CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats-associated 12a)-based nucleic acid detection kit as well as preparation and application methods thereof

Abstract

The invention relates to the technical field of nucleic acid molecule detection, and discloses a multiple nucleic acid detection kit based on CRISPR-Cas12a, the multiple nucleic acid detection kit comprises a plurality of fluorescence coding microspheres, and each fluorescence coding microsphere comprises a lipid membrane coated solid phase carrier microsphere, a lipid membrane coated solid phase carrier microsphere, a lipid membrane coated solid phase carrier microsphere and a lipid membrane coated solid phase carrier microsphere, the Cas12a / crRNA compound is embedded into the lipid membrane through hydrophobic interaction, and the 3'end of the crRNA is covalently connected with a cholesterol group; the fluorescent substrate probe is embedded into the lipid membrane through hydrophobic interaction and is single-stranded DNA, the 3'end of the fluorescent substrate probe is covalently connected with a cholesterol group, and the 5 'end of the fluorescent substrate probe is covalently connected with a fluorescent group. Different crRNA / Cas12a compounds and fluorescent substrate probes are jointly anchored on the surfaces of the microspheres with different optical codes, each microsphere corresponds to one specific target, multiple nucleic acid targets can be simultaneously detected in the same reaction system, and the detection flux and efficiency are remarkably improved.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid molecular detection technology, and in particular to a nucleic acid detection kit based on CRISPR-Cas12a and its preparation and application methods. Background Technology

[0002] CRISPR-Cas12a is a nuclease that, in the presence of guide RNA (crRNA), binds to the target DNA strand, activating its trans-cleavage activity and cleaving non-target single-stranded DNA in solution with extremely high efficiency, resulting in a significant signal amplification effect. CRISPR-Cas12a possesses numerous advantages, such as high catalytic efficiency, simple operation, and high stability, making it an excellent signal transduction and amplification tool that has been widely applied in the field of nucleic acid detection.

[0003] However, current CRISPR-Cas12a-based detection and diagnostic methods still face two major challenges: low sensitivity and poor multiplexing capability. To improve sensitivity, many existing methods pre-amplify the target using polymerase chain reaction (PCR) or isothermal amplification, significantly increasing the target concentration before adding the Cas enzyme. While pre-amplification significantly improves the sensitivity of CRISPR detection methods, it increases the complexity and detection time, and is susceptible to aerosol contamination, leading to nonspecific amplification and false positive signals. Regarding multiplexing capability, the trans-enzyme activity of Cas12a lacks sequence specificity, resulting in indiscriminate cleavage of the signal probe. Therefore, designing single-pot and multi-target CRISPR detection platforms for molecular diagnostics remains extremely challenging. Thus, developing a simple, pre-amplification-free, and single-pot multiplexing platform is crucial. Summary of the Invention

[0004] To address the technical problems mentioned in the background section, this invention provides a CRISPR-Cas12a-based amplification-free, highly sensitive multiplex nucleic acid detection kit and its preparation and application methods.

[0005] This invention is achieved using the following technical solution: One of the objectives of this invention is to propose a CRISPR-Cas12a-based multiplex nucleic acid detection kit, comprising various fluorescently encoded microspheres, wherein each fluorescently encoded microsphere contains:

[0006] Lipid membrane-coated solid-phase carrier microspheres;

[0007] The Cas12a / crRNA complex is embedded in the lipid membrane via hydrophobic interactions, wherein the 3' end of the crRNA is covalently linked to a cholesterol group.

[0008] The fluorescent substrate probe, which is embedded in the lipid membrane through hydrophobic interaction, is a single-stranded DNA with a cholesterol group covalently linked to its 3' end and a fluorescent group covalently linked to its 5' end.

[0009] The various fluorescently encoded microspheres are distinguished and encoded by at least one characteristic selected from the types of fluorescent groups, the fluorescence intensity reflected by the density of fluorescent substrate probe modification, and the size of solid-phase carrier microspheres, with each code corresponding to a specific target nucleic acid.

[0010] Furthermore, the solid-phase carrier microspheres are silica or polystyrene microspheres, the lipid membrane is a dioleoylphosphatidylcholine membrane, and the fluorescent group is selected from FAM, rhodamine, or Cy5.

[0011] Furthermore, the kit also includes a reaction buffer containing Tris-HCl or HEPES buffer, MnCl2, PEG-200, and dithiothreitol.

[0012] The second objective of this invention is to provide a method for preparing the aforementioned CRISPR-Cas12a-based multiplex nucleic acid detection kit, comprising the following steps:

[0013] S1. The liposome solution was mixed with the aqueous solution of solid-phase carrier microspheres and incubated to obtain lipid membrane-coated solid-phase carrier microspheres;

[0014] S2. Mix Cas12a protein with crRNA with a cholesterol group attached to its 3' end and incubate to form a Cas12a / crRNA complex;

[0015] S3. The Cas12a / crRNA complex obtained in step S2 is mixed and incubated with the lipid membrane-coated solid-phase carrier microspheres obtained in step S1, so that the complex is embedded in the lipid membrane through cholesterol groups;

[0016] S4. A single-stranded DNA substrate probe with a cholesterol group attached to its 3' end and a fluorescent group attached to its 5' end is mixed with the microspheres obtained in step S3 and incubated to allow the substrate probe to embed into the lipid membrane through the cholesterol group, thereby obtaining fluorescently encoded microspheres.

[0017] Furthermore, in step S1, the liposomes are dioleoylphosphatidylcholine liposomes, and the solid-phase carrier microspheres are silica or polystyrene microspheres.

[0018] Furthermore, in step S2, the molar ratio of Cas12a protein to crRNA is 1:1.2.

[0019] A third objective of this invention is to provide a nucleic acid detection method for non-diagnostic purposes, using the aforementioned kit, comprising the following steps:

[0020] a) Mix the suspension containing the various fluorescently encoded microspheres with the sample to be tested in the reaction buffer and let it stand;

[0021] b) Incubate at 40-50℃ for 0.5-1 hour to allow the target nucleic acid to bind to the corresponding crRNA / Cas12a complex and activate the trans-cleavage activity of Cas12a, thereby cleaving the fluorescent substrate probe on the fluorescently encoded microsphere.

[0022] c) Before and after incubation, fluorescence imaging was performed on the hybrid system to obtain the fluorescence signal of each type of microsphere;

[0023] d) Compare the fluorescence signals before and after incubation, and calculate the proportion of fluorescence signal disappearance for each type of microsphere, the proportion being related to the corresponding target nucleic acid concentration.

[0024] Furthermore, in step a), the reaction buffer is a solution containing Tris-HCl or HEPES buffer, MnCl2, PEG-200 and dithiothreitol.

[0025] Furthermore, in step c), imaging is performed using a fluorescence microscope, and statistical analysis is conducted on the fluorescence signal changes of at least 100 microspheres of the same type.

[0026] The fourth objective of this invention is to propose the application of a CRISPR-Cas12a-based multiplex nucleic acid detection kit in the preparation of products for non-diagnostic detection of pathogens, tumor genes, or viral nucleic acids.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] This invention anchors different crRNA / Cas12a complexes and fluorescent substrate probes onto the surface of microspheres with different optical codes. Each microsphere corresponds to a specific target, enabling the simultaneous detection of multiple nucleic acid targets in the same reaction system, which significantly improves detection throughput and efficiency.

[0029] This invention utilizes the close co-localization effect of Cas12a / crRNA and fluorescent substrate in the lipid membrane. Even after Cas12a is activated by extremely low concentrations of target nucleic acid, it can efficiently cleave the fluorescent probe on the same microsphere, achieving effective signal erasure and amplification. It can achieve a detection limit at the aM level without the need for pre-amplification.

[0030] The detection process proposed in this invention does not require complex instruments; signal reading can be completed using only a conventional fluorescence microscope. It maintains high recovery rate and stability in complex matrices such as serum and cell lysate, and is suitable for direct detection of a variety of real samples. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of a one-pot multiplex detection scheme based on CRISPR-Cas12a in an embodiment of the present invention;

[0032] Figure 2 This is a schematic diagram of 63 fluorescent microspheres encoded by three dimensions: fluorescence type, fluorescence intensity, and microsphere size, in an embodiment of the present invention.

[0033] Figure 3 This is a graph showing the relationship between the rate of change of fluorescent microsphere signal and the target DNA concentration (0 aM to 200 aM) in the embodiments of the present invention.

[0034] Figure 4 This is a heatmap of the detection results for all possible combinations (64 in total) of the six targets in this embodiment of the invention, showing the specific response of each coded microsphere. Detailed Implementation

[0035] The technical solution of the present invention will now be clearly and completely described with reference to the accompanying drawings. The described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0036] The core of the kit described in this invention lies in the preparation of various "fluorescently encoded microspheres". Each microsphere is an independent detection unit, and its structure is as follows: Figure 1 As shown: a solid-phase microsphere (such as silica or polystyrene microspheres) coated with a lipid membrane (such as a DOPC membrane) forms the substrate; the Cas12a / crRNA complex and the fluorescent substrate probe are embedded in the lipid membrane through their modified cholesterol groups via hydrophobic interactions. When target DNA is present in the sample, it binds to the corresponding crRNA / Cas12a complex and activates the trans-cleavage activity of Cas12a, efficiently cleaving the fluorescent substrate probe on the same microsphere, resulting in the "erasure" of the fluorescent signal of that microsphere. By designing different crRNA sequences and making the microspheres differ in fluorescence color, fluorescence intensity, and microsphere size, a large population of microspheres with unique "optical barcodes" can be constructed, with each barcode corresponding to a specific target, thus achieving one-pot multiplex detection.

[0037] Example 1: Preparation and sensitivity testing of a detection kit targeting a single target (EGFR gene)

[0038] 1. Preparation of fluorescently encoded microspheres

[0039] (1) Preparation of lipid membrane-coated silica microspheres: Dioleoylphosphatidylcholine (DOPC) was dissolved in chloroform to prepare a 0.5 mg / mL solution. 1 mL of this solution was placed in a glass bottle and dried with high-purity nitrogen gas to form a uniform lipid film at the bottom of the bottle. 1 mL of Tris-HCl buffer (10 mM, pH 7.5) was added to the bottle and sonicated at 4 °C for 10 minutes to form a nanoscale liposome solution. 1 mL of the liposome solution was mixed with 1 mL of aqueous solution of silica microspheres with a diameter of 10 μm (concentration of approximately 10^9 microspheres / mL), and gently shaken and incubated at 4 °C for 8 hours to allow the liposomes to fuse on the surface of the microspheres to form a complete DOPC lipid membrane. Subsequently, the mixture was centrifuged at 1500 rpm for 8 minutes, the supernatant was discarded, and the precipitate was resuspended in buffer to obtain membrane-coated silica microspheres.

[0040] (2) Assembly of the Cas12a / crRNA complex: The Cas12a protein was mixed with a crRNA designed for the human EGFR gene at a molar ratio of 1:1.2, wherein the 3' end of the crRNA was pre-modified with a cholesterol molecule. The crRNA sequence used was: Cholesterol-UCUCUCUCUUAAUUUCUACUAAGUGUAGAUACUCUGGAUCCCAGAAGGUG. The mixture was incubated at room temperature for 15 minutes to form the Cas12a / crRNA complex.

[0041] (3) Assembly of fluorescent microspheres: The membrane-coated silica microspheres (approximately 10^8) obtained in step (1) and the Cas12a / crRNA complex (final crRNA concentration 5 nM) obtained in step (2) were mixed in reaction buffer (20 mM HEPES, 5 mM MnCl2, 3% PEG-200, 3 mM DTT, pH 7.5) and incubated at room temperature for 40 minutes. Subsequently, a fluorescent substrate probe with the sequence: Cholesterol-TTTTTTTTTTTTTTTTTTTTTTTTTTATTT-Fam (5' end labeled with FAM fluorescent group) was added. The final probe concentration was 2 μM, and incubation was continued at room temperature for 40 minutes. Finally, the microspheres were centrifuged at 1500 rpm for 10 minutes to remove unbound components and washed twice with reaction buffer to obtain fluorescently encoded microspheres targeting EGFR (coding characteristics: 10 μm microspheres, FAM fluorescence).

[0042] 2. Target DNA Detection and Sensitivity Analysis

[0043] (1) Preparation and imaging of the reaction substrate: The microspheres were diluted with reaction buffer. 10 μL was added to a glass slide and allowed to stand at room temperature for 10 minutes to allow the microspheres to settle. First, an image of the microspheres before the reaction was taken using a fluorescence microscope (FAM channel). Figure 3(Left baseline), count the number of fluorescent microspheres in the field of view (>200).

[0044] (2) Target reaction: Add 1 μL of solution containing different concentrations of EGFR target DNA to the droplet. The target DNA sequence is: TTTAACTCTGGATCCCAGAAGGTG. The concentration gradient is set as follows: 0 aM (blank control), 1 aM, 10 aM, 100 aM, 1 fM, 10 fM. Place the slide in a humidified chamber and incubate at 45°C for 45 minutes.

[0045] (3) Signal reading and analysis: After incubation, the same area was photographed again. Figure 3 (Curves corresponding to each concentration). Compare the images before and after, identify and count the microspheres that lost fluorescence. Calculate the signal change rate using the formula: Signal change rate (%) = (Number of microspheres that lost fluorescence / Total number of initial fluorescent microspheres) × 100%.

[0046] (4) Results: such as Figure 3 As shown, the signal change rate increases with increasing target concentration. Even at extremely low concentrations of 10 aM, a clear signal can be observed. The calculated limit of detection (LOD) of this embodiment is approximately 2.4 aM, demonstrating the ultra-high sensitivity of this invention under amplification-free conditions.

[0047] Example 2: Construction and validation of a one-pot, six-fold nucleic acid detection kit:

[0048] This example demonstrates how to construct a multiplex detection kit using a multi-parameter encoding strategy and validate its specificity. We designed crRNAs targeting six different targets and prepared six microspheres with different optical encodings.

[0049] 1. Preparation of six types of fluorescently encoded microspheres

[0050] Following the steps in Example 1, six types of microspheres were prepared in parallel. Key variables included: target crRNA sequence, type of fluorescent group, and microsphere size. Specific configurations are shown in the table below:

[0051] target crRNA sequence (5′–3′, 3′ end marked with Cholesterol) Target DNA sequence (5′–3′) fluorescent groups Microsphere size Encoding instructions EGFR UCUCUCUCUUAUUUCUACUAAGUGUAGAUACUCUGGAUCCCAGAAGGUG (SEQIDNO.1) TTTAACTCTGGATCCCAGAAGGTG (SEQ ID NO.2) FAM 10μm Green light, middle ball BRCA1 UCUCUCUCUUAUUUCUACUAAGUGUAGAUGAACAAAAGGAAGAAAAUCA (SEQ ID NO.3) TTTAGAACAAAGGAAGAAAATCA (SEQIDNO.4) FAM (Low Density) 10μm Weak green light, medium sphere EC UCUCUCUCUUAUUUCUACUAAGUGUAGAUGGUAUAAAGACUUCGCGCUGAUAC (SEQ ID NO.5) TTTAGGTAAAAGACTTCGCGCTGATAC (SEQIDNO.6) Cy5 5μm Red light, small ball SA UCUCUCUCUUAUUUCUACUAAGUGUAGAUGCAAAGAAGCAUCAAAUUUAUGUA (SEQ ID NO.7) TTTAGCAAAGAAGCATCAAATTATAGTA (SEQ ID NO.8) Cy5 (Low Density) 5μm Weak red light, small ball HBV UCUCUCUCUUAUUUCUACUAAGUGUAGAUUCAUCUUCCUCUGCAUCCUG (SEQ ID NO.9) TTTATCATCTTCCTCTGCATCCTG (SEQ ID NO.10) FAM 20μm Green light, large sphere HPV-18 UCUCUCUCUUAUUUCUACUAAGUGUAGAUACAAUAUGUGCUUCUACACA (SEQ ID NO.11) TTTAACAATATGTGCTTCTACACA (SEQ ID NO.12) Cy5 20μm Red light, large sphere

[0052] Note: Low fluorescence density is achieved by reducing the incubation concentration or time of the fluorescent substrate probe.

[0053] By combining fluorescence color (FAM green / Cy5 red), intensity (strong / weak), and size (5 / 10 / 20 μm), we obtained six microscopically distinguishable coded microspheres, as shown in the conceptual diagram below. Figure 2 As shown, this demonstrates the rich coding capabilities that can be generated through the combination of multiple parameters.

[0054] 2. Multiple detection process and specificity verification

[0055] (1) Preparation of microsphere library: Mix the above six types of microspheres in equal proportions to form a detection microsphere library.

[0056] (2) Sample detection: To verify the multiple detection capability, we prepared a sample set containing all 64 possible combinations (from no target to all 6 targets). 10 μL of the mixed microsphere suspension was dropped onto a glass slide, allowed to stand, and then photographed under the FAM and Cy5 channels using a fluorescence microscope to record the initial state of each coded microsphere.

[0057] (3) One-pot reaction: Add 1 μL of the corresponding target DNA mixture to the microsphere suspension of each sample. Place all slides in a humidified chamber and incubate at 45°C for 45 minutes.

[0058] (4) Results Analysis: After incubation, dual-channel fluorescence imaging was performed again on each sample. For each coded microsphere (e.g., "green-medium-EGFR"), the signal change rate was analyzed across all 64 samples. The results are summarized in heatmap form. Figure 4 .

[0059] like Figure 4 As shown, the results are very clear: for any target (such as EGFR), the signal change rate of the corresponding encoding microsphere (green light - medium sphere) only increases significantly (shown as bright color in the heatmap) when the sample contains the target DNA; while in samples without the target, the signal change rate remains at the background level (dark color). The microsphere response patterns corresponding to the six targets are completely independent, with no cross-reaction. This fully demonstrates the high specificity and accuracy of the "one-pot method" for simultaneously detecting multiple targets in this invention.

[0060] Example 3: Application in simulating complex samples

[0061] This embodiment demonstrates the performance of the kit of the present invention in a near-real-world testing environment.

[0062] 1. Simulated Sample Preparation

[0063] Total nucleic acids were extracted as detection samples from 10% fetal bovine serum (simulated serum sample) artificially supplemented with HBV plasmid DNA and from cell suspensions lysed to overexpress the EGFR gene (simulated tissue lysis sample). Quantitative dilutions were performed using target DNA at known concentrations.

[0064] 2. Detection and Recovery Rate Calculation

[0065] Using the six-fold detection microsphere library constructed in Example 2, simulated samples were tested following the steps in Example 2. Three replicates were set for each sample. The signal change rate of the target microspheres (e.g., "red light-large spheres" for HBV) in the sample was compared with a standard curve prepared with pure buffer (see Example 1). Figure 3 The sample was fitted to calculate the measured concentration of the target nucleic acid in the sample.

[0066] Results: In 10% serum matrix and cell lysate matrix, the recoveries of targets such as HBV and EGFR were between 85% and 115%. The limits of detection (LOD) were only slightly higher than those in the pure buffer system, but remained in the aM-fM range. This indicates that the kit of the present invention has good resistance to interference from complex matrices and is suitable for direct detection of common clinical sample types such as serum and tissue lysates.

[0067] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A multiplex nucleic acid detection kit based on CRISPR-Cas12a, characterized in that, This includes various fluorescently encoded microspheres, each of which contains: Lipid membrane-coated solid-phase carrier microspheres; The Cas12a / crRNA complex is embedded in the lipid membrane via hydrophobic interactions, wherein the 3' end of the crRNA is covalently linked to a cholesterol group. The fluorescent substrate probe, which is embedded in the lipid membrane through hydrophobic interaction, is a single-stranded DNA with a cholesterol group covalently linked to its 3' end and a fluorescent group covalently linked to its 5' end. The various fluorescently encoded microspheres are distinguished and encoded by at least one characteristic selected from the types of fluorescent groups, the fluorescence intensity reflected by the density of fluorescent substrate probe modification, and the size of solid-phase carrier microspheres, with each code corresponding to a specific target nucleic acid.

2. The reagent kit according to claim 1, characterized in that, The solid-phase carrier microspheres are silica or polystyrene microspheres, the lipid membrane is a dioleoylphosphatidylcholine membrane, and the fluorescent group is selected from FAM, rhodamine, or Cy5.

3. The reagent kit according to claim 1, characterized in that, The kit also includes a reaction buffer containing Tris-HCl or HEPES buffer, MnCl2, PEG-200, and dithiothreitol.

4. A method for preparing a CRISPR-Cas12a-based multiplex nucleic acid detection kit as described in any one of claims 1-3, characterized in that, Includes the following steps: S1. The liposome solution was mixed with the aqueous solution of solid-phase carrier microspheres and incubated to obtain lipid membrane-coated solid-phase carrier microspheres; S2. Mix Cas12a protein with crRNA with a cholesterol group attached to its 3' end and incubate to form a Cas12a / crRNA complex; S3. The Cas12a / crRNA complex obtained in step S2 is mixed and incubated with the lipid membrane-coated solid-phase carrier microspheres obtained in step S1, so that the complex is embedded in the lipid membrane through cholesterol groups; S4. A single-stranded DNA substrate probe with a cholesterol group attached to its 3' end and a fluorescent group attached to its 5' end is mixed with the microspheres obtained in step S3 and incubated to allow the substrate probe to embed into the lipid membrane through the cholesterol group, thereby obtaining fluorescently encoded microspheres.

5. The method according to claim 4, characterized in that, In step S1, the liposomes are dioleoylphosphatidylcholine liposomes, and the solid-phase carrier microspheres are silica or polystyrene microspheres.

6. The method according to claim 4, characterized in that, In step S2, the molar ratio of Cas12a protein to crRNA is 1:1.

2.

7. A nucleic acid detection method for non-diagnostic purposes, characterized in that, Using the kit as described in any one of claims 1-3, the steps include: a) Mix the suspension containing the various fluorescently encoded microspheres with the sample to be tested in the reaction buffer and let it stand; b) Incubate at 40-50℃ for 0.5-1 hour to allow the target nucleic acid to bind to the corresponding crRNA / Cas12a complex and activate the trans-cleavage activity of Cas12a, thereby cleaving the fluorescent substrate probe on the fluorescently encoded microsphere. c) Before and after incubation, fluorescence imaging was performed on the hybrid system to obtain the fluorescence signal of each type of microsphere; d) Compare the fluorescence signals before and after incubation, and calculate the proportion of fluorescence signal disappearance for each type of microsphere, the proportion being related to the corresponding target nucleic acid concentration.

8. The method according to claim 7, characterized in that, In step a), the reaction buffer is a solution containing Tris-HCl or HEPES buffer, MnCl2, PEG-200 and dithiothreitol.

9. The method according to claim 7, characterized in that, In step c), imaging is performed using a fluorescence microscope, and statistical analysis is conducted on the fluorescence signal changes of at least 100 microspheres of the same type.

10. The use of a CRISPR-Cas12a-based multiplex nucleic acid detection kit as described in any one of claims 1-3 in the preparation of products for non-diagnostic detection of pathogens, tumor genes or viral nucleic acids.

Images