Structural variation molecular marker located on chromosome 6 of sow and related to lactation ability of sow and application of structural variation molecular marker
By detecting the structural variant molecular marker g.147139168_147139450del on pig chromosome 6, the problems of high cost and long cycle in assessing sow lactation capacity have been solved, enabling rapid identification of sow lactation capacity and accelerating the breeding process, thereby improving reproductive performance and economic benefits.
Patent Information
- Application Number
- CN202610017221.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-07
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies for assessing sow lactation capacity are costly, time-consuming, and easily affected by environmental and feeding management factors, resulting in slow genetic progress and failing to meet the growth needs of piglets.
A structural variant molecular marker, g.147139168_147139450del, located on chromosome 6 of pigs, is provided. The genotype of this marker is detected to identify the lactation trait of sows, and this marker is used for marker-assisted selection breeding to improve the lactation capacity of sows.
It enables rapid and accurate identification and breeding of sow lactation traits, significantly improving sow reproductive performance and economic benefits, and shortening the breeding process.
Smart Images

Figure CN122012723A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic breeding technology and relates to molecular markers of structural variations on chromosome 6 of pigs that are related to sow lactation capacity and their applications. Background Technology
[0002] Pigs are the most important of the six domestic animals and a core source of animal protein in daily life. With the rapid development of large-scale, intensive pig farming, there is a saying in the industry that "whoever controls the sows controls the market." Pigs Weaned Per Year (PSY) has become the primary indicator for measuring the economic benefits of pig farms, and lactation capacity is the key factor determining PSY. The level of sow lactation capacity directly affects the weaning weight, survival rate, and subsequent growth potential of piglets, thus significantly impacting the reproductive performance of the entire pig herd and the economic benefits of the farm. Currently, sow milk production cannot meet the maximum growth needs of piglets, and in traditional breeding, lactation capacity is mainly assessed based on the number of weaned piglets and weaning litter weight. This method is not only costly and time-consuming, but also easily affected by various factors such as environment and feeding management, resulting in slow genetic progress. Summary of the Invention
[0003] The purpose of this invention is to provide a structural variation molecular marker located on chromosome 6 of pigs that affects the lactation capacity of sows and its application.
[0004] According to one aspect of the present invention, a molecular marker for structural variation associated with sow lactation capacity located on chromosome 6 of pigs is provided. This marker is a 283 bp DNA fragment (named g.147139168_147139450del) with a nucleotide sequence as shown in SEQ ID NO:1, deleted after the 147139167 bp site on chromosome 6 of the International Pig Reference Genome Version 11.1. Its genotype is denoted as A / A, A / DEL, or DEL / DEL.
[0005] The deletion structural variant provided by this invention leads to significant differences in lactation capacity in sows. The deletion structural variant occurring after the 147139167 bp site on chromosome 6 results in a significant decrease in lactation capacity in sows. Specifically, sows carrying g.147139168_147139450del have significantly lower total litter weight gain at 7 days of age than sows not carrying g.147139168_147139450del. Therefore, the 7-day litter weight gain and lactation capacity traits in pigs can be identified by detecting the molecular marker of this structural variant, i.e., detecting whether a pig carries g.147139168_147139450del, or by identifying the genotype of this structural variant molecular marker.
[0006] According to a second aspect of the present invention, an application is provided for detecting products containing structurally variable molecular markers of the present invention, the application comprising at least one of the following items (1) to (6): (1) Identify the total litter weight gain of pigs at 7 days of age; (2) Prepare products for identifying the total litter weight gain of pigs at 7 days of age; (3) Identify the lactation capacity trait of pigs; (4) Prepare products for identifying the lactation performance traits of pigs; (5) Pig genetic improvement, based on the selection of pigs with structural variation molecular marker genotype A / A to improve the total litter weight gain and milk production at 7 days of age; (6) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of the genotype of the structural variant molecular marker of the present invention to assist in the genetic improvement of pigs.
[0007] In some embodiments, the product for detecting the structurally variable molecular markers of the present invention may include at least one of the following: reagents, kits, chips, and devices for detecting the structurally variable molecular markers of the present invention.
[0008] In some embodiments, the reagents used to detect the structurally variable molecular markers of the present invention may include at least one of the following: primers or probes for detecting the structurally variable molecular markers of the present invention.
[0009] In some implementations, the pig is a Large White pig.
[0010] According to a third aspect of the present invention, a primer pair for detecting the structurally variable molecular marker of the present invention is provided, the primer pair comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:3 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:4.
[0011] According to a fourth aspect of the present invention, a kit for detecting molecular markers of structural variations of the present invention is provided, the kit comprising primer pairs with nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:4.
[0012] In some embodiments, the kit for detecting the structural variation molecular markers of the present invention may further include: dNTPs, DNA polymerase, and Mg. 2+ Components of a conventional PCR reaction system, such as PCR reaction buffer.
[0013] According to a fifth aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the molecular markers of structural variations in pigs located on chromosome 6 that are associated with sow lactation capacity; (2) Select individuals with the molecular marker genotype A / A for structural variation and eliminate mutant individuals with deletion structural variation after the 147139167bp site on chromosome 6 (i.e., genotypes A / DEL and DEL / DEL) to increase the frequency of wild-type individuals (i.e., genotype A / A) in the population generation by generation, thereby improving the lactation capacity of offspring pigs, increasing the reproductive performance of sows, and improving the economic benefits of breeding.
[0014] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.
[0015] In some implementations, the pig in step (1) is a Large White pig.
[0016] In some implementations, step (1), determining the genotype of a structural variant molecular marker on sow chromosome 6 that is associated with sow lactation capacity, includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:4. The amplification products were sequenced, and the presence of deletion-type structural variations in the pigs was determined based on the sequencing results. The genotype of the molecular marker of the structural variation related to sow lactation capacity located on chromosome 6 of pigs was determined.
[0017] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention provides a molecular marker g.147139168_147139450del, a structural variation on chromosome 6 of pigs that is associated with sow lactation capacity, and verifies its effect on sow lactation capacity. This helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of sow lactation capacity, improve the breeding process of French Large White and its synthetic lines, and shorten the generation interval.
[0018] (2) This invention provides a primer pair that can be used to detect molecular markers of structural variations related to sow lactation capacity located on chromosome 6 of pigs. This primer pair can be used to accurately identify whether the pigs being tested carry g.147139168_147139450del. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established, enabling rapid and accurate selection of traits and accelerating the breeding process. Applying it to the genetic improvement program of sow lactation capacity can significantly improve sow lactation capacity, thereby increasing the profits of breeding enterprises and enhancing their core competitiveness. Attached Figure Description
[0019] Figure 1Manhattan plot for genome-wide association (GWAS) analysis of lactation capacity in French Large White sows on chromosome 6; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log P value; Figure 2 This is a box plot showing the results of phenotypic analysis of lactation capacity differences in sows of different genotypes; among them, * express P <0.05, ** express P <0.01, *** express P <0.001. Detailed Implementation
[0020] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.
[0021] Example 1: Identification and Validation of Molecular Markers for Structural Variations Related to Sow Lactation Capacity (1) Experimental pig herd The experimental pig herd used in this invention consisted of 98 purebred French Large White sows from Guangdong Guangken Livestock Group Co., Ltd., which were the core herd of the breeding pig division. The herd's pedigree was recorded in detail, and the pigs were raised under uniform standards. The pigs had free access to feed and water, and the feeding methods and rearing conditions were all conventional.
[0022] (2) Phenotypic measurement This invention uses total litter weight gain (kg) at 7 days of age as an indicator of lactation capacity. Since total litter weight gain at 7 days of age is affected by piglet mortality, introduction, and emigration, to ensure the accuracy of the lactation phenotype, this invention sets the formula for determining lactation capacity as follows: Lactation capacity (kg) = Total litter weight gain at 7 days of age (kg) = Piglet weight at pen (7-day weight - Birth weight) + Death weight (Death weight - Birth weight) + Introduction weight (7-day weight - Piglet weight at introduction) + Exit weight (Exit weight - Birth weight).
[0023] This invention measured the weight data of 1649 piglets at different stages. Ear samples from sows were collected and stored in cryovials at -80°C.
[0024] (3) Extraction of porcine genomic DNA Ear tissue samples from each French Large White pig were collected to extract whole-genome DNA using the standard phenol-chloroform method. The DNA from the purebred French Large White population was then analyzed and its concentration determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, all acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.
[0025] (4) Genotyping of structural variations in pigs The BGI Genomics DNBSEQ-T7 sequencing platform, with a sequencing depth of 15x, yielded 181,591 structural variant sites in FASTQ format. PLINK v1.9 was used for quality control of the obtained genotype data, removing structural variants with a detection rate <85%, a mimor allelic frequency (MAF) <5%, and those located at unknown positions or on sex chromosomes. The remaining 82,274 structural variants and 98 samples were used for subsequent data analysis.
[0026] (5) Genome-wide association analysis (GWAS) Because kinship and population stratification effects can cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis. Principal component analysis (PCA) is then performed using GCTA software, with the first five principal components and parity used as covariates to correct for population structure. Finally, GWAS analysis is conducted using a univariate mixture model within GCTA software. This invention references the significance threshold at the human chromosome level, setting the chromosome significance threshold to 1.2155 × 10⁻⁶. -5 (i.e., 1 / 82274).
[0027] GWAS analysis results are as follows Figure 1 As shown.
[0028] from Figure 1 It is known that in French Large White pigs, there is a structural variant on chromosome 6 that significantly affects the sow's lactation capacity (total litter weight gain at 7 days of age). This variant is a deletion variant, and the strongest associated structural variant is g.147139168_147139450del. P =4.25×10 -6 This corresponds to the deletion mutation that occurs at position 147139167 bp on chromosome 6, between 147139168 bp and 147139450 bp, in the International Pig Reference Genome Version 11.1.
[0029] (6) Analyze the association between different genotypes and the lactation capacity (total litter weight gain at 7 days of age) phenotype of French Large White sows to verify the effect of the structural variant molecular marker g.147139168_147139450del on the lactation capacity (total litter weight gain at 7 days of age) trait of sows. The results are shown in Table 1. Figure 2 As shown.
[0030] As shown in Table 1, the 283 bp DNA fragment deleted after the 147139167 bp site on chromosome 6 is significantly correlated with the sow's lactation capacity (total litter weight gain at 7 days of age). P The value <0.01 indicates that this molecular marker significantly affects the lactation capacity of sows. By using assisted selection on this structural variation in pigs, the lactation capacity of sows in this population can be improved, thereby accelerating the breeding process of breeding pigs and improving reproductive performance.
[0031] Additionally, according to Table 1, Figure 2 Furthermore, it was found that wild-type individuals with genotype A / A had a higher average milk production capacity than mutant individuals with genotype A / DEL, and mutant individuals with genotype A / DEL had a higher average milk production capacity than mutant individuals with genotype DEL / DEL. This indicates that the wild type is the dominant genotype for milk production in sows. Selecting wild-type individuals with genotype A / A during the breeding process can progressively improve the milk production capacity of sows in the population, significantly improve sow reproductive performance, increase meat yield in the commercial pig herd, bring greater economic benefits to pig farming enterprises, and enhance their core competitiveness.
[0032] Table 1. Correlation analysis between structural variation molecular markers and traits
[0033] (7) Effect analysis This invention provides a structural variation molecular marker that can significantly improve the lactation capacity of French Large White pigs. Using this molecular marker for marker-assisted selection can greatly accelerate the breeding process of sows' lactation capacity. If individuals with genotypes A / DEL and DEL / DEL mutants affecting the sow's lactation capacity trait are bred into wild-type individuals with genotype A / A, the lactation capacity of each sow can be increased by 2.57–6.02 kg. This not only improves sow lactation capacity but also provides higher reproductive performance and meat yield, effectively improving the economic benefits of livestock farming enterprises.
[0034] Example 2: Methods for genetic improvement of pigs The nucleotide sequence of the target fragment containing the g.147139168_147139450del variant site as shown in SEQ ID NO:1 is shown in SEQ ID NO:2, and the primer pairs for its PCR amplification are shown in SEQ ID NO:3 and SEQ ID NO:4.
[0035] SEQ ID NO:2 AAGGAAATTTTAAACTGCCAGCTAAAGTAGCATTAAA AATGACCAGACATCAGAGTTCCTGTCGTGGCG CAGTGGTTAACGAATCCGACTAGGAACCATGAGGTTGAGGGTTCGGTCCCTGCCCTTGCTCAGTGGGTTAACGATCC GGCATTGCCATGAGCTGTGGTGTAGGTTGCAGACGCGGCTTGGATCCTGCGTTGCTGTGGCTCTGGCGTAAGCTGGC AGCTACAGCTCCGATTCAACCCCTAGCCTGGGAACCTCCATATGCCGTGGGAGCGGCCCAAGAAATAGCAAAAAAAA CACAAACAAACAAAACAACA ACAAAATGACCAGACATCACTTTTTAGAGAATTTATAACATCTATATCTCAGTATTTCTGCCCTTGAAAAAGGCAGTTTATGCTCAGCTTAATCTCCTTGT The 283 bp sequence marked by underline in the sequence is the missing sequence (DEL sequence, SEQ ID NO:1); the bolded beginning and end of the sequence indicate the primer binding positions.
[0036] Upstream primer-F: 5'-AAGGAAATTTTAAACTGCCAGCT-3' (SEQ ID NO:3); Downstream primer-R: 5'- ACAAGGAGATTAAGCTGAGCA -3' (SEQ ID NO:4).
[0037] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of molecular markers for structural variations related to lactation in pigs. (1) Take ear tissue from pigs and extract the whole genome DNA of pigs according to the standard phenol-chloroform method. Then, perform quality testing and concentration determination on the extracted DNA.
[0038] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of a conventional PCR reaction system, such as PCR reaction buffer.
[0039] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.
[0040] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and gene fragments were measured in both forward and reverse reactions. Based on the sequencing results, it was determined whether the pigs under test had deletion-type structural variations, and the genotype of the molecular markers of structural variations in the pigs under test was determined.
[0041] S2. Select pigs with structural variation molecular marker genotype A / A as parents for breeding.
[0042] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.
Claims
1. A structural variant molecular marker located on chromosome 6 of pigs and associated with sow lactation capacity, characterized in that, The structural variation molecular marker is a DNA fragment deleted after the 147139167 bp site on chromosome 6 in International Pig Reference Genome Version 11.1; the nucleotide sequence of the DNA fragment is shown in SEQ ID NO:1; the genotype of the structural variation molecular marker is A / A, A / DEL, or DEL / DEL.
2. The application of the product containing the structural variation molecular marker according to claim 1, characterized in that, The application includes at least one of the following items (1) to (6): (1) Identify the total litter weight gain of pigs at 7 days of age; (2) Prepare products for identifying the total litter weight gain of pigs at 7 days of age; (3) Identify the lactation capacity trait of pigs; (4) Prepare products for identifying the lactation performance traits of pigs; (5) Pig genetic improvement, based on breeding pigs with the structural variation molecular marker genotype A / A to improve the total litter weight gain and / or lactation capacity at 7 days of age; (6) Prepare a product for assisting in the genetic improvement of pigs, said product being based on the identification of the genotype of the structural variant molecular marker to assist in the genetic improvement of pigs.
3. The application according to claim 2, characterized in that, The product for detecting the structurally variable molecular marker according to claim 1 includes at least one of the following: reagents, kits, chips, and devices for detecting the structurally variable molecular marker.
4. The application according to claim 3, characterized in that, The reagents used to detect the structurally variable molecular markers include at least one of the following: primers or probes for detecting the structurally variable molecular markers.
5. The application according to any one of claims 2 to 4, characterized in that, The pig in question is a Large White pig.
6. A primer pair for detecting the structurally variable molecular marker according to claim 1, characterized in that, The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:
4.
7. A kit for detecting structurally variable molecular markers according to claim 1, characterized in that, Its composition includes the primer pair as described in claim 6.
8. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the structural variation molecular marker in pigs according to claim 1; (2) Select individuals with structural variation molecular marker genotype A / A.
9. The method for genetic improvement of pigs according to claim 8, characterized in that, In step (1), the method for determining the genotype of the pig according to claim 1, includes the following steps: Whole-genome DNA was extracted from pigs and amplified by PCR using primer pairs with nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:
4. The amplified products were sequenced, and the genotype of the pig with the structural variation molecular marker according to claim 1 was determined based on the sequencing results.
10. The method for genetic improvement of pigs according to claim 8 or 9, characterized in that, The pig in question is a Large White pig.