RPA-CRISPR method for rapidly detecting pathogens in air

By employing a two-step strategy of nucleic acid extraction-isothermal amplification-CRISPR detection, combined with RPA and CRISPR-Cas12a technologies, rapid and sensitive detection of airborne pathogens has been achieved, solving the problems of long processing time and low sensitivity in existing technologies. This approach is suitable for rapid pathogen detection in field environments.

CN122038544APending Publication Date: 2026-05-15GUANGZHOU NAT LAB +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610321766.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-17
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies are time-consuming and have low sensitivity when detecting low-concentration aerosol samples in the air, and they rely on large equipment, making it difficult to achieve rapid and sensitive pathogen detection.

Method used

A two-step strategy of nucleic acid extraction-isothermal amplification-CRISPR detection is adopted. RPA technology is used to exponentially amplify trace target sequences under isothermal conditions, and CRISPR-Cas12a biosensor technology is combined for specific identification and signal cascade detection to achieve rapid visualization output.

Benefits of technology

It enables rapid and sensitive detection of airborne pathogens, with a detection limit as low as a single copy. It can complete the entire detection process within 15 minutes, is suitable for deployment in field environments, and has high specificity and anti-interference capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038544A_ABST
    Figure CN122038544A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of environmental biological safety monitoring, and particularly relates to an RPA-CRISPR method for rapidly detecting pathogens in air. According to the invention, a two-step detection strategy integrating RPA isothermal amplification and CRISPR detection is established; the method specifically comprises the following steps: firstly, acquiring genome DNA of an air sample, and carrying out specific amplification on a trace target by utilizing an RPA technology; then, a product is introduced into a CRISPR-Cas12a system, and the trans-shear activity is recognized and activated by utilizing the specificity of crRNA, so that signal cascade amplification is realized. Pseudomonas aeruginosa is used as a model pathogen, and a primer and probe combination is designed aiming at a specific gene of the pseudomonas aeruginosa. Results show that the method can complete detection within 10-15 minutes at the soonest, the lowest detection limit can reach a single copy level (100 copies / L), and the method has the advantages of high environmental interference resistance, high sensitivity and no need of large instruments, and can meet the on-site rapid screening requirements of air pathogen aerosol in public places, medical environments and other scenes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of environmental biosafety monitoring technology, specifically relating to an RPA-CRISPR method for rapid detection of pathogens in the air. Background Technology

[0002] Aerosol transmission is a significant route for the spread of various respiratory pathogens and drug-resistant bacteria, posing a substantial challenge to public health security. Real-time detection and early warning of airborne pathogenic bacterial aerosols in key areas such as public places, medical environments, and conference venues are of significant strategic importance.

[0003] However, in the field of intelligent air sensing, achieving real-time pathogen monitoring faces a technical bottleneck where "timeliness" and "sensitivity" are difficult to balance. To ensure detection sensitivity, existing technologies often rely on lengthy enrichment sampling and complex nucleic acid purification steps (such as magnetic bead methods), which are time-consuming. On the other hand, if rapid sampling and simple nucleic acid release methods are used, the obtained sample DNA is often at extremely low concentrations (trace amounts) and contains a large number of residual environmental inhibitors (such as dust, aerosol particles, heavy metal ions, etc.), making traditional PCR methods susceptible to inhibition and resulting in false negatives. Therefore, developing a detection system with ultra-high sensitivity to trace targets and tolerance to complex environmental impurities is key to achieving "sampling and detection" of airborne pathogens while being compatible with rapid front-end sampling.

[0004] Pseudomonas aeruginosa is one of the most common Gram-negative opportunistic pathogens in clinical practice and a typical aerosol-borne drug-resistant bacterium. Widely distributed in nature and hospital environments, it easily causes severe respiratory infections (such as lung infections in patients with cystic fibrosis) in immunocompromised populations. Pseudomonas aeruginosa readily forms biofilms in the environment, making it difficult to eradicate, and is characterized by rapid onset, rapid disease progression, and high mortality. Therefore, early and rapid screening for pathogens in ambient air is crucial for timely blocking of pathogen transmission routes, preventing nosocomial infections, and ensuring public health safety.

[0005] Currently, there is a lack of rapid on-site detection technologies both domestically and internationally that can balance high sensitivity and broad applicability. CRISPR-Cas12a biosensor technology, with its single-molecule-level sensitivity and specific recognition capabilities, combined with RPA isothermal amplification technology, holds promise for solving these challenges. This invention aims to develop a universal detection method applicable to air environments and, using *Pseudomonas aeruginosa* as a model pathogen, verify the feasibility of this method throughout its entire process, from air sample pretreatment to signal output. Summary of the Invention

[0006] The purpose of this invention is to provide a rapid RPA-CRISPR method for detecting pathogens in the air, aiming to solve the problems of long detection time, low sensitivity, and reliance on large equipment in existing technologies when detecting low-concentration aerosol samples in the air.

[0007] The RPA-CRISPR method for rapid detection of airborne pathogens provided by this invention employs a two-step detection strategy of "nucleic acid extraction-isothermal amplification-CRISPR detection" cascade: (I) Target amplification: Given the extremely low pathogen content in air samples, isothermal amplification technology is used to exponentially amplify specific genes; for DNA pathogens (such as Pseudomonas aeruginosa), RPA technology is used for amplification, achieving exponential accumulation of trace target sequences under isothermal conditions, providing sufficient double-stranded DNA substrate for subsequent detection; (II) Signal cascade detection: The Cas12a-crRNA complex is used to perform secondary specific recognition of the amplification products, activating trans-cleavage activity, cleaving fluorescent reporter molecules, and achieving visual output. The specific steps are as follows:

[0008] S1. Nucleic acid preparation from air aerosol samples: Collect ambient air aerosol samples and use a rapid nucleic acid release or extraction process adapted to aerosol samples to obtain a nucleic acid solution containing the genomic DNA of the pathogen to be tested. Since the RPA-CRISPR system subsequently established in this invention has high sensitivity and strong anti-interference, this step is simplified by using a rapid nucleic acid release agent or thermal lysis method, without the need for complex purification steps, which can meet the subsequent detection requirements.

[0009] S2. Isothermal amplification of target sequence: Using the nucleic acid extracted in step S1 as a template, an amplification reaction system targeting a highly conserved and specific gene of the target pathogen is constructed; under isothermal conditions of 37°C-39°C, the RPA reaction is initiated to achieve exponential accumulation of trace target sequences and obtain high concentrations of double-stranded DNA amplification products.

[0010] S3. CRISPR-Cas12a Specific Recognition and Signal Transduction: A CRISPR detection system was constructed containing Cas12a nuclease, specific crRNA, and a single-stranded DNA (ssDNA) fluorescent reporter molecule modified with fluorescent and quenching groups at both ends, respectively. The amplification product obtained in step S2 was introduced into this system and incubated at 37°C-39°C. The crRNA in the detection system specifically recognizes and binds to the target region in the amplification product, inducing a conformational change in the Cas12a protein, thereby activating its associated trans-cleavage activity.

[0011] S4. Result determination: The activated Cas12a protein non-specifically cleaves the ssDNA fluorescent reporter molecule in the system, causing the fluorescent group and quencher group to separate and emit significant fluorescence; observe the fluorescence signal under blue light (excitation wavelength 492 nm / emission wavelength 518 nm). If visible fluorescence is produced, it is determined that the air sample to be tested contains the target pathogen.

[0012] Furthermore, the RPA reaction system in step S2 has a volume of 50 µL, containing 29.4 µL of A Buffer, 2 µL of forward primer, 2 µL of reverse primer, 2.5 µL of B Buffer, and a mixed solution of 14.1 µL of nucleic acid template and Nuclease-free ddH2O; the amplification reaction takes 10-30 minutes.

[0013] Furthermore, for the target pathogen *Pseudomonas aeruginosa*, the specific RPA primer pair targeting its oprL gene is selected from any of the following:

[0014] .

[0015] Furthermore, the crRNA described in step S3 can specifically recognize the amplification products of the target pathogen in the air, and the crRNA nucleotide sequence for Pseudomonas aeruginosa is selected from any one of the following A1-A4 (according to the WIPO ST.26 sequence standard, T in the sequence represents uracil U):

[0016] .

[0017] Furthermore, the fluorescent reporter molecule in step S3 is a single-stranded DNA (ssDNA) with a fluorescent group (such as FAM) modified at its 5' end and a fluorescence quencher group (such as BHQ1) modified at its 3' end; the sequence of the fluorescent reporter molecule is: 5'-FAM-TTATT-BHQ1-3'.

[0018] Furthermore, the Cas12a nuclease mentioned in step S3 is LbCas12a derived from Lachnospiraceaebacterium ND2006.

[0019] Furthermore, the CRISPR detection system described in step S3 has a volume of 20 µL and contains 2 µL of 10×Amp CasReaction Buffer, 0.5 µL of LbCas12a Nuclease, 1 µL of crRNA, 1 µL of ssDNA Reporter, 2 µL of LRPA amplification product, and Nuclease-free ddH2O.

[0020] Furthermore, in step S4, the result judgment criteria are as follows: the CRISPR detection system is placed in an environment of 37°C-39°C for reaction, and the fluorescence signal is observed at an excitation wavelength of 492 nm and an emission wavelength of 518 nm. A significant fluorescence signal can be detected in positive samples within 1-5 minutes.

[0021] The beneficial effects of this invention are as follows:

[0022] 1. Broad applicability: This method can cover the detection needs of the vast majority of pathogens in the air;

[0023] 2. High sensitivity, adaptable to samples with low air density: The two-step strategy avoids enzyme activity competition between amplification and detection, achieving a detection limit as low as the single-copy level (10). 0 (copies / µL), effectively solving the problem of low aerosol sample concentration;

[0024] 3. High specificity and resistance to background interference: The specific recognition of crRNA ensures accurate differentiation of target pathogens in complex atmospheric background impurities, and has strong resistance to interference.

[0025] 4. Rapid detection: The entire detection process (amplification + detection) can be completed in as little as 15 minutes, requiring only temperature control equipment and a blue light observation device, making it suitable for deployment in on-site environments such as customs and hospitals;

[0026] 5. Strong pretreatment compatibility and fast end-to-end process: Thanks to the fact that this detection system is compatible with trace targets (10 0 With its ultra-high sensitivity (copies / µL) and excellent resistance to environmental interference, this method is compatible with various commercially available aerosol rapid nucleic acid lysis / release reagents (without the need for complex magnetic bead purification operations). In practical applications, only simple pretreatment is required for subsequent amplification and detection, thereby significantly shortening sample processing time and ensuring timeliness throughout the entire process from sampling to results. Attached Figure Description

[0027] Figure 1 Screening, specificity and sensitivity verification of the optimal combination of RPA primers and crRNA. (A) Agarose gel electrophoresis; (B) Screening and specificity verification of primer and crRNA combinations; (C) Sensitivity gradient test.

[0028] Figure 2 Fluorescence intensity under different combinations of RPA amplification time (10 min, 30 min) and CRISPR reaction time (instant / 0 min, 5 min). (A) 10 min RPA + instant CRISPR detection; (B) 10 min RPA + 5 min CRISPR detection; (C) 30 min RPA + instant CRISPR detection; (D) 30 min RPA + 5 min CRISPR detection.

[0029] Figure 3 DNA concentration gradient (10) 0 -10 5 RPA-CRISPR fluorescence kinetics curves (copies / μL). (A) RPA amplification for 10 minutes; (B) RPA amplification for 30 minutes.

[0030] Figure 4 DNA concentration gradient (10) 0 -10 5 Linearity analysis of copies / μL) and fluorescence intensity. (A) 10-minute RPA + instant CRISPR detection; (B) 10-minute RPA + 5-minute CRISPR detection; (C) 30-minute RPA + instant CRISPR detection; (D) 30-minute RPA + 5-minute CRISPR detection.

[0031] Figure 5 Interface of a portable RPA-CRISPR detection system based on a smartphone. (A) Positive result reference interface; (B) Negative result reference interface; (C) Final result reference interface. Detailed Implementation

[0032] The present invention will be further described below with reference to the embodiments and accompanying drawings.

[0033] In this embodiment, the pathogen selected is *Pseudomonas aeruginosa*, which has a high risk of airborne transmission and is highly drug-resistant. Unless otherwise specified, all materials and reagents used in this embodiment are commercially available. The Cas12a nuclease is LbCas12a derived from *Lachnospiraceae bacterium* ND2006.

[0034] Example 1: The specific steps of the method of the present invention are as follows:

[0035] Step 1: Inoculate *Pseudomonas aeruginosa* bacterial culture into LB medium and incubate overnight. Extract and quantify bacterial genomic DNA, adjust the concentration, and use it as a screening template.

[0036] Step 2: Prepare a 50 μL RPA amplification system. Add 29.4 μL of Buffer A to the RPA dry powder reaction tube. Add 2 μL of the forward primer (10 μM) and 2 μL of the reverse primer (10 μM) to be screened. Add 5 μL of the genomic DNA template extracted in Step 1 and 9.1 μL of Nuclease-free ddH2O. Finally, add 2.5 μL of Buffer B to the inside of the tube cap, seal the tube, invert it 8-10 times to mix, and centrifuge to allow the liquid to settle and start the reaction. Incubate the reaction tube at 37°C-39°C for 10 min.

[0037] Step 3: Prepare a 20 μL CRISPR detection system. Add 13.5 μL Nuclease-free ddH2O and 2 μL 10 × Amp Cas Reaction Buffer to a centrifuge tube. Add 0.5 μL LbCas12a Nuclease (4 μM), 1 μL crRNA to be screened (10 μM), and 1 μL ssDNA Reporter (5'-FAM-TTATT-BHQ1-3', 10 μM), and mix thoroughly. Add 2 μL of the RPA amplification product from Step 2 to the above CRISPR detection system and mix thoroughly.

[0038] Step 4: Place the reaction system at 37°C-39°C. Observe using a portable fluorescence detector or transilluminator equipped with a blue light excitation device (excitation wavelength 492 nm). At an emission wavelength of 518 nm, the positive reaction wells emit bright green fluorescence, while the negative control wells remain dim or without fluorescence.

[0039] In the RPA amplification system, the primer pairs are:

[0040] oprL-RPA-F3: 5'-GTCGCGTCGAGCTGAAGAAGTAAGAAGTC-3'

[0041] oprL-RPA-R3: 5'-ATCTGCTGGAGCTGCATGAACAGTTCGCC-3';

[0042] In the CRISPR detection system, crRNA is:

[0043] crRNA-A1: 5'-TAATTTCTACTAAGTGTAGATCCGGAGGTGGGGTGACAACCC-3'.

[0044] Figure 1(A) shows the agarose gel electrophoresis results of the RPA primer amplification products. The clearly visible bands are located at the expected size (inferred from the marker), and the bands are single and bright, without obvious non-specific amplification or primer dimer tailing. This indicates that the RPA primer combination has good amplification efficiency and specificity, and can successfully amplify the target gene fragment, providing a high-quality substrate for subsequent CRISPR detection.

[0045] In the RPA amplification system, other primer pairs and crRNA combinations all showed good results.

[0046] Example 2: The specific steps of the method of the present invention are as follows:

[0047] To verify the specificity of the primer-crRNA combination, common airborne respiratory pathogens and closely related species of Pseudomonas were selected as interference controls.

[0048] Step 1: Select *Pseudomonas aeruginosa* as the positive control group. Select the following two common pathogens found in airborne aerosols as interference controls (negative control groups): *Staphylococcus aureus* and *Klebsiella pneumoniae*. Nuclease-free ddH2O was also used as a template-free negative control (NTC). Genomic DNA was extracted from all the above strains, and the concentration was uniformly adjusted to 10. 5 copies / μL.

[0049] Step 2: Perform RPA amplification using the primer combination from Example 1 (37°C-39°C, 10 min).

[0050] Step 3: Perform a CRISPR reaction using the crRNA from Example 1.

[0051] Step 4: Place the mixture in a 37°C-39°C constant temperature fluorescence detector for CRISPR detection.

[0052] Figure 1(B) Visually demonstrates the results of crRNA screening and specificity verification of the RPA-CRISPR detection system constructed in this invention. The RPA primer and crRNA combination emits high fluorescence intensity in the RPA-CRISPR detection system, and the difference in fluorescence intensity between the optimal combination and other combinations is clearly distinguishable to the naked eye. Under blue light excitation, only the reaction tube labeled "P" (Positive) (containing *Pseudomonas aeruginosa*) emitted bright green fluorescence; while the negative control tubes labeled "N" (Negative) (containing *Staphylococcus aureus* and *Klebsiella pneumoniae* interfering strains) did not produce any fluorescence signal, appearing dark, consistent with the blank control. This result confirms that the RPA primers and crRNA of this method have extremely high species specificity and can effectively resist interference from non-target bacterial groups in complex samples.

[0053] Results: Only the Pseudomonas aeruginosa positive group produced significant fluorescence signals, while the fluorescence signals of Staphylococcus aureus, Klebsiella pneumoniae, and the blank control group were all at extremely low levels. This indicates that the method has extremely high specificity and can eliminate interference from other bacteria in the air.

[0054] Example 3: Sensitivity Test

[0055] This embodiment simulates a situation where the concentration of pathogens in an air sample is extremely low, verifying the minimum detection limit of the present invention.

[0056] Step 1: Take Pseudomonas aeruginosa genomic DNA of known concentration and perform 10-fold serial dilutions to prepare concentration gradients of 10... 5 10 4 10 3 10 2 10 1 10 0 Templates for copies / μL and blank control (Nuclease-free ddH2O).

[0057] Step 2: Prepare a 50 μL RPA amplification system for amplification (same as in Example 1). Incubate the reaction tube at 37°C-39°C for 10 minutes.

[0058] Step 3: Prepare a 20 μL CRISPR detection system (same as in Example 1). Take 2 μL of the RPA amplification product after the reaction in Step 2 and add it to the CRISPR detection system. Mix thoroughly.

[0059] Step 4: Immediately place the reaction system in a fluorescence detection instrument, incubate at 37°C-39°C and detect the fluorescence intensity.

[0060] Figure 1(C) shows the visualization results of different concentrations of template DNA after 10 minutes of RPA amplification. The template concentrations in the reaction tubes from left to right are 10... 0 Up to 10 5 Copies / µL. Visually, it is visible that while the fluorescence intensity decreases with decreasing template concentration, it still remains relatively constant even at the lowest concentration of 10. 0 In the reaction tube with copies / µL (i.e., single copy), clear green fluorescence can still be observed, which contrasts sharply with the negative control.

[0061] Results: As shown in Figure (C), even at template concentrations as low as 10 0 Fluorescence signals are still visible to the naked eye even at single-copy levels. This demonstrates that the method possesses ultra-high sensitivity at the single-copy level, enabling it to detect trace aerosol pathogens and meet the needs of intelligent air sensing.

[0062] Example 4: Optimization of Amplification Time

[0063] To meet the needs of rapid on-site testing, the RPA amplification time was optimized.

[0064] Step 1: Prepare the RPA reaction system (same as in Example 1), and terminate the reaction when the reaction time reaches 10 min and 30 min respectively.

[0065] Step 2: Take products at each time point for CRISPR detection (same as in Example 1). Measure fluorescence intensity at both instantaneous CRISPR detection and 5-minute reaction time.

[0066] Figure 2 Fluorescence intensities were shown under different combinations of RPA amplification duration (10 min, 30 min) and CRISPR reaction duration (instant / 0 min, 5 min). (A) 10 min RPA + instant CRISPR detection; (B) 10 min RPA + 5 min CRISPR detection; (C) 30 min RPA + instant CRISPR detection; (D) 30 min RPA + 5 min CRISPR detection.

[0067] Result: As Figure 2 As shown in the bar chart, the change in DNA template concentration from 10... 0 Increase to 10 5 The detected fluorescence value increased in a stepwise manner, with copies / µL. In all test combinations, the system effectively identified values ​​as low as 10. 0 Sample signal of copies / μL, and 10 0The fluorescence signal intensity of the copies / µL group (7000-12000 au) was significantly higher than that of the blank control group (1800-2100 au), and the signal intensity increased significantly with the extension of reaction time.

[0068] Example 5: DNA concentration gradient (10 0 -10 5 RPA-CRISPR fluorescence kinetics curves (copies / μL)

[0069] DNA concentration gradient (10) 0 -10 5 The fluorescence kinetics of RPA-CRISPR (copies / μL) were investigated.

[0070] Step 1: Prepare the RPA reaction system (same as in Example 1), and terminate the reaction when the reaction time reaches 10 min and 30 min respectively.

[0071] Step 2: Take RPA products at each time point for CRISPR fluorescence kinetics detection.

[0072] Figure 3 The DNA concentration gradient (10) was shown. 0 -10 5 RPA-CRISPR fluorescence kinetic curves (copies / μL) were obtained. (A) RPA amplification for 10 minutes; (B) RPA amplification for 30 minutes. The kinetic curves show that all positive samples (10 copies / μL) showed positive fluorescence kinetics. 0 -10 5 The fluorescence signal of the positive samples (copies / µL) increased rapidly after the reaction started, while the signal of the template-free negative control (NTC) remained at a flat baseline. The initial fluorescence intensity of the positive samples after RPA amplification for 10 minutes was between 7000-8000 au, which was significantly higher than that of the template-free negative control (NTC, 2000-3000 au).

[0073] Result: By setting 6000 au as the threshold for determining positive or negative results, the system can complete the determination of 10 positive / negative results within a total process time of 10 minutes. 0 Accurate interpretation of low-concentration samples (copies / μL). Even for low-concentration samples, the fluorescence signal can exceed the threshold line (shown by the dashed line) during CRISPR instantaneous detection, indicating that the system has extremely fast reaction kinetics and can achieve rapid on-site screening with "sample in, result out".

[0074] Example 6: Linear Relationship Analysis between DNA Concentration and Fluorescence Intensity

[0075] DNA concentration gradient (10) 0 -105 RPA-CRISPR fluorescence intensity quantitative analysis was performed on samples (copies / μL).

[0076] Step 1: Prepare the RPA reaction system (same as in Example 1), and terminate the reaction when the reaction time reaches 10 min and 30 min respectively.

[0077] Step 2: Add the RPA products from each time point to the CRISPR system (same as in Example 1). Perform real-time detection and fluorescence intensity detection in the CRISPR system after 5 minutes of reaction.

[0078] Figure 4 It shows different DNA concentration gradients (10) 0 -10 5 The linear relationship between copies / μL and fluorescence intensity was investigated. The results were: (A) 10-minute RPA + instant CRISPR detection; (B) 10-minute RPA + 5-minute CRISPR detection; (C) 30-minute RPA + instant CRISPR detection; and (D) 30-minute RPA + 5-minute CRISPR detection.

[0079] Results: For DNA concentration gradients (10... 0 -10 5 Quantitative analysis of fluorescence intensity in CRISPR reactions of samples (copies / μL) revealed a strong linear relationship between the logarithm of DNA concentration and fluorescence intensity. Specifically, the linear regression equation for the 10-minute RPA + instant CRISPR detection mode was y = 419.91x + 6869.92 (R² / μL). 2 = 0.97); in the "30-minute RPA + instant CRISPR" mode, y = 693.68x + 11258.26 (R 2 = 0.98), indicating that the system has good quantitative detection capabilities.

[0080] Example 7: Real-time detection of portable devices

[0081] This embodiment demonstrates the combination of the method with a portable fluorescence detector (model: HTM-8T, manufacturer: Suzhou Changhe Biotechnology Co., Ltd.) and a custom-developed Android smartphone application (APP name: Changjian Wuyou 1.0.2, developer: Suzhou Changhe Biotechnology Co., Ltd.).

[0082] Step 1: Take 2 μL of the reaction product amplified by RPA and add it to 18 μL of CRISPR detection system.

[0083] Step 2: Place the reaction tube into the portable constant temperature fluorescence detector and connect it to the mobile APP via Bluetooth.

[0084] Step 3: Set the temperature to 37°C-39°C and collect fluorescence signals in real time.

[0085] Step 4: Observe the fluorescence enhancement curve in real time on the Android phone screen.

[0086] Figure 5 This demonstrates the integrated application effect of the method of the present invention with a portable fluorescence detector and a smartphone APP terminal. The mobile APP can receive and plot fluorescence detection curves in real time, and automatically determine the negative / positive results according to a preset algorithm.

[0087] Result: As Figure 5 As shown, the app can accurately identify positive samples. This illustration powerfully demonstrates the portability and intelligence of the hardware system accompanying this invention, showcasing its potential for real-time testing in a laboratory-free environment.

Claims

1. A rapid RPA-CRISPR method for detecting airborne pathogens, characterized in that, Includes the following steps: S1. Nucleic acid preparation from air aerosol samples: Collect ambient air aerosol samples and use a rapid nucleic acid release or extraction process adapted to aerosol samples to obtain a nucleic acid solution containing the genomic DNA of the pathogen to be tested. S2. Isothermal amplification of target sequence: Using the nucleic acid extracted in step S1 as a template, an amplification reaction system targeting a highly conserved and specific gene of the target pathogen is constructed; under isothermal conditions of 37°C-39°C, the RPA reaction is initiated to achieve exponential accumulation of trace target sequences and obtain high concentrations of double-stranded DNA amplification products. S3, CRISPR-Cas12a Specific Recognition and Signal Transduction: A CRISPR detection system was constructed containing Cas12a nuclease, specific crRNA, and a single-stranded DNA (ssDNA) fluorescent reporter molecule with fluorescent and quenching groups modified at both ends, respectively. The amplification product obtained in step S2 was introduced into this system and incubated at 37°C-39°C. The crRNA in the detection system specifically recognizes and binds to the target region in the amplification product, inducing a conformational change in the Cas12a protein and thereby activating its accessory trans-cleavage activity. S4. Result determination: The activated Cas12a protein non-specifically cleaves the ssDNA fluorescent reporter molecule in the system, causing the fluorescent group and quencher group to separate and emit significant fluorescence; observe the fluorescence signal under blue light irradiation, and if visible fluorescence is produced, it is determined that the air sample to be tested contains the target pathogen.

2. The RPA-CRISPR method for rapid detection of airborne pathogens according to claim 1, characterized in that, The RPA reaction system in step S2 has a volume of 50 µL and contains 29.4 µL of A Buffer, 2 µL of forward primer, 2 µL of reverse primer, 2.5 µL of B Buffer, and a mixed solution of 14.1 µL of nucleic acid template and Nuclease-free ddH2O; the amplification reaction takes 10-30 minutes.

3. The RPA-CRISPR method for rapid detection of airborne pathogens according to claim 2, characterized in that, For the target pathogen being *Pseudomonas aeruginosa*, the specific RPA primer pair for its oprL gene is selected from any of the following: oprL-RPA-F1: ACGACAGCTCCGACCTGAAGCCGGAAGCCA oprL-RPA-R1:AGCGACCGGACCGCTCTTTACCATAGGAAAC oprL-RPA-F2:ACCTTCTACTTCGAGTACGACAGCTCCGAC oprL-RPA-R2: CAGGTCTTTCGCGTGTACGTCCAGAGCGCG oprL-RPA-F3:GTCGCGTCGAGCTGAAGAAGTAAGAAGTC oprL-RPA-R3: ATCTGCTGGAGCTGCATGAACAGTTCGCC.

4. The RPA-CRISPR method for rapid detection of airborne pathogens according to claim 3, characterized in that, The nucleotide sequence of the crRNA mentioned in step S3 is selected from any one of the following A1-A4: A1: TAATTTCTACTAAGTGTAGATCCGGAGGTGGGGTGACAACCC A2: TAATTTCTACTAAGTGTAGATCTGCGCTGGCTCTGGCCATGGCT A3: TAATTTCTACTAAGTGTAGATAGTTCGTCGGCACCGCCAGCGCC A4: TAATTTCTACTAAGTGTAGATCCGCCGACCTGATCGACGTGTCC.

5. The RPA-CRISPR method for rapid detection of airborne pathogens according to claim 4, characterized in that, The fluorescent reporter molecule in step S3 is a single-stranded DNA with a fluorescent group modified at its 5' end and a fluorescence quenching group modified at its 3' end; the sequence of the fluorescent reporter molecule is: 5'-FAM-TTATT-BHQ1-3'.

6. The RPA-CRISPR method for rapid detection of airborne pathogens according to claim 4, characterized in that, The Cas12a nuclease mentioned in step S3 is LbCas12a derived from the Trichophyton spp. ND2006.

7. The RPA-CRISPR method for rapid detection of airborne pathogens according to claim 4, characterized in that, In step S3, the CRISPR detection system has a volume of 20 µL, containing 2 µL of 10×Amp Cas Reaction Buffer, 0.5 µL of LbCas12a Nuclease, 1 µL of crRNA, 1 µL of ssDNA Reporter, 2 µL of RPA amplification product, and Nuclease-free ddH2O.

8. The RPA-CRISPR method for rapid detection of airborne pathogens according to claim 4, characterized in that, In step S4, the result judgment criteria are as follows: the CRISPR detection system is placed in an environment of 37°C-39°C for reaction, and the fluorescence signal is observed at an excitation wavelength of 492 nm and an emission wavelength of 518 nm. A significant fluorescence signal is detected in positive samples within 1-5 minutes.