Plasma extracellular vesicle miRNA biomarker for monitoring or prognosing curative effect of lung cancer immune combined chemotherapy and application of plasma extracellular vesicle miRNA biomarker

Abstract

The invention discloses plasma extracellular vesicles miR-140-5p, miR-597-3p and miR-92a-1-5p which can be used as biomarkers for monitoring or prognosing the curative effect of immune combined chemotherapy of lung cancer, so that the plasma extracellular vesicles miR-140-5p, miR-597-3p and miR-92a-1-5p can be used for preparing a chip, a detection reagent or a detection kit for monitoring or prognosing the curative effect of immune combined chemotherapy of lung cancer. The plasma extracellular vesicle miRNA biomarker disclosed by the invention can be used for accurately screening potential people who benefit from lung cancer immune combined chemotherapy, and particularly accurately subdividing and monitoring the curative effect of the people who benefit from lung cancer immune combined chemotherapy.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine. Specifically, this invention relates to the monitoring of the efficacy or prognosis of immunotherapy combined with chemotherapy for lung cancer, particularly the application of plasma extracellular vesicle miRNAs and their combinations as biomarkers for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy for lung cancer. Background Technology

[0002] Lung cancer is the most common primary malignant tumor of the lung. Over the past 50 years, the incidence and mortality rates of lung cancer have risen rapidly in countries worldwide, especially industrialized nations, making it the leading cause of cancer death globally. Currently, conventional treatments for lung cancer include surgery, platinum-based doublet chemotherapy, radiotherapy, targeted therapy, and immunotherapy. In recent years, immunotherapy combined with chemotherapy has become an important interventional therapy for lung cancer. This combination regimen can significantly improve efficacy without significant additive drug-related adverse reactions, and is mainly suitable for maintenance therapy in advanced lung cancer and neoadjuvant and adjuvant therapy in locally advanced lung cancer. Its high efficacy and good safety profile have gradually made it the main treatment modality for advanced lung cancer. If potential beneficiaries can be rationally screened and their treatment outcomes precisely segmented before treatment, it will provide important information for individualized precision medicine.

[0003] Currently, widely used clinical imaging examinations (such as enhanced chest CT, chest X-ray, MRI, and ultrasound) and tumor marker tests (such as CEA, NSE, CYFRA21-1, proGRP, and SCC-Ag) have low sensitivity and specificity for detecting the efficacy of treatment in lung cancer, and are prone to false positives. Highly specific extracellular vesicle miRNA biomarkers for predicting the efficacy of immunotherapy combined with chemotherapy in lung adenocarcinoma patients, especially for precise segmentation and monitoring of the benefit population, have not been reported.

[0004] Currently, the main biomarkers for screening potential beneficiaries of immunotherapy include PD-L1 expression levels, tumor mutational burden (TMB), and microsatellite instability (MSI). High MSI levels (MSI-high, MSI-H) are one of the screening biomarkers for immune checkpoint inhibitors in colorectal cancer, but they are extremely rare in lung cancer patients, making them difficult to use for predicting immune-related efficacy in lung cancer patients. PD-L1 expression levels on tumor cell surfaces may affect the efficacy of immune checkpoint inhibitors in lung cancer patients, but the heterogeneity of this detection is a significant issue. Different antibodies, different detection platforms, and different assessment systems all have different positive thresholds, making it difficult to establish a consistent standard to measure PD-L1 expression in tumor cells. Furthermore, its accuracy and specificity are not high; even in patients with the highest PD-L1 expression (≥50%), the response rate is only 45.2%. TMB has been shown to be associated with immunotherapy efficacy in multiple large clinical trials and can complement PD-L1 detection, but current TMB prediction still has insufficient specificity and limitations, requiring further prospective studies for validation. While an increasing number of patients are benefiting from immunotherapy combined with chemotherapy, effective and precise biomarkers for screening potential beneficiaries and for accurately segmenting the efficacy of treatment within these beneficiaries remain lacking. Exploring predictive biomarkers to accurately screen patients responding to immunotherapy combined with chemotherapy, and to precisely segment and monitor the efficacy of treatments within these beneficiaries, is crucial to reducing unnecessary waste of medical resources, adjusting treatment strategies in a timely manner, and improving the overall therapeutic effect of immunotherapy combined with chemotherapy. Summary of the Invention

[0005] The purpose of this invention is to monitor the efficacy of immunotherapy combined with chemotherapy for lung cancer by discovering and validating biomarkers for monitoring the efficacy of immunotherapy combined with chemotherapy for lung cancer.

[0006] Therefore, the present invention provides a biomarker that can be used clinically as a biomarker for the efficacy of combined immunotherapy and chemotherapy in lung cancer.

[0007] This invention also provides a chip and reagent kit for monitoring the efficacy of combined immunotherapy and chemotherapy in lung cancer.

[0008] The present invention also provides a method for monitoring the efficacy of lung cancer immunotherapy combined with chemotherapy using the aforementioned biomarkers.

[0009] In a first aspect, the present invention provides the use of plasma extracellular vesicle miRNA in the preparation of chips, detection reagents, or detection kits for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy for lung cancer, wherein the plasma extracellular vesicle miRNA is: (i) One or more of the miRNAs with sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i).

[0010] In a specific implementation, the lung cancer is lung adenocarcinoma.

[0011] In a preferred embodiment, the miRNA is a miRNA isolated from humans.

[0012] In a preferred embodiment, the immunotherapy combined with chemotherapy is a PD-1 inhibitor combined with chemotherapy; preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with chemotherapy; more preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with pemetrexed and carboplatin.

[0013] In a second aspect, the present invention provides a miRNA chip, the miRNA chip comprising: Solid support; and An oligonucleotide probe is ordered and immobilized on the solid support, and the oligonucleotide probe specifically binds to miRNA; The miRNA mentioned above is: (i) One or more of the miRNAs with sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i).

[0014] In a preferred embodiment, the oligonucleotide probe contains: Complementary bonding region; and / or The connection zone that is connected to the solid support.

[0015] In a preferred embodiment, the miRNA chip is used for monitoring the efficacy of combined immunotherapy and chemotherapy in lung cancer.

[0016] In a preferred embodiment, the lung cancer is lung adenocarcinoma.

[0017] In a preferred embodiment, the immunotherapy combined with chemotherapy is a PD-1 inhibitor combined with chemotherapy; preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with chemotherapy; more preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with pemetrexed and carboplatin.

[0018] In a preferred embodiment, the miRNA is a miRNA isolated from humans.

[0019] In a preferred embodiment, the miRNA is plasma extracellular vesicle miRNA.

[0020] In a third aspect, the present invention provides the use of the miRNA chip described in the second aspect for the preparation of a detection kit for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy in lung cancer.

[0021] In a preferred embodiment, the lung cancer is lung adenocarcinoma.

[0022] In a preferred embodiment, the immunotherapy combined with chemotherapy is a PD-1 inhibitor combined with chemotherapy; preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with chemotherapy; more preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with pemetrexed and carboplatin.

[0023] In a fourth aspect, the present invention provides a kit containing a detection reagent for detecting miRNA; The miRNA mentioned above is: (i) One or more of the miRNAs with sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i) Alternatively, the kit may contain the miRNA chip described in the second aspect.

[0024] In a preferred embodiment, the kit is used for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy for lung cancer.

[0025] In a preferred embodiment, the lung cancer is lung adenocarcinoma.

[0026] In a preferred embodiment, the immunotherapy combined with chemotherapy is a PD-1 inhibitor combined with chemotherapy; preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with chemotherapy; more preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with pemetrexed and carboplatin.

[0027] In a preferred embodiment, the miRNA is a miRNA isolated from humans.

[0028] In a preferred embodiment, the miRNA is plasma extracellular vesicle miRNA.

[0029] In a fifth aspect, the present invention provides a plasma extracellular vesicle miRNA for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy in lung cancer. The miRNA mentioned above is: (i) One or more of the miRNAs with sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i).

[0030] In a preferred embodiment, the lung cancer is lung adenocarcinoma.

[0031] In a preferred embodiment, the immunotherapy combined with chemotherapy is a PD-1 inhibitor combined with chemotherapy; preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with chemotherapy; more preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with pemetrexed and carboplatin.

[0032] In a preferred embodiment, the miRNA is a miRNA isolated from humans.

[0033] In a preferred embodiment, the miRNA is plasma extracellular vesicle miRNA.

[0034] In a sixth aspect, the present invention provides an isolated or artificially constructed precursor miRNA, said precursor miRNA being cleaved and expressed in human cells as the miRNA described in the fifth aspect.

[0035] In a seventh aspect, the present invention provides an isolated polynucleotide that can be transcribed into a precursor miRNA by human cells, the precursor miRNA being cleaved and expressed in human cells as the miRNA described in the fifth aspect.

[0036] In a preferred embodiment, the polynucleotide has the structure shown in Formula I: Seq 正向 -X-Seq 反向 Formula I In formula I, Seq 正向 The nucleotide sequence is such that the miRNA can be expressed in human cells. Seq 反向 These are nucleotide sequences that are substantially or completely complementary to the forward direction of the Seq sequence; X is located at Seq 正向 and Seq 反向 The interval sequence between, and the interval sequence with Seq 正向 and Seq 反向 Not complementary; The structure shown in Formula I, after being transferred into human cells, forms the secondary structure shown in Formula II: Formula II, In Equation II, Seq 正向 Seq 反向 The definitions of X and X are as described above. || indicates that in Seq 正向 and Seq 反向 The complementary base pairing relationship formed between them.

[0037] In an eighth aspect, the present invention provides a vector containing the miRNA described in the fifth aspect or the polynucleotide described in the seventh aspect.

[0038] In a ninth aspect, the present invention provides a method for monitoring or predicting the efficacy of immunotherapy combined with chemotherapy for lung cancer, comprising the following steps: (a) Detecting the expression level of miRNA in the sample of the subject to be tested; (b) Determine the efficacy of immunotherapy combined with chemotherapy on the subjects based on the expression level of the miRNA obtained in step (a); The miRNA mentioned above is: (i) one or more of the following: miRNA with the sequence shown in SEQ ID NO: 1, miRNA with the sequence shown in SEQ ID NO: 2, and miRNA with the sequence shown in SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i).

[0039] In a preferred embodiment, the miRNA is a miRNA isolated from humans.

[0040] In a preferred embodiment, the miRNA is plasma extracellular vesicle miRNA.

[0041] In a preferred embodiment, the lung cancer is lung adenocarcinoma.

[0042] In a preferred embodiment, the immunotherapy combined with chemotherapy is a PD-1 inhibitor combined with chemotherapy; preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with chemotherapy; more preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with pemetrexed and carboplatin.

[0043] In a preferred embodiment, subjects with low miRNA expression levels benefit more from immunotherapy combined with chemotherapy, while subjects with high miRNA expression levels benefit less from immunotherapy combined with chemotherapy.

[0044] In a preferred embodiment, the expression level of the miRNA in the subject is detected by PCR, and the average CT value of the non-response group marker is used as a reference. If the relative expression level of the miRNA in the subject before immunotherapy is more than 1.5 times and P < 0.05, the subject is judged to have high expression; if the relative expression level of the miRNA in the subject before immunotherapy is less than 2 / 3 times and P < 0.05, the subject is judged to have low expression.

[0045] In a preferred embodiment, the average CT value of the non-response group markers is used as a reference, and the relative expression level of miRNA markers before treatment is calculated based on 2^(-ΔΔCT).

[0046] In a tenth aspect, the present invention provides an apparatus for monitoring or predicting the efficacy of immunotherapy combined with chemotherapy for lung cancer, the apparatus having a storage device storing instructions for performing the method for monitoring or predicting the efficacy of immunotherapy combined with chemotherapy for lung cancer as described in the ninth aspect.

[0047] In a preferred embodiment, the device includes the following means: (a) A detection device that detects the expression level of miRNA in a sample of a test subject; and (b) An output device that determines the efficacy of immunotherapy combined with chemotherapy on the subject based on the expression level of miRNA obtained by device (a); The miRNA mentioned above is: (i) One or more of the following: miRNAs listed in SEQ ID NO: 1, miRNAs with sequences shown in SEQ ID NO: 2, and miRNAs with sequences shown in SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i).

[0048] In a preferred embodiment, the miRNA is a miRNA isolated from humans.

[0049] In a preferred embodiment, the miRNA is plasma extracellular vesicle miRNA.

[0050] In a preferred embodiment, the lung cancer is lung adenocarcinoma.

[0051] In a preferred embodiment, the immunotherapy combined with chemotherapy is a PD-1 inhibitor combined with chemotherapy; preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with chemotherapy; more preferably, the immunotherapy combined with chemotherapy is pembrolizumab combined with pemetrexed and carboplatin.

[0052] In a preferred embodiment, subjects with low miRNA expression levels benefit more from immunotherapy combined with chemotherapy, while subjects with high miRNA expression levels benefit less from immunotherapy combined with chemotherapy.

[0053] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0054] Figure 1 The morphology of extracellular vesicles as detected by TEM is shown; Figure 2 The particle size distribution of extracellular vesicles as detected by NTA is shown; Figures 3-5 The expression levels of extracellular vesicle miRNAs miR-140-5p, miR-597-3p, and miR-92a-1-5p in the plasma of lung cancer patients in the training cohort were shown using small RNA sequencing. Figures 6-8 The expression levels of extracellular vesicle miRNAs miR-140-5p, miR-597-3p, and miR-92a-1-5p in plasma of lung cancer patients in the validation cohort were shown using small RNA sequencing. Figure 9 The ROC curve of the training queue is shown; Figure 10 The ROC curve for the validation queue is shown. Detailed Implementation

[0055] Immunotherapy combined with chemotherapy has become an important clinical treatment option for lung cancer patients, and an increasing number of patients are benefiting from this treatment regimen. However, biomarkers that can effectively identify the true response population and more accurately assess efficacy are still lacking.

[0056] To address the aforementioned issues, this invention establishes a prognostic assessment kit for lung cancer patients receiving immunotherapy combined with chemotherapy, based on the expression levels of miRNA biomarkers derived from extracellular vesicles in the plasma of lung adenocarcinoma patients. This kit can effectively indicate and monitor the efficacy of immunotherapy combined with chemotherapy in lung cancer patients, helping clinicians to conduct precise individualized assessments of patients with advanced lung adenocarcinoma, thereby bringing better survival benefits to patients. It also has significant value for further segmenting the clinical application scenarios of immunotherapy combined with chemotherapy regimens.

[0057] definition The scientific and technical terms used herein are consistent with the conventional understanding of those skilled in the art. For ease of understanding of this invention, the relevant terms are explained and defined as follows: Small extracellular vesicles (sEVs) are cystic vesicles with a lipid bilayer structure secreted by multicellular bodies, typically ranging in diameter from 30 to 150 nm. The contents of sEVs, such as lipids, proteins, and nucleic acids, play crucial roles in intercellular communication. Extracellular vesicles secreted by different cells have different contents and functions, and these differences can be used as biomarkers for disease diagnosis. Small RNAs in sEVs, including microRNAs (miRNAs), have been considered potential biomarkers for various cancers. However, whether sEV miRNAs can serve as biomarkers for predicting the efficacy of immunotherapy combined with chemotherapy and for precise segmentation and monitoring of the efficacy in benefiting populations remains unclear.

[0058] The use of extracellular vesicle miRNAs in blood and their application in monitoring the efficacy or prognosis of lung cancer immunotherapy combined with chemotherapy. Currently, the imaging examinations widely used in clinical practice (such as enhanced chest CT, chest X-ray, MRI, and ultrasound) and tumor marker tests (such as CEA, NSE, CYFRA21-1, proGRP, and SCC-Ag) have low sensitivity and specificity for detecting the efficacy of lung cancer treatment and cannot be directly used to predict the efficacy of immunotherapy combined with chemotherapy. There are no research reports on highly specific extracellular blood vesicle miRNA biomarkers for predicting the efficacy of immunotherapy combined with chemotherapy in patients with lung adenocarcinoma and for accurately segmenting and monitoring the efficacy in the benefit population.

[0059] The following limitations exist in research on predicting the efficacy of immunotherapy combined with chemotherapy in patients with lung adenocarcinoma: a. There are relatively few studies focusing on predicting the efficacy of immunotherapy combined with chemotherapy in patients with lung adenocarcinoma; b. There are relatively few studies based on next-generation sequencing platforms; c. There are relatively few studies using extracellular vesicle contents as biomarkers for predicting the efficacy of immunotherapy combined with chemotherapy in patients with lung adenocarcinoma; d. There are no research reports proposing extracellular vesicle miRNAs as highly specific biomarkers to screen patients who will benefit from immunotherapy combined with chemotherapy regimens, or to accurately segment and monitor the efficacy of these patients.

[0060] Currently, there are no reports on highly specific blood extracellular vesicle miRNA biomarkers for predicting the efficacy of immunotherapy combined with chemotherapy in lung adenocarcinoma patients, especially for precise segmentation and monitoring of the efficacy in the benefit population. Studies on predicting the efficacy of immunotherapy combined with chemotherapy in lung adenocarcinoma patients are also limited. For example, CN116574807A, through high-throughput sequencing and bioinformatics analysis of plasma extracellular vesicle long RNAs (exLRs) before and after immunotherapy combined with chemotherapy in patients with advanced lung adenocarcinoma, combined with treatment response and survival analysis to identify and evaluate efficacy biomarkers, found that EV-derived CD160 can predict the efficacy of anti-PD-1 immunotherapy combined with chemotherapy in lung adenocarcinoma, and validated this at the RT-qPCR level. A predictive model based on peripheral blood EV-CD160 levels, NLR levels, and bone metastasis was established for predicting the efficacy of immunotherapy combined with chemotherapy in lung adenocarcinoma patients. However, the predictive performance of the biomarkers found in this study was poor, with an AUC of only 0.648 from ROC curve analysis, and the biomarker was blood exLRs; the extracellular vesicle miRNA biomarkers involved in the model established in this invention and their uses were not disclosed. CN114220486B describes a method for predicting the efficacy of immunotherapy combined with chemotherapy in lung cancer patients by detecting the expression of five types of immune cells and inputting the expression data of these five immune cells into a pre-trained support vector machine (SVM) model. The AUC of the training and validation groups of this vector model were 0.886 and 0.874, respectively, indicating high predictive performance. However, this literature primarily focuses on the expression of immune cells and does not disclose the extracellular vesicle miRNA biomarkers involved in this area, nor their applications.

[0061] To address the shortcomings in this field, the inventors, through analysis and screening of plasma extracellular vesicle miRNA expression profiles and treatment effects in patients with advanced lung adenocarcinoma before treatment, discovered and verified plasma exosome-derived miRNA biomarkers that can be used to predict the efficacy of immunotherapy combined with chemotherapy and to screen potential beneficiaries. These biomarkers can effectively indicate the efficacy of immunotherapy combined with chemotherapy in lung cancer patients, helping clinicians to conduct precise individualized assessments of patients with advanced lung adenocarcinoma, thereby bringing better survival benefits to patients. This has significant value for further segmenting the clinical application scenarios of immunotherapy combined with chemotherapy regimens.

[0062] The inventors used miRNA, a component of one of the contents of blood extracellular vesicles, to establish a biomarker model to identify patients who would benefit from immunotherapy combined with chemotherapy for lung cancer. However, many other components of extracellular vesicles exist, such as lncRNA, circRNA, mRNA, piRNA, proteins, lipids, and small molecule metabolites. These components could also be used to construct biomarker models to achieve similar effects to miRNA. In addition, various components in the patient's blood, such as cell-free nucleic acids (cfRNA and cfDNA), circulating tumor cells (CTCs), circulating tumor DNA (ctDNA), and protein biomarkers, can all serve as biomarkers to predict the efficacy of immunotherapy combined with chemotherapy for lung cancer.

[0063] Specifically, the inventors used blood samples from patients with advanced or metastatic lung adenocarcinoma who received immunotherapy combined with chemotherapy as research samples. They extracted blood exosomes using the L3525 extracellular vesicle (exosome) extraction reagent independently developed by Shanghai 3DMed Biomedical Technology Co., Ltd., and further used next-generation sequencing technology (small RNA sequencing) to detect the expression of extracellular vesicle miRNAs in the blood of the responders of this combined treatment. They discovered plasma exosome-derived miRNA biomarkers that can be used to accurately segment and monitor the efficacy of immunotherapy combined with chemotherapy in lung cancer patients.

[0064] In specific embodiments, the blood extracellular vesicle miRNA of the present invention is a miRNA with the sequence shown in SEQ ID NO: 1, a miRNA with the sequence shown in SEQ ID NO: 2, and / or a miRNA with the sequence shown in SEQ ID NO: 3; or a miRNA complementary to them.

[0065] In a preferred embodiment, the blood extracellular vesicle miRNA of the present invention is a combination of miRNA with the sequence shown in SEQ ID NO: 1, miRNA with the sequence shown in SEQ ID NO: 2, and miRNA with the sequence shown in SEQ ID NO: 3.

[0066] Based on the teachings of this invention, those skilled in the art will understand that the extracellular vesicle miRNA of the blood of this invention can be used for monitoring the efficacy or prognosis of immune-assisted chemotherapy in lung cancer, and can be used to prepare miRNA chips, detection reagents or detection kits for monitoring the efficacy or prognosis of immune-assisted chemotherapy in lung cancer.

[0067] In a specific embodiment, the miRNA chip includes: a solid-phase support; and oligonucleotide probes orderly immobilized on the solid-phase support, wherein the oligonucleotide probes specifically bind to the extracellular vesicle miRNAs of the present invention. Those skilled in the art will know how to design the oligonucleotide probes based on conventional techniques. For example, the oligonucleotide probes may contain: a complementary binding region; and / or a linker region connected to the solid-phase support.

[0068] In a specific embodiment, the detection kit contains a detection reagent for detecting extracellular vesicle miRNAs in blood according to the present invention, or the miRNA chip.

[0069] Based on the teachings of this invention and common knowledge in the field of miRNA, those skilled in the art will conceive of an isolated or artificially constructed precursor miRNA that can be cleaved and expressed in human cells as the extracellular vesicle miRNA of this invention. Furthermore, those skilled in the art will also conceive of an isolated polynucleotide that can be transcribed by human cells into the precursor miRNA, which can be cleaved and expressed in human cells as the miRNA.

[0070] In a specific embodiment, the polynucleotide has the structure shown in Formula I: Seq forward - X-Seq reverse I In Formula I, the forward Seq sequence is a nucleotide sequence that can be expressed as the miRNA in human cells; the reverse Seq sequence is a nucleotide sequence that is substantially complementary or completely complementary to the forward Seq sequence; X is a spacer sequence located between the forward and reverse Seq sequences, and the spacer sequence is not complementary to the forward and reverse Seq sequences. The structure shown in Formula I, after being transferred into human cells, forms the secondary structure shown in Formula II: Formula II, In Equation II, Seq forward, Seq reverse, and X are defined as above, and || represents the complementary base pairing relationship formed between Seq forward and Seq reverse.

[0071] Based on the teachings of this invention and common knowledge in the field of miRNA, those skilled in the art will also conceive of a vector containing the miRNA or polynucleotide described herein.

[0072] Immunotherapy combined with chemotherapy for lung cancer The "immunotherapy combined with chemotherapy for lung cancer" described in this article refers to a treatment regimen for lung cancer that combines immunotherapy drugs with chemotherapy drugs. The principle is to use chemotherapy to destroy cancer cells and release antigens, while simultaneously using immunotherapy drugs to activate the body's immune system, creating a synergistic effect and thus improving treatment efficacy.

[0073] In a specific embodiment, the immunotherapy combined with chemotherapy is a PD-1 inhibitor combined with chemotherapy. In a preferred embodiment, the immunotherapy combined with chemotherapy is pembrolizumab combined with chemotherapy. In a further preferred embodiment, the immunotherapy combined with chemotherapy is pembrolizumab combined with pemetrexed and carboplatin.

[0074] The present invention relates to a method and device for monitoring the efficacy or prognosis of lung cancer using immunotherapy combined with chemotherapy. The inventors have discovered that plasma extracellular vesicle miRNAs can be used for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy in lung cancer. Therefore, the inventors also provide a method for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy in lung cancer using said plasma extracellular vesicle miRNAs, comprising the following steps: (a) Detecting the expression level of miRNA in the sample of the subject to be tested; (b) Determine the efficacy of immunotherapy combined with chemotherapy on the subjects based on the expression level of the miRNA obtained in step (a).

[0075] In a specific implementation, a low miRNA expression level indicates a higher benefit to the subject from immunotherapy combined with chemotherapy; conversely, a high miRNA expression level indicates a lower benefit to the subject. For example, to determine whether a subject can benefit from immunotherapy combined with chemotherapy, the miRNA expression level can be measured first, and then compared with a reference value. The determination of whether a subject can benefit from immunotherapy combined with chemotherapy is based on the miRNA expression level relative to the reference value. The reference value can be the average CT value of the non-responder group markers.

[0076] In a preferred embodiment, the expression level of the miRNA in the subject is detected by PCR. The mean CT value of the non-responder group markers is used as a reference. If the relative expression level of the miRNA in the subject before immunotherapy combined with chemotherapy is greater than 1.5 times and P < 0.05, the subject is considered to have high expression; if the relative expression level of the miRNA in the subject before immunotherapy combined with chemotherapy is less than 2 / 3 times and P < 0.05, the subject is considered to have low expression. Further, the mean CT value of the non-responder group markers is used as a reference, corrected with internal or external references, and the relative expression level of the miRNA marker before treatment is calculated based on 2^(-ΔΔCT).

[0077] To implement the monitoring or prognostic method of the present invention, the inventors also provide an apparatus for monitoring or prognosing the efficacy of immunotherapy combined with chemotherapy for lung cancer, the apparatus having a storage device storing instructions for performing the method of the present invention for monitoring or prognosticating the efficacy of immunotherapy combined with chemotherapy for lung cancer.

[0078] In a specific implementation, the device includes a detection device for detecting the expression level of miRNA in a sample of the subject to be tested; and an output device for determining the efficacy of immunotherapy combined with chemotherapy on the subject based on the miRNA expression level obtained by the detection device.

[0079] Advantages of this invention: 1. Currently, there are no research reports on highly specific blood extracellular vesicle miRNA biomarkers for precise segmentation and monitoring of the efficacy of immunotherapy combined with chemotherapy in lung adenocarcinoma patients. This invention employs a plasma extracellular vesicle small RNA sequencing strategy and for the first time discovered three plasma extracellular vesicle miRNAs for lung cancer: miR-140-5p (MIMAT0000431, CAGUGGUUUUACCCUAUGGUAG, SEQ ID NO: 1), miR-597-3p (MIMAT0026619, UGGUUCUCUUGUGGCUCAAGCGU, SEQ ID NO: 2), and miR-92a-1-5p (MIMAT0004507, AGGUUGGGAUCGGUUGCAAUG CU, SEQ ID NO: 3). These can serve as biomarkers for monitoring the efficacy of immunotherapy combined with chemotherapy in lung cancer, exhibiting high sensitivity and convenience. 2. Compared with the disease stable and disease progressive groups, the inventors found that lung cancer patients with low expression levels of plasma extracellular vesicle miR-140-5p, miR-597-3p and miR-92a-1-5p, who achieved partial remission after immunotherapy combined with chemotherapy, could benefit from the pembrolizumab combined with chemotherapy regimen. 3. This invention employs liquid biopsy identification technology, which can be combined with imaging examinations to improve the specificity of efficacy monitoring in response populations of immunotherapy combined with chemotherapy, reduce false positives, avoid overtreatment, and can be used to accurately screen potential patients who will benefit from immunotherapy combined with chemotherapy for lung cancer, especially to accurately subdivide and monitor the efficacy of the benefit population.

[0080] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2001), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated.

[0081] Example Material All materials used in the following examples are commercially available.

[0082] method 1. Study cohort and clinical information This study included 28 patients with advanced or metastatic lung cancer in the study cohort. Blood samples were collected from patients before drug treatment. The inclusion criteria were as follows: 1) pathological diagnosis of lung adenocarcinoma; 2) first-time treatment with the regimen of pembrolizumab (Keytruda, a PD-1 inhibitor) + pemetrexed + carboplatin, with no prior history of chemotherapy; 3) available efficacy evaluation data. The training cohort included 12 lung cancer patients, of whom 6 showed disease remission with the immunotherapy combined with chemotherapy regimen (response group), and the other 6 showed stable or progressive disease with the regimen (non-response group). The validation cohort included 16 lung cancer patients, specifically 7 in the response group and 9 in the non-response group.

[0083] 2. Extraction and characterization of extracellular vesicles from plasma 1) Plasma collection and extracellular vesicle extraction Blood samples were collected from patients prior to their immunotherapy and chemotherapy regimens and stored in 10 mL vacuum blood collection tubes (REF367525, BD, USA). The tubes were gently inverted several times and then placed upright. Samples were centrifuged at 1600 g for 10 min at 4°C. Samples with a hemolysis grade less than 4 were used for subsequent studies. The supernatant was transferred to 1.5 mL EP tubes and centrifuged at 16000 g for 15 min at 4°C to remove residual cell debris. The supernatant was then aliquoted into 1.5 mL EP tubes and stored at -80°C for later use.

[0084] Frozen plasma samples were thawed in a 37°C water bath and centrifuged at 12000 g for 10 min at 4°C. The supernatant was then filtered sequentially through a 0.45 µm filter column (CLS8163-100EA, Corning, USA) and a 0.22 µm filter column (CLS8161-100EA, Corning, USA) at 4°C for 5 min. The filtrate was collected into a 2 mL EP tube. The volume of the filtrate was measured, and 1 / 4 volume of exosome precipitant L3525 (3DMed, Shanghai) was added. After vortexing and mixing, the mixture was incubated at 4°C for 30 min. The mixture was then centrifuged at 4700 g for 30 min at 4°C, the supernatant was discarded, and the extracellular vesicles were resuspended in 200 µL of PBS (Phosphate Buffer Saline).

[0085] This invention uses the extracellular vesicle (exosome) separation reagent L3525 (3DMed, Shanghai) to extract plasma extracellular vesicles. However, based on the teachings of this invention and conventional techniques in the art, those skilled in the art will recognize other alternatives, including but not limited to centrifugation (differential centrifugation, density gradient centrifugation), particle size separation (ultrafiltration, size exclusion chromatography), immunoaffinity assays, microfluidic technology, and preferably other commercially available exosome separation kits.

[0086] 2) Identification of extracellular vesicle characteristics in plasma TEM detection: Extracellular vesicles were resuspended in PBS and fixed with 4% paraformaldehyde. The fixed extracellular vesicles were then dropped onto a carbon-coated copper grid. After incubation at room temperature for 5 min, the grid was rinsed twice with PBS, once with PBS containing glycine (50 mM), and incubated with PBS containing 0.5% BSA for 10 min. Finally, the copper grid was negatively stained with 2% uranyl acetate for 10 min. The results were observed and photographed using a transmission electron microscope (H-7650, Hitachi, Japan).

[0087] NTA assay: First, plasma extracellular vesicles were diluted with PBS to 1*10^7-1*10^9 / mL and mixed thoroughly by pipetting. Then, the NTA instrument (NanoSight NS300, Malvern, UK) was turned on and the sample was injected into the sample chamber. Using the 488 nm excitation module, the camera lens parameters were set as follows: shutter speed 890, gain 146, and detection threshold 7. At least 200 complete tracks were analyzed for each video. Finally, the nanoparticle tracking data of the extracellular vesicles were analyzed using NTA version 2.3 analysis software.

[0088] 3. Extraction of extracellular vesicle miRNA from plasma Following the product instructions, total RNA was extracted from extracellular vesicles using the miRNeasy Serum / Plasma Kit (217184, QIAGEN, Shanghai), and finally eluted with 15 µL of RNase-free water. The concentration and fragment distribution of miRNAs were detected using an Agilent 2100 bioanalyzer and its accompanying small RNA analysis kit (5067-1548, Agilent).

[0089] This invention utilizes small RNA sequencing to detect the expression level of extracellular vesicle miRNAs in plasma. However, based on the teachings of this invention and conventional techniques in the art, those skilled in the art will recognize other alternatives, including but not limited to qRT-PCR, miRNA microarray detection, and third-generation sequencing technologies.

[0090] 4. Construction of a plasma extracellular vesicle miRNA library miRNA libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (E7300L, NEB, USA) according to the product instructions. 6 µL of each RNA sample was loaded, followed by 18 cycles of 3' adapter ligation, reverse transcription primer hybridization, 5' adapter ligation, reverse transcription, and PCR amplification. PCR amplification products were purified using the NucleoSpin Gel and PCR Clean-up kit (740609.250, MN, Germany), and the library DNA was eluted with 30 µL of elution buffer. The concentration of library DNA was detected using an Invitrogen Qubit 4 fluorometer and the accompanying Qubit dsDNA HS Assay Kit (Q32854, Thermofisher, USA). The distribution of library DNA fragments was detected using an Agilent 2100 bioanalyzer and the accompanying chips and reagents, the Agilent High Sensitivity DNA Kit & Reagents (5067-4626, Agilent, USA). Sequencing was performed using the Illumina NovaSeq platform with a sequencing strategy of 2x150 bp paired-end sequencing, and the sequencing data volume of each library was 6 G.

[0091] 5. Sequencing Data Analysis Workflow The expression levels of extracellular vesicle miRNAs in the plasma of lung cancer patients were obtained using small RNA sequencing technology. The analysis workflow for the sequencing data is as follows: 1) Sequencing data alignment. After removing the sequencing adapters from the small RNA sequencing data, the sequencing data was aligned to the human reference genome hg19 using BWA software (version: 0.7.12-r1039) (genome download link: http: / / hgdownload.soe.ucsc.edu / goldenPath / hg19 / bigZips / ), and the number of reads aligned to miRNAs was counted.

[0092] 2) miRNA annotation. miRNAs were annotated using the Gencode v25 and miRBase v21 databases, retaining those annotated as known mature miRNAs for subsequent analysis.

[0093] 3) miRNA filtering. Mature miRNAs with a length of 30 nt or less and covering at least 2 reads per sample are retained for subsequent analysis.

[0094] 4) miRNA expression level standardization. The miRNA expression levels of the samples were standardized using the M-value weighted truncated mean (TMM) method of the edgeR v3.26.8 analysis package and the voom method of the limma v3.40.6 analysis package.

[0095] 6. Biomarker Discovery Based on the expression levels of miRNAs in extracellular vesicles in the plasma of lung cancer patients, samples were grouped according to imaging assessments after immunotherapy combined with chemotherapy. Statistical methods were used to identify plasma extracellular vesicle miRNAs as biomarkers that can be used for precise segmentation and monitoring of the efficacy of immunotherapy combined with chemotherapy in benefiting patients in lung cancer. The process is as follows: 1) Sample grouping. Based on the imaging evaluation results after patients received immunotherapy combined with chemotherapy, the samples were grouped into a response group and a non-response group. The response group refers to patients who achieved partial remission (PR) after immunotherapy combined with chemotherapy, and the non-response group refers to patients who achieved stable disease (SD) or disease progression (PD) after immunotherapy combined with chemotherapy.

[0096] 2) Candidate Molecular Markers. The limma-voom method from the R language's limma analysis package was used to analyze miRNAs showing significant differences in expression levels between the response and non-response groups in the training cohort. miRNAs with an expression level CPM (Counts Per Million) greater than 32, a change greater than 1.5-fold between the two groups, and a p-value < 0.05 were selected as candidate molecular markers.

[0097] 3) Molecular marker validation. The linear model fitting method (limma-voom) in the limma analysis package of R language was used to analyze and validate miRNAs with significant differences in expression levels between the response group and the non-response group in the cohort, and the expression differences of the above candidate miRNA molecular markers were analyzed and compared.

[0098] Example 1 This embodiment recruited two research cohorts. Specific research cohorts and clinical information are described below: In this study, 28 patients with advanced or metastatic lung adenocarcinoma were included. Blood samples were collected from each patient before drug treatment for plasma extracellular vesicle extraction and subsequent analysis. The inclusion criteria were as follows: 1) Pathological diagnosis of lung adenocarcinoma; 2) First-time treatment with the "pembrolizumab (Keytruda, a PD-1 inhibitor) + pemetrexed + carboplatin" regimen, with no prior history of chemotherapy; 3) Efficacy evaluation data available. One month after drug treatment, efficacy was evaluated according to the RECIST 1.1 criteria for evaluating the efficacy of treatment in solid tumors. Thirteen patients showed partial response (PR) to the immunotherapy combined with chemotherapy regimen (response group), and 15 patients showed stable disease (SD) or progressive disease (PD) (non-response group). The training cohort included 12 lung cancer patients, of whom 6 showed disease response to the immunotherapy combined with chemotherapy regimen, and the other 6 showed stable disease or progressive disease. The validation cohort included 16 lung cancer patients, specifically 7 patients in disease remission and 9 patients with stable or progressive disease. Table 1 shows the patient grouping information, and the analysis results indicate that there was no significant difference in the proportion of samples from different categories between the two groups.

[0099] Table 1 Example 2. Extraction and Characterization of Extracellular Vesicles from Plasma In this embodiment, extracellular vesicles were extracted from the plasma of lung cancer patients using the company's independently developed extracellular vesicle extraction reagent L3525 (3DMed, Shanghai). TEM analysis was used to detect the morphology of the extracellular vesicles, and the results showed that the extracellular vesicles exhibited a typical "horseshoe" shape (see...). Figure 1 The particle size distribution of extracellular vesicles was determined using NTA. The results showed that the average particle size of the extracellular vesicles was 114.9 nm, which is consistent with the particle size distribution of extracellular vesicles (see...). Figure 2 ).

[0100] Example 3. Discovery of Molecular Markers In this embodiment, small RNA sequencing was used to detect the expression levels of extracellular vesicle miRNAs in the plasma of lung cancer patients in the training cohort. Based on the miRNA expression levels, patients were grouped according to the imaging assessment results after immunotherapy combined with chemotherapy. Statistical methods were used to identify miRNA biomarkers that can be used for precise segmentation and monitoring of the efficacy of immunotherapy combined with chemotherapy in the benefit population of lung cancer patients: miR-140-5p ( Figure 3 miR-597-3p Figure 4 ) and miR-92a-1-5p ( Figure 5 There are a total of 3 types.

[0101] The results showed that lung cancer patients with low levels of plasma extracellular vesicle expression of miR-140-5p, miR-597-3p, and miR-92a-1-5p, who experienced partial disease remission after immunotherapy combined with chemotherapy, could benefit from pembrolizumab combined with chemotherapy. Conversely, patients with high levels of these three miRNAs, whose disease was stable or progressed after immunotherapy combined with chemotherapy, benefited less from pembrolizumab combined with chemotherapy.

[0102] Example 4. Validation of Molecular Markers 1 In this embodiment, small RNA sequencing was used to detect and verify the expression levels of extracellular vesicle miRNA molecular markers in the plasma of a cohort of lung cancer patients. Based on miRNA expression levels and patient grouping, statistical methods were used to verify the above-mentioned three miRNA biomarkers that can be used for precise segmentation and monitoring of the efficacy of lung cancer immunotherapy combined with chemotherapy in the benefit population.

[0103] Validation results showed that plasma extracellular vesicles miR-140-5p ( Figure 6 miR-597-3p Figure 7 ) and miR-92a-1-5p ( Figure 8 Lung cancer patients with low levels of these three miRNAs who have achieved partial remission after immunotherapy combined with chemotherapy can benefit from pembrolizumab combined with chemotherapy. Conversely, patients with high levels of these three miRNAs who have achieved stable or progressive disease after immunotherapy combined with chemotherapy will benefit less from pembrolizumab combined with chemotherapy.

[0104] Example 5. Validation of Molecular Markers 2 In this embodiment, the inventors verified the efficacy of plasma extracellular vesicles miR-140-5p, miR-597-3p, and miR-92a-1-5p as biomarkers for monitoring the efficacy of immunotherapy combined with chemotherapy in lung cancer. The details are as follows: 1. Construction of a predictive model for the treatment efficacy of lung adenocarcinoma Using miRNA expression data from the training cohort, and with three molecular markers as variables, combined with imaging results, a predictive model for the treatment efficacy of lung adenocarcinoma was constructed. The model consists of three parts: parameters, model formula, and reference values. The process is as follows: 1) Model parameters. In the training queue, using three molecular markers as variables, 100-fold cross-validation with 100 repetitions was used to obtain the model calibration parameters and model coefficients of the molecular markers (Table 2).

[0105] Table 2. Parameters of the efficacy prediction model constructed using three miRNAs as markers. 2) Efficacy prediction model. The formula for the efficacy prediction model is as follows: Risk-Score = Among them, the Risk-Score is a predictive value for the response and non-response to the combined immunotherapy and chemotherapy. Gi This represents the expression value of the i-th miRNA. βi The coefficients representing the efficacy prediction model for the i-th miRNA, i = 1, 2, … n, where n is the total number of molecular markers predicted to respond to and not respond to the therapeutic effect. α The model correction value represents the risk score. Using a risk scoring model and the expression levels of three molecular markers in each sample, a risk value can be obtained for each sample. The level of the risk value reflects the patient's assessment of the efficacy of immunotherapy combined with chemotherapy.

[0106] 3) Reference value. When the hazard value is less than or equal to the reference value, the sample is predicted to be responsive to immunotherapy combined with chemotherapy; otherwise, it is predicted to be non-responsive. Receiver operating characteristic (ROC) curves were plotted for each patient in the training cohort based on their hazard value and imaging results. Based on the ROC curve results, and ensuring that the specificity and sensitivity are both greater than 0.5, the reference value was determined to be 3.604.

[0107] 4) Model Performance Evaluation. Using a reference value of 3.604, the training cohort samples were divided into a response group (predicted to respond to immunotherapy combined with chemotherapy) and a non-response group (predicted to not respond to immunotherapy combined with chemotherapy). The model's predictive performance was evaluated using imaging results as the true value. The model's predictive performance was evaluated using methods including Area Under the ROC Curve (AUC, range 0-1), specificity (range 0-1), and sensitivity (range 0-1), with higher values ​​indicating better performance. A value of 0.944 (e.g., AUC) was used to evaluate the model's predictive performance. Figure 9 As shown in Table 3, the efficacy prediction model achieved high AUC, specificity, and sensitivity in the training cohort, demonstrating superior predictive power.

[0108] Table 3. Performance evaluation of the three molecular marker-based efficacy prediction models 2. Validation of the efficacy of the lung adenocarcinoma treatment prediction model In the validation cohort, the efficacy of the model in predicting the treatment efficacy of immunotherapy combined with chemotherapy was validated based on the risk scoring model and reference values ​​determined in the training cohort. The process is as follows: 1) Risk Value. Calculate the risk value for each sample in the validation queue.

[0109] 2) Model efficacy validation. Using a reference value of 3.604, the validation cohort of patients was divided into a response group (predicted to respond to immunotherapy combined with chemotherapy) and a non-response group (predicted to not respond to immunotherapy combined with chemotherapy). ROC curves were plotted using imaging results as the true values ​​to evaluate the model's predictive efficacy, including AUC, specificity, and sensitivity. Higher values ​​indicated better efficacy. Specifically, AUC was 0.921 (e.g., AUC, specificity, and sensitivity). Figure 10 As shown in Table 3, the efficacy prediction models achieved high AUC, specificity, and sensitivity in the validation cohort, demonstrating superior predictive power.

[0110] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The use of plasma extracellular vesicle miRNA in the preparation of chips, detection reagents, or detection kits for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy in lung cancer, wherein the plasma extracellular vesicle miRNA is: (i) One or more of the miRNAs with sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i).

2. The use as described in claim 1, characterized in that, The lung cancer mentioned is lung adenocarcinoma.

3. A miRNA chip, wherein the miRNA chip comprises: Solid support; as well as An oligonucleotide probe is ordered and immobilized on the solid support, and the oligonucleotide probe specifically binds to miRNA; The miRNA mentioned above is: (i) One or more of the miRNAs with sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i).

4. The use of the miRNA chip according to claim 3, for preparing a test kit for monitoring the efficacy or prognosis of immune-mediated chemotherapy in lung cancer.

5. A kit containing a detection reagent for detecting miRNA; in, The miRNA mentioned is: (i) One or more of the miRNAs with sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i) Alternatively, the kit may contain the miRNA chip of claim 3.

6. A plasma extracellular vesicle miRNA for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy in lung cancer; in, The miRNA mentioned is: (i) One or more of the miRNAs with sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i).

7. An isolated or artificially constructed precursor miRNA, said precursor miRNA being cleaved and expressed in human cells as the miRNA of claim 6.

8. An isolated polynucleotide, said polynucleotide being transcribed into a precursor miRNA by human cells, said precursor miRNA being cleaved and expressed in human cells as the miRNA of claim 6.

9. A vector comprising the miRNA of claim 6 or the polynucleotide of claim 8.

10. A method for monitoring the efficacy or prognosis of immunotherapy combined with chemotherapy for lung cancer, comprising the following steps: (a) Detecting the expression level of miRNA in the sample of the subject to be tested; (b) Determine the efficacy of immunotherapy combined with chemotherapy on the subjects based on the expression level of the miRNA obtained in step (a); The miRNA mentioned above is: (i) one or more of the following: miRNA with the sequence shown in SEQ ID NO: 1, miRNA with the sequence shown in SEQ ID NO: 2, and miRNA with the sequence shown in SEQ ID NO: 3; or (ii) miRNAs complementary to the miRNA sequences described in (i).

11. An apparatus for monitoring or predicting the efficacy of immunotherapy combined with chemotherapy for lung cancer, the apparatus having a storage device storing instructions for performing the method of monitoring or predicting the efficacy of immunotherapy combined with chemotherapy for lung cancer as described in claim 10.

Images