the first molecule antibody) at the sample contact end (colloidal gold), an antibody binding the first molecule antibody at the first line (control line), and an antibody binding the second molecule antibody (i.e., the second molecule antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecule antibody binds to the first molecule, carrying cleaved or uncleaved oligonucleotides to the capture lines. Cleaved reporters bind to the first molecule antibody at the first capture line, while uncleaved reporters bind to the second molecule antibody at the second capture line. The binding of the reporter group at each line results in a strong readout / signal (e.g., color). As more reporters are cleaved, more signal accumulates at the first capture line, and less signal appears at the second line. In some aspects, the present invention relates to the use of flow strips as described herein for the detection of nucleic acids. In some aspects, the present invention relates to methods for detecting nucleic acids using flow strips as defined herein, such as (lateral)flow assays or (lateral)flow immunochromatographic assays. In some aspects, the molecules in the single-stranded nucleic acid detector may be interchanged or their positions altered, provided that their reporting principle is the same as or similar to that of the present invention, and any modifications thereof are also included in the present invention.

[0206] The detection method described in this invention can be used for the quantitative detection of target nucleic acids. The quantitative detection index can be determined based on the signal strength of the reporter group, such as the luminescence intensity of the fluorescent group or the width of the colored band.

[0207] wild type

[0208] As used herein, the term “wildtype” has the meaning commonly understood by those skilled in the art as referring to the typical form of an organism, strain, or gene, or the characteristic that distinguishes it from mutant or variant forms when it exists in nature, is separable from its natural source and has not been intentionally modified by humans.

[0209] Derivatization

[0210] As used herein, the term "derivation" refers to the chemical modification of an amino acid, polypeptide, or protein in which one or more substituents are covalently linked to the amino acid, polypeptide, or protein. Substituents may also be referred to as side chains.

[0211] A derivatized protein is a derivative of the original protein. Generally, the derivatization of a protein does not adversely affect its desired activity (e.g., activity to bind to guide RNA, endonuclease activity, activity to bind to and cleave a target sequence at a specific site under the guidance of guide RNA). In other words, the derivative of a protein has the same activity as the original protein.

[0212] Derivatized proteins

[0213] Also known as "protein derivatives," these are modified forms of proteins, where one or more amino acids of the protein may be deleted, inserted, modified, and / or substituted.

[0214] Not naturally occurring

[0215] As used herein, the terms “non-naturally occurring” or “engineered” are used interchangeably and indicate artificial involvement. When these terms are used to describe nucleic acid molecules or peptides, they indicate that the nucleic acid molecule or peptide is at least substantially free from at least one other component bound to it, either naturally occurring or found in nature.

[0216] Orthologue (ortholog)

[0217] As used herein, the term "orthologue" has the meaning commonly understood by those skilled in the art. As further guidance, an "orthologue" of a protein, as described herein, refers to a protein belonging to a different species that performs the same or similar function as the protein that is its orthologue.

[0218] identity

[0219] As used herein, the term "identity" refers to the sequence matching between two polypeptides or two nucleic acids. Two compared sequences are identical at a position when the same base or amino acid monomeric subunit occupies the same location (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if six out of ten positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT have 50% identity (three out of six positions match). Typically, two sequences are compared to produce the maximum identity. Such comparisons can be made using methods readily available, for example, computer programs such as the Align program (DNAstar, Inc.) Needleman et al. (1970) J. Mol. Biol. 48:443-453. The percentage identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) integrated into the ALIGN program (version 2.0), which uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (J MoI Biol. 48:444-453 (1970)) in the GAP program integrated into the GCG software package (available at www.gcg.com), which uses a Blossum 62 matrix or a PAM250 matrix, along with gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0220] carrier

[0221] The term "vector" refers to a nucleic acid molecule capable of delivering another nucleic acid molecule linked to it. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules including one or more free ends, or without free ends (e.g., circular); nucleic acid molecules including DNA, RNA, or both; and a wide variety of other polynucleotides known in the art. A vector can be introduced into a host cell through transformation, transduction, or transfection, thereby enabling the expression of its carried genetic material elements in the host cell. A vector can be introduced into a host cell to produce transcripts, proteins, or peptides, including proteins, fusion proteins, isolated nucleic acid molecules, etc., as described herein (e.g., CRISPR transcripts, such as nucleic acid transcripts, proteins, or enzymes). A vector may contain a variety of elements controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may contain a replication initiation site.

[0222] One type of vector is a "plasmid," which is a circular double-stranded DNA loop into which another DNA fragment can be inserted, for example, using standard molecular cloning techniques.

[0223] Another type of vector is the viral vector, in which a virus-derived DNA or RNA sequence is present in a vector used to package the virus (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also contain polynucleotides carried by the virus used for transfection into a host cell. Some vectors (e.g., bacterial vectors with bacterial origins of replication and episodic mammalian vectors) are capable of autonomous replication in the host cells into which they are introduced.

[0224] Other vectors (e.g., non-attachment mammalian vectors) integrate into the host cell's genome upon introduction and thereby replicate along with the host genome. Furthermore, some vectors are capable of directing the expression of genes they are operatively linked to. Such vectors are referred to herein as "expression vectors."

[0225] host cells

[0226] As used herein, the term “host cell” refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, and eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.

[0227] Those skilled in the art will understand that the design of expression vectors can depend on factors such as the selection of host cells to be transformed and the desired expression level.

[0228] Control element

[0229] As used herein, the term "regulatory element" is intended to include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences), for which detailed description can be found in Goeddel, *Gene Expression Technology: Methods in Enzymology*, 185, Academic Press, San Diego, California (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells and those sequences that direct expression of that nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., lymphocytes). In some cases, regulatory elements can also be directed to express in a time-dependent manner (such as in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In some cases, the term "regulatory element" covers enhancer elements such as WPRE; CMV enhancer; R-U5' fragment in the LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0230] promoter

[0231] As used herein, the term "promoter" has the meaning known to those skilled in the art, referring to a non-coding nucleotide sequence located upstream of a gene that initiates the expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when the cell is a cell of the tissue type corresponding to that promoter.

[0232] NLS

[0233] A “nuclear localization signal” or “nuclear localization sequence” (NLS) is an amino acid sequence that “tags” a protein to allow it to be transported to the nucleus via nuclear transport; that is, a protein with an NLS is transported to the nucleus. Typically, an NLS contains positively charged Lys or Arg residues exposed on the protein surface. Exemplary nuclear localization sequences include, but are not limited to, NLS from the following: SV40 large T antigen, EGL-13, c-Myc, and TUS protein. In some embodiments, the NLS contains the PKKKRKV sequence. In some embodiments, the NLS contains the AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS contains the PAAKRVKLD sequence. In some embodiments, the NLS contains the MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS contains the KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP A1, the KIPIK sequence in the yeast transcriptional repressor Matα2, and PY-NLS.

[0234] Operable connection

[0235] As used herein, the term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to one or more regulatory elements in a manner that allows the expression of that nucleotide sequence (e.g., in an in vitro transcription / translation system or in the host cell when the vector is introduced into the host cell).

[0236] Complementarity

[0237] As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence via conventional Watson-Crick or other non-conventional types. The percentage of complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Complete complementarity" means that all consecutive residues in a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, “substantially complementary” refers to a complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% in a region having 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids hybridizing under stringent conditions.

[0238] Strict conditions

[0239] As used herein, “strict conditions” for hybridization refer to conditions under which a nucleic acid complementary to the target sequence hybridizes primarily with the target sequence and substantially does not hybridize to non-target sequences. Strict conditions are typically sequence-dependent and vary depending on many factors. Generally, the longer the sequence, the higher the temperature at which it specifically hybridizes to its target sequence.

[0240] Hybridization

[0241] The terms “hybridization” or “complementary” or “substantially complementary” refer to nucleic acids (such as RNA, DNA) containing nucleotide sequences that enable them to bind non-covalently, that is, to form base pairs and / or G / U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., nucleic acid-specific binding of complementary nucleic acids), also known as “annealing” or “hybridization”.

[0242] Hybridization requires two nucleic acids to contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on their length and degree of complementarity, variables well known in the art. Typically, hybridizable nucleic acids are 8 nucleotides or longer (e.g., 10 nucleotides or longer, 12 nucleotides or longer, 15 nucleotides or longer, 20 nucleotides or longer, 22 nucleotides or longer, 25 nucleotides or longer, or 30 nucleotides or longer).

[0243] It should be understood that the sequence of a polynucleotide does not need to be 100% complementary to the sequence of its target nucleic acid for specific hybridization. The polynucleotide may contain 60% or higher, 65% or higher, 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 98% or higher, 99% or higher, 99.5% or higher, or have 100% sequence complementarity with the target region of the target nucleic acid sequence it hybridizes with.

[0244] Hybridization of the target sequence with gRNA means that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleic acid sequences of the target sequence and gRNA can hybridize to form a complex; or it means that at least 12, 15, 16, 17, 18, 19, 20, 21, 22, or more bases of the nucleic acid sequences of the target sequence and gRNA can complement each other to form a complex.

[0245] Express

[0246] As used herein, the term "expression" refers to the process by which a DNA template is transcribed into polynucleotides (such as mRNA or other RNA transcripts) and / or the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides can be collectively referred to as "gene products." If the polynucleotides are derived from genomic DNA, expression can include the splicing of mRNA in eukaryotic cells.

[0247] connector

[0248] As used herein, the term "linker" refers to a linear polypeptide formed by the linkage of multiple amino acid residues via peptide bonds. The linkers of this invention can be synthetically produced amino acid sequences or naturally occurring polypeptide sequences, such as polypeptides with hinge region functions. Such linker polypeptides are well known in the art (see, for example, Holliger, P. et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ et al. (1994) Structure2:1121-1123).

[0249] treat

[0250] As used in this article, the term "treatment" means to treat or cure a disease, to delay the onset of symptoms of a disease, and / or to slow the progression of a disease.

[0251] Subjects

[0252] As used herein, the term “subject” includes, but is not limited to, various animals, plants and microorganisms.

[0253] animal

[0254] For example, mammals, such as bovids, equines, sheep, suidae, canines, felines, lagos, rodents (e.g., mice or rats), non-human primates (e.g., macaques or cynomolgus monkeys), or humans. In some embodiments, the subject (e.g., a human) suffers from a condition (e.g., a condition caused by a disease-related gene defect).

[0255] plant

[0256] The term "plant" should be understood as any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturity or development, particularly monocotyledonous or dicotyledonous plants, vegetable crops including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, longleaf lettuce), bok choy, taro, cucurbits (e.g., melons, watermelons, crenshaw, cantaloupes, Roman melons), rapeseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, headless cabbage, Chinese cabbage, bok choy), artichokes, carrots, napa cabbage, okra, onions, celery, parsley, chickpeas, parsnip, chicory, peppers, potatoes, gourds (e.g., zucchini, cucumbers, baby zucchini, squash, pumpkin), radishes, dried artichokes, etc. Onions, turnips, purple eggplant (also known as eggplant), ginseng, lettuce, scallions, chicory, garlic, spinach, green onions, squash, leafy greens, beets (sugar beets and fodder beets), sweet potatoes, romaine lettuce, wasabi, tomatoes, turnips, and spices; fruits and / or vine crops such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus fruits, blueberries, boysenberry. y), cranberries, currants, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pears, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, miscanthus, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas, soybeans). Oil-bearing plants (rapeseed, mustard, poppy, olive, sunflower, coconut, castor oil plants, cocoa beans, peanuts), Arabidopsis, fiber plants (cotton, flax, hemp, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugarcane, tea, and natural rubber plants; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, and trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0257] Beneficial effects of the invention

[0258] This invention discovers a novel Cas enzyme. Blast results show that the Cas enzyme of this application has low similarity to previously reported Cas enzymes, belonging to a new class of Cas proteins with broad application prospects.

[0259] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings and examples. However, those skilled in the art will understand that the following drawings and examples are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description of the drawings and preferred embodiments. Attached Figure Description

[0260] Figure 1 Cas-sf4274 single-stranded nucleic acid detection results.

[0261] Figure 2 Cas-sf2201 detection results for single-stranded nucleic acids.

[0262] Figure 3 Cas-sf2771 results for single-stranded nucleic acid detection.

[0263] Figure 4 The PAM structure of Cas-sf4274.

[0264] Figure 5 The PAM structure of Cas-sf2201.

[0265] Figure 6 The PAM structure of Cas-sf2771.

[0266] Figure 7 The cleavage results of Cas-sf4274 on double-stranded nucleic acids.

[0267] Figure 8 The cleavage results of double-stranded nucleic acids by Cas-sf2201.

[0268] Figure 9 The cleavage results of Cas-sf2771 on double-stranded nucleic acids.

[0269] Figure 10 The cleavage results of double-stranded nucleic acids by Cas-sf2586.

[0270] Figure 11 The location where Cas-sf4274 cleaves the target nucleic acid.

[0271] Figure 12 The location where Cas-sf2201 cleaves the target nucleic acid.

[0272] Figure 13 The location where Cas-sf2771 cleaves the target nucleic acid.

[0273] Figure 14 The location where Cas-sf2586 cleaves the target nucleic acid.

[0274] Figure 15 Cutting efficiency of Cas-sf4274 complementary chain (TS) and non-complementary chain (NTS).

[0275] Figure 16 Cutting efficiency of Cas-sf2201 complementary chain (TS) and non-complementary chain (NTS).

[0276] Figure 17 Cutting efficiency of Cas-sf2771 complementary chain (TS) and non-complementary chain (NTS).

[0277] Figure 18 Cutting efficiency of Cas-sf2586 complementary chain (TS) and non-complementary chain (NTS).

[0278] Figure 19 Sequencing results of target genes edited by Cas-sf2201 in eukaryotic cells.

[0279] Sequence information

[0280] Detailed Implementation

[0281] The following examples are for illustrative purposes only and are not intended to limit the invention. Unless otherwise specified, the experiments and methods described in the examples are generally performed according to conventional methods well known in the art and described in various references. For example, conventional techniques such as immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA used in this invention can be found in Sambrook, Fritsch, and Maniatis, *Molecular Cloning: A Laboratory Manual*, 2nd edition (1989); *Current Protocols in Molecular Biology* (edited by FM. Ausubel et al., (1987)); and the *Methods in Enzymology* series (academic publishing company): *PCR 2: A PRACTICAL*. APPROACH (edited by MJ MacPherson, BD Hames and GR Taylor (1995)), Harlow and Lane (1988) Antibodies, A Laboratory Manual, and Animal Cell Culture (edited by R.R. Freshney (1987)).

[0282] Furthermore, unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. Those skilled in the art will understand that the examples are described by way of illustration and are not intended to limit the scope of protection claimed by the invention. All disclosures and other references mentioned herein are incorporated herein by reference in their entirety.

[0283] Example 1. Obtaining the Cas protein

[0284] The inventors analyzed the metagenomics of uncultured organisms and identified four new Cas enzymes through redundancy removal and protein clustering analysis. Blast results showed that the Cas proteins had low sequence similarity to previously reported Cas proteins, and in this invention, they were named Cas-sf2201, Cas-sf4274, Cas-sf2771, and Cas-sf2586. The amino acid sequences, encoding nucleic acid sequences, and codon-optimized nucleic acids of the above proteins are shown in Tables 1-3 below, and the homologous repeat sequences of the gRNAs corresponding to the above different proteins are shown in Table 4.

[0285] Table 1. Amino acid sequence of Cas protein

[0286]

[0287]

[0288] Table 2. Nucleic acid sequence of Cas protein

[0289]

[0290]

[0291]

[0292]

[0293]

[0294]

[0295] Table 3. Nucleic acid sequences after codon optimization for the Cas protein

[0296]

[0297]

[0298]

[0299]

[0300]

[0301]

[0302] Table 4. Direct repeat sequences of gRNA corresponding to Cas protein

[0303]

[0304] Example 2. Application of Cas-sf4274 protein in nucleic acid detection

[0305] This embodiment verifies the trans-cleavage activity of Cas-sf4274 through in vitro detection. In this embodiment, gRNA that can pair with the target nucleic acid guides the Cas-sf4274 protein to recognize and bind to the target nucleic acid; subsequently, the Cas-sf4274 protein is activated to trans-cleave any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector in the system; the single-stranded nucleic acid detector has a fluorescent group and a quencher group at both ends, respectively, which will excite fluorescence if the single-stranded nucleic acid detector is cleaved; in other embodiments, the two ends of the single-stranded nucleic acid detector can also be labeled with colloidal gold that can be detected.

[0306] In this embodiment, the target nucleic acid was selected as single-stranded DNA, NB-i3g1-ssDNA0, whose sequence is: CGACATTCCGAAGAACGCTGAAGCGCTGGGGGCAAATTGTGCAATTTGCGGC.

[0307] The gRNA sequence is: GUUGCAAUGCCUAAUCAAAUUGUGUCGAUAUGGACAC CCCCCAGCGCUUCAGCGUUC (The underlined area represents the region of the target nucleic acid.)

[0308] The single-stranded nucleic acid reporter molecule sequence is FAM-TTATT-BHQ1;

[0309] The following reaction system was used: Cas-sf4274 final concentration 100 nM, gRNA final concentration 200 nM, target nucleic acid final concentration 200 nM, and single-stranded nucleic acid reporter molecule final concentration 500 nM. Incubation was performed at 37°C, and FAM fluorescence was read every 20 seconds. The control group did not contain any target nucleic acid.

[0310] like Figure 1 As shown, compared to the control without target nucleic acid, Cas-sf4274 can cleave the single-stranded nucleic acid reporter molecule used for detection in the presence of target nucleic acid, and quickly report fluorescence; in the absence of target nucleic acid, the fluorescence signal remains unchanged. These experiments demonstrate that, in conjunction with a single-stranded nucleic acid reporter molecule, Cas-sf4274 can be used for the detection of target nucleic acids. Figure 1 In the diagram, 1 represents the experimental group with added target nucleic acid, and 2 represents the control group without added target nucleic acid.

[0311] Example 3. Application of Cas protein in nucleic acid detection

[0312] Using the same method as in Example 2, the application of Cas-sf2201 and Cas-sf2771 in nucleic acid detection was verified.

[0313] The results of Cas-sf2201 are as follows Figure 2 As shown, compared to the control without target nucleic acid, Cas-sf2201 can cleave the single-stranded nucleic acid reporter molecules used for detection in the presence of target nucleic acid, rapidly reporting fluorescence; in the absence of target nucleic acid, the fluorescence signal remains unchanged. The results for Cas-sf2771 are as follows... Figure 3 As shown, compared to the control without target nucleic acid, Cas-sf2771 can cleave the single-stranded nucleic acid reporter molecule used for detection in the presence of target nucleic acid, and quickly report fluorescence; in the absence of target nucleic acid, the fluorescence signal remains unchanged. These experiments demonstrate that, in conjunction with a single-stranded nucleic acid reporter molecule, Cas-sf2201 and Cas-sf2771 can be used for the detection of target nucleic acids. Figure 2 , 3 In the diagram, 1 represents the experimental group with added target nucleic acid, and 2 represents the control group without added target nucleic acid.

[0314] Example 4. PAM identification of Cas-sf4274 protein

[0315] Construction of the Cas-sf4274 protein expression plasmid: After optimizing the nucleic acid sequence with human codons, the gene was synthesized and ligated into the *E. coli* expression vector PeT28(a)+. The JM23119 promoter was added to the PeT28(a)+-Cas-sf4274 vector to initiate Cas-sf4274 gRNA transcription. The resulting vector was: PeT28(a)+-Cas-sf4274-JM23119-gRNA, with the gRNA sequence: GUUGCAAUGCCUAAUCAAAUUGUGUCGAUAUGGACACAC UCCCCUACGUGCUGCUGAAGUUGC Underlined sequences represent target sequences; PAM library construction: Synthetic sequence CGTGTTTCGTAAAGTCTGGAAACGCGGAAGCCCCCAGCGCTTCAGCGTTCNNNNNN TCCCCTACGTGCTGCTGAAGTTGC CCGCAA, where N represents a random deoxyribonucleotide, and the underlined sequence is the target sequence. After being filled with Klenow enzyme, it was ligated into the pcyc184 vector. Following transformation into E. coli, plasmids were extracted to form a PAM library.

[0316] PAM library subtraction experiment: Competent cells were prepared: BL21(DE3)-PeT28(a)+-Cas-sf4274-JM23119-gRNA. The PAM library plasmid was transformed into competent cells: BL21(DE3)-PeT28(a)+-Cas-sf4274-JM23119-gRNA, plated on LB agar plates containing kanamycin and chloramphenicol, and incubated overnight at 37°C. The cells were then collected, and the bacterial concentration was adjusted to OD600 ≤ 0.6-0.8. 0.2 mM IPTG was added, and the cells were induced at 37°C for 4 h. Plasmid extraction was performed using the FastPure EndoFree Plasmid Maxi Kit (vazyme) to obtain the subtracted PAM library. Primers: PAM-F: GGTCTTCGGTTTCCGTGTT; PAM-R: TGGCGTTGACTCTCAGTCAT. PCR was performed using a 30 ng / μL plasmid (PAM library) as template primers to obtain control group samples, and PCR was performed using a 30 ng / μL plasmid (subtracted PAM library) as template to obtain experimental group samples. Both control and experimental group samples were sent for next-generation sequencing for data analysis to obtain the PAM sequence of Cas-sf4274. Weblogo plotting revealed the PAM structure to be 5'-TTN-3', where N = A / T / C / G. Figure 4 As shown.

[0317] Example 5. PAM identification of Cas-sf2201 and Cas-sf2771 proteins

[0318] The PAM of Cas-sf2201 and Cas-sf2771 proteins was identified using the same method as in Example 4.

[0319] The PAM structure of Cas-sf2201 is 5'-TTH-3', where H=A / T / C, as shown below. Figure 5 As shown. The PAM structure of Cas-sf2771 is 5'-TTN-3', where N=A / T / C / G, as... Figure 6 As shown.

[0320] Example 6. Application of Cas-sf4274 protein in double-stranded nucleic acid editing

[0321] This embodiment describes the in vitro detection of the cis cleavage activity of Cas-sf4274 on double-stranded DNA. In this embodiment, gRNA that can pair with the target nucleic acid guides the Cas-sf4274 protein to recognize and bind to the target nucleic acid, thereby cleaving the target nucleic acid in the system. The cleaved target nucleic acid is then detected by agarose gel electrophoresis.

[0322] In this embodiment, the target nucleic acid was selected as double-stranded DNA (plasmid), 5spacer1-PAM, with the sequence: CATTAGATCTGTGTGGCCAANNN TCCCCTACGTGCTGCTGAAGTTGCThe vector T-Vector-pEASY-Blunt SimpleCloning Vector is inserted; the italicized part is the PAM sequence, N=A / T / C / G, and the underlined area is the target region.

[0323] gRNA:Cas-sf4274-5spacer1: GUUGCAAUGCCUAAUCAAAUUGUGUCGAUAUGGACAC UCCCC UACGUGCUGCUGAAG (The underlined area is the target area)

[0324] The following reaction system was used: 20 µL system, with a final concentration of Cas-sf4274 of 100 nM, gRNA of 200 nM, and double-stranded target nucleic acid of 5 ng / µL. Incubation was performed at 37 °C for 1 h and then at 85 °C for 20 min. The cleavage products were subjected to agarose gel electrophoresis to assess the Cas-sf4274 cleavage capacity. The experimental group received Cas-sf4274 protein, gRNA, and target nucleic acid, while the control group (CK) received no gRNA.

[0325] The results are as follows Figure 7 As shown, compared to the control group without gRNA, Cas-sf4274 was able to cleave double-stranded nucleic acids in the experimental group with PAM of 5'-TTN-3' (where N=A / T / C / G), exhibiting a clear cleavage band. This indicates that Cas-sf4274 can be used for the cleavage and editing of double-stranded target nucleic acids with PAM of 5'-TTN-3', where N=A / T / C / G.

[0326] Example 7. Application of Cas-sf2201, Cas-sf2771, and Cas-sf2586 proteins in double-stranded nucleic acid editing.

[0327] The cis cleavage activity of double-stranded DNA from Cas-sf2201, Cas-sf2771, and Cas-sf2586 was detected in vitro using the same method as in Example 4.

[0328] The results of the cis cleavage activity of the double-stranded DNA of the Cas-sf2201 protein are as follows: Figure 8 As shown, compared with the control group without gRNA, Cas-sf2201 was able to cleave double-stranded nucleic acids in the experimental group with PAM of 5'-TTN-3' (where N=A / T / C / G), showing obvious cleavage bands.

[0329] The results of the cis cleavage activity of the double-stranded DNA of the Cas-sf2771 protein are as follows: Figure 9 As shown, compared with the control group without gRNA, Cas-sf2771 was able to cleave double-stranded nucleic acids in the experimental group with PAM of 5'-TTN-3' (where N=A / T / C / G), showing obvious cleavage bands.

[0330] The results of cis cleavage activity of the double-stranded DNA of Cas-sf2586 protein are as follows: Figure 10 As shown, compared with the control group without gRNA, Cas-sf2586 was able to cleave double-stranded nucleic acids in the experimental groups with PAM of 5'-ATT-3' and 5'-ATC-3', showing obvious cleavage bands.

[0331] This indicates that Cas-sf2201 and Cas-sf2771 can be used for the cleavage and editing of double-stranded target nucleic acids with PAM of 5'-TTN-3' (where N=A / T / C / G), and Cas-sf2586 can be used for the cleavage and editing of double-stranded target nucleic acids with PAM of 5'-ATT-3' and 5'-ATC-3'.

[0332] Example 8. Cleavage characteristics of Cas-sf4274 protein - cleavage site

[0333] This embodiment uses in vitro detection to determine the cleavage sites of the Cas-sf4274 protein on the complementary strand (TS) and non-complementary strand (NTS) of double-stranded target nucleic acids. In this embodiment, gRNA guides the Cas-sf4274 protein to recognize and bind to the double-stranded target nucleic acid; the Cas protein then activates its Cis cleavage activity on the double-stranded target nucleic acid, thereby cleaving the double-stranded target nucleic acid in the system. The cleaved double-stranded target nucleic acid is then padded with A and ligated with a T-linked adapter. The ligation product is enriched by PCR and then Sanger sequenced.

[0334] In this embodiment, the target nucleic acid was selected as double-stranded DNA (plasmid), with the sequence: CATTAGTCTGTGTGGCCAATTC TCCC CTACGTGCTGCTGAAG TTGC is linked into the vector T-Vector-pEASY-Blunt Simple Cloning Vector. The italicized part is the PAM sequence, and the underlined area is the target region.

[0335] gRNA: Cas-sf4274-5spacer1: GUUGCAAUGCCUAAUCAAAUUGUGUCGAUAUGGACAC UCCCC UACGUGCUGCUGAAG (The underlined area is the target area).

[0336] The following reaction system was used: 50 µL of Cas-sf4274 100 nM, gRNA 250 nM, and double-stranded target nucleic acid 10 ng / µL (plasmid). Cas protein and gRNA were incubated at 25 °C for 10 min; then the double-stranded target nucleic acid was added, and the mixture was incubated at 37 °C for 1 h, followed by incubation at 85 °C for 5 min; 50 µL of 2X Taq DNA Polymerase Mix (Novizan) (1:1) was added to the above system, and the reaction was carried out at 72 °C for 30 min; the reaction solution was then recovered; 2 µL of annealed primer (2 µM) was added to the recovered liquid.

[0337] (TK-117: CGGCATTCCTGCTGAACCGCTCTTCCGATCT, TK-111: GATCGGAAGAGCGGTTCAGCAGGAATGCCG), T4 (NEB) ligase, 22℃, 1h. Take 10µL of the ligation product and perform PCR with primers S1-PAM-after: ACTCAGCGGCATTCCTGCTGAACCGC, PQ0275-F: CCGTATTACCGCCTTTGAG, and 2X Taq DNA Polymerase Mix (Novizan). Perform Sanger sequencing on the PCR product. Results are as follows. Figure 11 As shown, when the Cas-sf4274 protein cleaves the target nucleic acid, the cleavage sites are between 23-24, 28-29, and 30-31 nt of the NTS and between 22-23 nt of the TS. That is, the cleavage site of Cas-sf4274 on the complementary strand of the target sequence is between 22 and 23 nt at the 5' end of the PAM complementary sequence, and the cleavage site of Cas-sf4274 on the non-complementary strand of the target sequence is between 23 and 24 nt, or between 28 and 29 nt, or between 30 and 31 nt at the 3' end of the PAM sequence. The gRNA guides the Cas-sf4274 protein to recognize and bind to the aforementioned complementary strands, where the non-complementary strand is the DNA strand that pairs with the complementary strand.

[0338] Example 9. Cleavage characteristics and cleavage sites of Cas-sf2201, Cas-sf2771, and Cas-sf2586 proteins.

[0339] Using the same method as in Example 8, the positions where proteins Cas-sf2201, Cas-sf2771, and Cas-sf2586 cleave the complementary and non-complementary strands of double-stranded target nucleic acids were detected in vitro.

[0340] The results for the Cas-sf2201 protein are as follows: Figure 12As shown, when the Cas-sf2201 protein cleaves the target nucleic acid, the cleavage sites are between 25-26 and 28-29 nt of the NTS and between 22-23 nt of the TS. That is, the cleavage site of Cas-sf2201 on the complementary strand of the target sequence is between 22 and 23 nt at the 5' end of the PAM complementary sequence, and the cleavage site of Cas-sf2201 on the non-complementary strand of the target sequence is between 25 and 26 nt or between 28 and 29 nt at the 3' end of the PAM sequence. The gRNA guides the Cas-sf2201 protein to recognize and bind to the aforementioned complementary strands, where the non-complementary strand is the DNA strand that pairs with the complementary strand.

[0341] The results for Cas-sf2771 protein are as follows: Figure 13 As shown, when the Cas-sf2771 protein cleaves the target nucleic acid, the cleavage site is between 18-19 nt of the NTS and between 22-23 nt of the TS. That is, the cleavage site of Cas-sf2771 on the complementary strand of the target sequence is between 22 and 23 nt from the 5' end of the PAM complementary sequence, and the cleavage site of Cas-sf2771 on the non-complementary strand of the target sequence is between 18 and 19 nt from the 3' end of the PAM sequence. The gRNA guides the Cas-sf2771 protein to recognize and bind to the aforementioned complementary strand, which is the DNA strand that pairs with the complementary strand.

[0342] The results for the Cas-sf2586 protein are as follows: Figure 14 As shown, when the Cas-sf2586 protein cleaves the target nucleic acid, the cleavage site is between 24 and 25 nt of the NTS. That is, the cleavage site of Cas-sf2586 on the non-complementary strand of the target sequence is between 24 and 25 nt from the 3' end of the PAM sequence. The gRNA guides the Cas-sf2586 protein to recognize and bind to the aforementioned complementary strand, which is the DNA strand that pairs with the complementary strand.

[0343] Example 10. Cleavage characteristics of Cas-sf4274 protein - NTS / TS cleavage efficiency

[0344] This embodiment examines the cleavage efficiency of Cas-sf4274 on the complementary (TS) and non-complementary (NTS) strands of target nucleotide double-stranded DNA. The non-complementary (NTS) strand is labeled with 5'6-FAM, and the complementary (TS) strand with 5'ROX. gRNA guides the Cas-sf4274 protein to recognize and bind to the target nucleic acid, thereby cleaving the target nucleic acid in the system. The cleaved target nucleic acid is then detected by capillary electrophoresis (ABI 3730xl genetic analyzer). DNA fragments migrate from the cathode to the anode in the gel, arranged according to fragment length. When they reach the scanning window of the laser scanner at the anode end, the fluorescent dye is excited, emitting light of a specific wavelength, which is recorded according to the fluorescence intensity. The electrophoretic trajectory of each DNA fragment carrying the fluorescent dye is recorded according to the actual time it takes to pass through the laser scanning window, and each fragment is represented by a fluorescence absorption peak. The higher the peak value, the greater the quantity of the fragment; the time of peak appearance is directly related to fragment size, with smaller fragments appearing earlier. FAM fluorescence: The uncut NTS fragment size of Cas-sf4274 is 380 nt, and the fragment size after cleavage of the NTS by Cas-sf4274 is approximately 126 nt. ROX fluorescence: The uncut TS fragment size of Cas-sf4274 is 380 nt, and the fragment size after cleavage of the TS by Cas-sf4274 is approximately 254 nt. The fragment cleavage efficiency is calculated as: Cleavage efficiency = Cleavage peak area / (Cleavage peak area + Uncut peak area).

[0345] In this embodiment, the target nucleic acid was selected as double-stranded DNA (PCR product), and the primers were:

[0346] XQ0001-5FAM:GTATGTTGTGTGGAATTGTG5'6-FAM;

[0347] XQ0002-5ROX:GCTGCGCGTAACCACCACAC5'ROX

[0348] The amplified product sequence is: GTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTGCCCTTCATTAGATCTGTGTGGCCAATTC TCCCCTACGTGCTGCTGAAGTTGCAAGGGCAGCTTCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGC; The italicized portion represents the PAM sequence, and the underlined area represents the target region.

[0349] Cas-sf4274-5spacer1: GUGGGAACCCUUCCUGAUGGCUCGAUCCGUCGAGAC UCCCCUACGUG CUGCUGAAG (The underlined area is the target area)

[0350] The following reaction system was used: 20 µL system, Cas-sf4274 50 nM, gRNA 100 nM, and double-stranded target nucleic acid 1 µL (PCR product). Incubation was performed at 37 °C for 5 min, 15 min, 30 min, and 60 min, followed by incubation at room temperature for 20 min with proteinase K 1 ng / µl. Capillary electrophoresis (ABI 3730xl genetic analyzer) was used for FAM and ROX detection. Data analysis was performed using Gene Mapper 4.1 software to calculate the NTS / TS cleavage efficiency.

[0351] The results are as follows Figure 15 As shown, Cas-sf4274 preferentially cuts the NTS.

[0352] Example 11. Cleavage characteristics of Cas-sf2201, Cas-sf2771, and Cas-sf2586 proteins - NTS / TS cleavage efficiency Rate

[0353] Using the same method as in Example 10, the cleavage efficiency of proteins Cas-sf2201, Cas-sf2771, and Cas-sf2586 on the complementary (TS) and non-complementary (NTS) strands of target nucleotide double-stranded DNA was determined in vitro.

[0354] The results for the Cas-sf2201 protein are as follows: Figure 16 As shown, Cas-sf2201 simultaneously cuts TS / NTS.

[0355] The results for Cas-sf2771 protein are as follows: Figure 17 As shown, Cas-sf2771 preferentially cuts the NTS.

[0356] The results for the Cas-sf2586 protein are as follows: Figure 18 As shown, Cas-sf2586 preferentially cuts the NTS.

[0357] Example 12. Editing efficiency of Cas-sf4274 and Cas-sf2771 proteins in animal cells.

[0358] The gene editing activities of Cas-sf4274 and Cas-sf2771 were verified in animal cells. A target gR3 was designed for the FUT8 gene in Chinese hamster ovary cells (CHO): CAGCCAAGGTTGTGGACGGATCA. The vector pcDNA3.3 was modified to carry the ECFP fluorescent protein gene. The SV40 NLS-Cas-sf4274-NLS fusion protein was inserted via the BsmB1 restriction site; the U6 promoter and gRNA sequence were inserted via the Mfe1 restriction site. The CMV promoter initiated the expression of the SV40 NLS-Cas-sf4274-NLS-ECFP fusion protein. The Cas-sf4274-NLS protein and the ECFP protein were linked by the linker peptide T2A. The pUC19 vector was modified, and the EF-1α promoter initiated the expression of the tdTomato-T2A-GF(gR3)FP gene. After the Cas-sf4274 protein recognizes and edits the target gR3, the proportion of GFP-positive cells in CFP and tdTomato double-positive cells is analyzed as the Cas-sf4274 protein editing efficiency.

[0359] Plating: 293T cells were plated when the confluence reached 70-80%, and the number of cells seeded in a 12-well plate was 1.5*10^5 cells / well.

[0360] Transfection: Transfect cells after 12-24 hours of plating. Add 2 µl of Hieff Trans™ liposome nucleic acid transfection reagent to 100 µl opti-MEM, mix well, and incubate at room temperature for 5 minutes. Add 1 µg of plasmid (pcDNA3.3: pUC19 = 1:1) to 100 µl opti-MEM and mix well. Mix the diluted Hieff Trans™ liposome nucleic acid transfection reagent with the diluted plasmid and incubate at room temperature for 20 minutes. Add the incubated mixture to cell-coated culture medium for transfection. After 24 hours of transfection, replace the medium with normal medium and continue culturing for another 24 hours. Analyze using flow cytometry.

[0361] Analysis results show that the editing efficiency of Cas-sf4274 is 5.05%, while that of Cas-sf2771 is 0.04%.

[0362] Example 13. Editing efficiency of Cas-sf2201 protein in animal cells

[0363] The gene-editing activity of the Cas-sf2201 protein was validated in animal cells, with a target designed for the FUT8 gene in Chinese hamster ovary cells (CHO). The vector pcDNA3.3 was modified to carry EGFP fluorescent protein. The SV40 NLS-Cas-sf2201-NLS fusion protein was inserted via the BsmB1 restriction site; the U6 promoter and gRNA sequence were inserted via the Mfe1 restriction site. The CMV promoter initiated the expression of the SV40 NLS-Cas-sf2201-NLS-GFP fusion protein. The Cas-sf2201-NLS and GFP proteins were linked using the linker peptide T2A.

[0364] Plating: CHO cells are plated when the confluence reaches 70-80%, with a cell number of 8*10^4 cells / well in a 12-well plate.

[0365] Transfection: Transfect cells 12-24 hours after plating. Add 2 µg of plasmid to 100 µL opti-MEM and mix well. Add 4 µL TransIntro® EL Transfection Reagent (TRAN) to the diluted plasmid and incubate at room temperature for 15-20 min. Add the incubated mixture to the culture medium containing cells for transfection. Replace with normal culture medium 24 h after transfection, and GFP-positive cells are sorted by flow cytometry 48 h after transfection.

[0366] DNA extraction, PCR amplification of the region near the editing site, and hiTOM sequencing: Collected GFP-positive cells underwent genomic DNA extraction using a cell / tissue genomic DNA extraction kit (Biotech). The genomic DNA was amplified near the target site using primers PQ0106-FUT8-HiTom-F1: ggagtgagtacggtgtgCGAGTTCTGTTGCATGGTAGG; and PQ0106-FUT8-HiTom-R1: GAGTTGGATGCTGGATGGGCCAAGCTTCTTGGTGGTTTC. The PCR products were then sequenced using hiTOM (http: / / 121.40.237.174 / HiTOM / Sample_acceptance_sanyang.php).

[0367] Sequencing data analysis was conducted to statistically analyze the types and proportions of sequences within the target area, thereby obtaining the editing efficiency of the Cas-sf2201 protein at the target location.

[0368] CHO cell FUT8 gene target sequence: gR3-FUT8: TTC CAGCCAAGGTTGTGGACGGATCA The italicized portion is the PAM sequence, and the underlined area is the target region. The gRNA sequence is GUUGCAACGGCUGAGAAUUGCGUCUUCCGUUGACGCC AGCCAAGGUUGUGGACGGAUCA The underlined area is the target area.

[0369] Analysis showed that Cas-sf2201 achieved an editing efficiency of 5.18% in the target site gR3-Cas12i3-target-FUT8 of CHO cells, with the editing type being InDel. Partial sequencing results of the edited target nucleic acid are shown below. Figure 19 As shown.

[0370] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A Cas protein, characterized in that, The Cas protein is any one of the following Cas proteins described in I-III: I. The amino acid sequence of the Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with any of the sequences in SEQ ID No. 3-4, and substantially retains the biological function of the sequences from which it originated; II. The amino acid sequence of the Cas protein, compared with any of the sequences in SEQ ID No. 3-4, has one or more amino acid substitutions, deletions or additions, and essentially retains the biological function of the sequence from which it originated; III. The Cas protein contains any of the amino acid sequences shown in SEQ ID No. 3-4.

2. A fusion protein comprising the Cas protein of claim 1 and other modified portions.

3. An isolated polynucleotide, characterized in that, The polynucleotide is a polynucleotide sequence encoding the Cas protein of claim 1, or a polynucleotide sequence encoding the fusion protein of claim 2.

4. A carrier, characterized in that, The vector comprises the polynucleotide of claim 3 and a regulatory element operatively linked thereto.

5. A CRISPR-Cas system, characterized in that, The system comprises the Cas protein of claim 1 and at least one gRNA; The gRNA can bind to the Cas protein as described in claim 1.

6. A composition, characterized in that, The composition comprises: (i) A protein component selected from: the Cas protein of claim 1 or the fusion protein of claim 2; (ii) A nucleic acid component selected from: gRNA, or nucleic acid encoding gRNA, or precursor RNA of gRNA, or precursor RNA nucleic acid encoding gRNA, wherein the gRNA is capable of binding the Cas protein of claim 1; The protein components and nucleic acid components combine to form a complex.

7. An engineered host cell, characterized in that, The host cell comprises the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6.

8. The use of the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7 in any one or more of the following: gene editing, gene targeting, gene cutting, cutting double-stranded DNA, single-stranded DNA or single-stranded RNA, specifically editing double-stranded nucleic acids, base editing double-stranded nucleic acids, base editing single-stranded nucleic acids; Alternatively, in the preparation of formulations or kits for: gene editing, gene targeting, gene cutting, editing of target sequences in target loci to modify organisms, treatment of diseases, or targeting of target genes.

9. A method for editing, targeting, or cleaving a target nucleic acid, the method comprising contacting the target nucleic acid with the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7.

10. A kit for gene editing, gene targeting, or gene cutting, the kit comprising the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7.