Engineering strain for efficiently producing Ectoin through polysaccharide co-utilization and fermentation process
By modifying the CCR system of Escherichia coli, an engineered strain capable of simultaneously utilizing glucose and xylose was constructed, solving the problem of low xylose utilization in ectoine fermentation and achieving high-efficiency production and cost reduction.
Patent Information
- Application Number
- CN202610297811.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-12
- Publication Date
- 2026-05-19
AI Technical Summary
In existing technologies, E. coli exhibits a carbon metabolism repression (CCR) effect when co-fermenting glucose and xylose to produce ectoine, resulting in low xylose utilization, prolonged fermentation cycle, difficulty in increasing yield, and high cost.
By knocking out the crr and ptsG genes in E. coli using CRISPR-Cas9 technology, overexpressing the xylA, xylB, and xylR genes to enhance xylose utilization, and overexpressing the glk and galp genes to enhance glucose utilization, an ectoin synthesis module was constructed to form an engineered strain capable of simultaneously utilizing glucose and xylose.
Simultaneous co-utilization of glucose and xylose was achieved, significantly improving fermentation efficiency and ectoine yield, reducing production costs, and achieving a yield of 162.2 g/L and a carbon source yield of 0.37 g/g.
Smart Images

Figure CN122060656A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fermentation engineering and relates to a genetically engineered bacterium that efficiently co-utilizes glucose and xylose to produce ectoine and its application. Background Technology
[0002] Ectoin, also known as tetrahydropyrimidine, is a derivative of a cyclic amino acid and an important compatible solute. It is the most common osmoregulator in salt-tolerant microorganisms, helping organisms resist high osmotic pressure. Among known compatible solutes such as trehalose, glutamic acid, and betaine, ectoin exhibits strong cytoprotective capabilities.
[0003] Ectoine is widely used in cosmetics and pharmaceuticals due to its long-lasting moisturizing effects. It is a more effective long-lasting moisturizer than glycerin, effectively reducing cell damage from UV and visible light, protecting skin from oxidative damage, and combating aging. Ectoine is also an excellent biological stabilizer, skin protectant, and potential pharmaceutical agent. Due to its widespread use in cosmetics and pharmaceuticals, the annual demand for ectoine is approximately 15,000 tons, with a market size in the billions of dollars.
[0004] Currently, there are two main fermentation processes for ectoine: wild-type fermentation and engineered-type fermentation. Wild-type fermentation typically requires a high-salt environment, which severely corrodes fermentation equipment and results in low yields. Engineered-type bacteria, primarily *E. coli* and *Corynebacterium glutamicum*, have higher production potential. Due to the large demand and high production costs of ectoine, a low-cost, high-yield fermentation process is needed. Carbon sources are among the most expensive components in ectoine production; if glucose is used as the carbon source, its cost accounts for at least half of the culture medium cost. To reduce production costs, using cheaper cellulose hydrolysate as the carbon source for ectoine is an efficient solution. However, cellulose hydrolysate contains a large amount of xylose and glucose coexisting. When using cellulose hydrolysate as the carbon source, *E. coli* exhibits a significant carbon metabolism repression (CCR) effect: it preferentially utilizes glucose, only starting to utilize xylose after glucose is depleted. This "two-stage growth" model leads to prolonged fermentation cycles, low xylose utilization, and difficulty in increasing yield. The key to improving the utilization efficiency of cellulose hydrolysate lies in efficiently utilizing mixed sugars simultaneously. This study constructed an engineered *E. coli* strain capable of efficiently utilizing both glucose and xylose, which not only reduced the production cost of ectoine but also improved fermentation efficiency. Ultimately, a highly efficient fermentation method for ectoine production suitable for industrial applications was obtained, achieving high yields and production rates. Summary of the Invention
[0005] The purpose of this invention is to provide an ectoin-producing strain that uses both glucose and xylose for fermentation, thereby solving the problems of low conversion rate, low yield, and low xylose utilization efficiency in the current Escherichia coli co-utilization of glucose and xylose to produce ectoin.
[0006] To achieve the above technical objectives, the present invention adopts the following technical solution: An ectoin production strain that co-ferments glucose and xylose eliminates the CCR effect compared to traditional Escherichia coli, exhibiting higher xylose utilization capacity and efficiency. This modification solves the problem of low xylose utilization and difficulty in increasing yield when using mixed sugars as carbon sources.
[0007] A strain that efficiently co-utilizes glucose and xylose to produce ectoine, wherein the genetically engineered bacterium is a recombinant *E. coli* strain modified with a chassis microbiome; the chassis microbiome modification is based on *E. coli* K-12 substr. MG1655 as the starting strain, with the knockout of... crr, ptsG The strain inhibits the PTS system; it also includes an ectoin synthesis module and a carbon flow enhancement module; in a preferred embodiment, the ectoin synthesis module is an overexpressed gene. ectA, ectB, ectC The carbon flow enhancement module is an overexpression gene. lysC, glk, galp, xylA, xylB, xylR .
[0008] The strain is able to simultaneously utilize both glucose and xylose in a mixed carbon source containing glucose and xylose.
[0009] xylA The sequence is shown in SEQ ID NO: 3; xylB The sequence is shown in SEQ ID NO: 4; xylR The sequence is shown in SEQ ID NO: 5; glk The sequence is shown in SEQ ID NO: 6; galp The sequence is shown in SEQ ID NO: 7.
[0010] Knockout crr, ptsG Inhibit the PTS system, overexpress glk and galp Glucose salvage uptake, overexpression xylA , xylB and xylR Xylose utilization enhancement was performed, and the strain constructed in this invention was synergistically able to utilize both xylose and glucose.
[0011] The strain constructed in this invention not only enhances the utilization of glucose and xylose, but also functionally alters the glucose and xylose utilization patterns of the strain: compared to the sequential utilization pattern of wild-type or starting strains, which preferentially utilize glucose and only initiate xylose metabolism after glucose is depleted, the modified strain of this invention removes carbon decomposition repression (CCR), enabling simultaneous transport and co-metabolization of glucose and xylose in the presence of glucose, achieving simultaneous consumption and synergistic utilization of the two carbon sources, and significantly improving the utilization efficiency and fermentation performance of mixed sugar substrates.
[0012] A second objective of this invention is to provide a method for constructing the aforementioned strain, comprising: The MG1655 strain of E. coli was knocked out using CRISPR-Cas9 technology. crr and ptsG Genes, resulting in gene knockout chassis strains; Amplification ectABC Gene cluster gene sequences are inserted into vector plasmids using a one-step cloning method involving enzyme digestion to obtain expression plasmids; Amplification lysC, glk, galp The gene sequence is inserted into the vector plasmid using a one-step cloning method involving enzyme digestion to obtain the expression plasmid; Amplification xylA, xylB, xylR The gene sequence is inserted into the vector plasmid using a one-step cloning method involving enzyme digestion to obtain the expression plasmid; The expression plasmids were introduced into the bacterial strains in the chassis.
[0013] In a preferred embodiment, the vector plasmids are pTrc99a, pCDFtrc, and pRSFtrc, respectively. The pCDFtrc plasmid is a pCDFduet plasmid in which the T7 promoter is replaced with the Trc promoter via a one-step PCR cloning process. The pRSFtrc plasmid is a pRSFduet plasmid in which the T7 promoter is replaced with the Trc promoter via a one-step PCR cloning process.
[0014] As a preferred implementation method, lysC, glk, galp Gene sequence inserted into the vector plasmid pCDFtrc; xylA、 xylB、xylR The gene sequence was inserted into the vector plasmid pRSFtrc.
[0015] Amplification was performed using the following primers. ectABC Gene cluster gene sequence: ectAF: 5'-CATGGAATTCGAGCTCGGTACCATGAGCACGCCAATAATACC-3' ectCR: 5'-CAGGTCGACTCTAGAGGATCCCTCACCAGTAGGTGCGGCG-3'.
[0016] Amplification was performed using the following primers. lysC Gene sequence: eclysC P1A-F: 5'-TGGAATTCGAGCTCGGTACCTGACACGAGGTAGTTATGTC-3' ectOv-eclysC P1-R:5'-TCAAGGATTAATGCCACGCT-3' ectOv-eclysC P2-F: 5'-AGCGTGGCATTAATCCTTGA-3' eclysC P2-R: 5'-CAGGTCGACTCTAGAGGATCCCTGTTACTCAAACAAATTACTATGCAG-3'.
[0017] Amplification was performed using the following primers. glk Gene sequence: glk-F: TGTTTAACTTTAAGAAGGAGATATACCatgacaaagtatgcattagtcggtg glk-R: CAGGTCGACTCTAGAGGATCCCTGttacagaatgtgacctaaggtctgg Amplification was performed using the following primers. galp Gene sequence: galp-F: TGTTTAACTTTAAGAAGGAGATATACCatgcctgacgctaaaaaacag galp-R: CAGGTCGACTCTAGAGGATCCCTGttaatcgtgagcgcctatttcg Amplification was performed using the following primers. xylA Gene sequence: xylA-F: cacacaggaaacagaccatGatgcaagcctattttgaccag xylA-R: CAGGTCGACTCTAGAGGATCttatttgtcgaacagataatggtttacc Amplification was performed using the following primers. xylB Gene sequence: xylB-F: TGTTTAACTTTAAGAAGGAGATATACCATGTATATCGGGATAGATCTTGGCAC xylB-R: GTGCCAAGATCTATCCCGATATACATGGTATATCTCCTTCTTAAAGTTAAACA Amplification was performed using the following primers. xylR Gene sequence: xylR-F: TGTTTAACTTTAAGAAGGAGATATACCATGTTTACTAAACGTCACCGC xylR-R: GTAAATAGCGAGGTCATGTTGTAGGATCCTCTAGAGTCGACCTG In a preferred embodiment, the lysC gene includes an endogenous Escherichia coli gene or an exogenous lysC gene; and includes a mutant gene that resists feedback inhibition.
[0018] A third objective of this invention is to provide the application of the above-mentioned strain in the fermentation production of ectoine, including: The ectoin synthesizing strain was streaked onto solid LB medium and cultured at 35-39℃ for 8-16 hours. Select the cultured bacterial strains, inoculate them into liquid LB medium, and incubate at 35-39℃ for 8-16 hours to obtain seed culture; Inoculate the seed culture into the fermentation medium, add ampicillin, streptomycin, and kanamycin. When the OD reaches 8, add IPTG inducer and ferment at 35-39℃ for 36-100h.
[0019] In a preferred embodiment, the fermentation medium for the strain is composed of: 20-30 g / L carbon source, 6 g / L nitrogen source, 2 g / L sodium citrate dihydrate, 4 g / L potassium dihydrogen phosphate, 1.2 g / L magnesium sulfate, 0.2 g / L ferric sulfate, and 0.2 g / L manganese sulfate.
[0020] In a preferred embodiment, when using a fermenter for fermentation, the carbon source is a mixture of glucose and xylose in a ratio of 1:1 to 4:1, or cellulose hydrolysate containing glucose, xylose, and other carbon sources. The carbon source concentration is maintained at 1-5 g / L by fed-batch feeding. Preferably, the ratio of glucose to xylose in the carbon source is 2:1.
[0021] As a preferred embodiment, the utilization efficiency is highest when the sugar ratio of glucose to xylose is 2:1. The production process of lignocellulose hydrolysate involves pre-treating wheat straw by steam explosion, followed by alkali treatment with potassium sulfite and potassium hydroxide at a dry weight ratio of 30:3:1. The treated wheat straw is then soaked in 1% sulfuric acid, followed by the addition of 5×10⁻⁶ ppm of alkali. 9CFU of Clostridium thermophilum and 500 FPU (filter paper enzyme units) of cellulase were used for hydrolysis, and finally detoxification was performed with activated charcoal powder.
[0022] In this invention, by knocking out crr, ptsG Inhibiting the PTS system relieved the inhibition of xylose utilization through overexpression. xylA, xylB, xylR It enhances xylose utilization and overexpression. glk, galp This enhanced glucose utilization, resulting in the construction of an engineered *E. coli* strain capable of co-utilizing xylose and glucose. This was achieved through gene overexpression. ectA, ectB, ectC, lysC This invention constructs an engineered strain capable of efficiently producing ectoine using mixed sugars, effectively improving the efficiency of ectoine production using mixed sugars or cellulose hydrolysate as a carbon source, thus increasing fermentation efficiency. This invention efficiently utilizes inexpensive lignocellulose hydrolysate as a carbon source, and since carbon source costs account for a relatively high proportion in ectoine fermentation, this invention can further reduce the production cost of ectoine.
[0023] The present invention has the following beneficial effects: (1) This invention constructs an Escherichia coli strain that can efficiently produce ectoine and determines a modified combination that can efficiently utilize xylose. This Escherichia coli can efficiently co-utilize glucose and xylose, which can effectively improve the production efficiency of ectoine and reduce production costs.
[0024] (2) In this invention, an optimized fermentation medium is used for fermentation or fed-batch fermentation, which can achieve a maximum ectoine yield of 162.2 g / L, a carbon source yield of 0.37 g / g, and efficient utilization of xylose, providing favorable conditions for the industrial synthesis of ectoine by the strain. Attached Figure Description
[0025] Figure 1 This is the time variation of cell growth and substrate consumption during the fermentation process of Example 14.
[0026] Figure 2 This is a graph showing the real-time consumption rate of xylose and glucose during the fermentation process of Example 14. Detailed Implementation
[0027] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments.
[0028] The ectoine detection method in this embodiment is as follows: Every 4-12 hours, 2 mL of sample was taken. A portion of this sample was diluted to an appropriate concentration, and the absorbance at 600 nm was measured using a spectrophotometer to indicate the bacterial cell count. The remaining sample was centrifuged at 12000 rpm for 2 min, and the supernatant was collected. A portion of the supernatant was used to detect the residual sugar concentration using a biosensor analyzer; the remaining portion was diluted to an appropriate concentration, filtered through a 0.22 μm pore size filter, and added to a liquid chromatography sample vial for detection using high-performance liquid chromatography (HPLC). The HPLC used a C18 column, with a mobile phase of 20% acetonitrile and 80% water. The ectoine concentration was calculated by comparing the peak area with that of the standard sample.
[0029] Production rate calculation method: yield (g / L) / fermentation time (H).
[0030] The following examples illustrate the fermentation culture of the strain, with the following steps: (1) Plate culture: The strain was streaked onto LB solid medium (5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, 15 g / L agar. Sterilized at 115℃ for 20 min) and cultured at 37℃ for 12-18 h; (2) Seed culture: Pick the inoculum from the plate containing the inoculum or take the inoculum from the seed tube, inoculate it into a test tube containing 5 mL LB medium, and place it in a shaker at 37℃ and culture at 180 rpm for 12 h to obtain the seed culture. (3) Shake-flask fermentation: The activated seed culture was inoculated into a shake flask at an inoculum size of 1% (v / v). The fermentation medium consisted of 20 g / L carbon source, 6 g / L ammonium chloride, 2 g / L sodium citrate dihydrate, 4 g / L potassium dihydrogen phosphate, 1.2 g / L magnesium sulfate, 0.2 g / L ferric sulfate, and 0.2 g / L manganese sulfate. The flask was placed in a shaker at 37℃ and fermented at 180 rpm for 48 h. IPTG 0.1 mmol / L was added at 4 h. Ammonia was added every 12 h to adjust the pH to 7.
[0031] The chassis microbiota were modified using *Escherichia coli* K-12 substr. MG1655 as the starting strain. The modification primarily targeted the original phosphotransferase system of *E. coli*. Using CRISPR-Cas9 technology, the phosphotransferase system in the chassis strain was precisely knocked out. crr and ptsG Genes. Additionally, glucose salvage uptake is achieved through overexpression of glk and galp, through overexpression... xylA , xylB and xylR Xylose utilization enhancement was performed. Finally, overexpression was used. lysC and ectABCGene clusters enhance ectoine expression. This invention focuses on the metabolic characteristics of ectoine synthesis, constructing a targeted modification system that resolves the natural conflict between CCR resolution and ectoine synthesis, the contradiction between xylose metabolism and precursor supply, and energy deficiency and metabolic burden, thereby improving ectoine yield and productivity.
[0032] Example 1 Construction of strain Methods for constructing bacterial strains include: The MG1655 strain of E. coli was knocked out using CRISPR-Cas9 technology. crr and ptsG Gene knockout chassis strains were obtained; the CRISPR-Cas9 technology specifically involves: treating competent cells in target *E. coli* with calcium chloride to introduce the pEcCas plasmid, and then separately introducing the pTarget plasmid containing the target fragment and homologous arm fragments via electroporation for knockout. Finally, rhamnose, glucose, and sucrose were added to eliminate the knockout plasmid.
[0033] The following primers were used for amplification to knockout. crr pTarget plasmid: CRRn20-1-F: TGGAGATAACAACCGGAGTCgttttagagctagaaatagcaag CRRn20-1-R: GACTCCGGTTGTTATCTCCAactagtattatacctaggactg The following primers were used for amplification to knockout. crr Homologous arm fragments: CRRty-FR: ggcaagaattacttcttgatgcgggatcttctcctaagcagtaaattgg CRRty-BR: ttggcgatattgatagcggaat CRRty-FF: gtaaagcgtttgacgagtcaa CRRty-BF: ccaatttactgcttaggagaagatcccgcatcaagaagtaattcttgcc The following primers were used for amplification to knockout. ptsG pTarget plasmid: ptsg n201-F:GATGCCATAGGCAACAACTGgttttagagctagaaatagcaagtt ptsg n201-R: CAGTTGTTGCCTATGGCATCactagtattatacctaggactgagctag The following primers were used for amplification to knockout. ptsG Homologous arm fragments: ptsg-FF: acacctatccccggcagc ptsg-FR: catactcaggagcactctcaatttccgtaagacgttggggagac ptsg-BF: aattgagagtgctcctgagtatg ptsg-BR: gaaacggcgggtaaattactg Amplification ectABC The gene cluster gene sequence was constructed using the same method as patent CN118028204B, and the expression plasmid was obtained by inserting it into the vector plasmid using a one-step cloning method involving enzyme digestion. Amplification was performed using the following primers. ectABC Gene cluster gene sequence: ectAF: 5'-CATGGAATTCGAGCTCGGTACCATGAGCACGCCAATAATACC-3' ectCR: 5'-CAGGTCGACTCTAGAGGATCCCTCACCAGTAGGTGCGGCG-3'.
[0034] The vector plasmid used is pTrc99a plasmid.
[0035] Amplification lysC, glk, galp The gene sequence was inserted into the vector plasmid pCDFtrc using a one-step cloning method involving enzyme digestion to obtain the expression plasmid; The lysC gene includes endogenous E. coli genes or exogenous lysC genes; and includes mutant genes that resist feedback inhibition. In this embodiment, a mutant lysC gene from E. coli is used, with a sequence identical to that in patent CN118028204B.
[0036] Amplification was performed using the following primers. lysC Gene sequence: eclysC P1A-F: 5'-TGGAATTCGAGCTCGGTACCTGACACGAGGTAGTTATGTC-3' ectOv-eclysC P1-R:5'-TCAAGGATTAATGCCACGCT-3' ectOv-eclysC P2-F: 5'-AGCGTGGCATTAATCCTTGA-3' eclysC P2-R: 5'-CAGGTCGACTCTAGAGGATCCCTGTTACTCAAACAAATTACTATGCAG-3'.
[0037] Amplification was performed using the following primers. glk Gene sequence: glk-F: TGTTTAACTTTAAGAAGGAGATATACCatgacaaagtatgcattagtcggtg glk-R: CAGGTCGACTCTAGAGGATCCCTGttacagaatgtgacctaaggtctgg Amplification was performed using the following primers. galp Gene sequence: galp-F: TGTTTAACTTTAAGAAGGAGATATACCatgcctgacgctaaaaaacag galp-R: CAGGTCGACTCTAGAGGATCCCTGttaatcgtgagcgcctatttcg The pCDFtrc plasmid is a pCDFduet plasmid in which the T7 promoter is replaced with the trc promoter through a one-step PCR cloning process. The final plasmid sequence is shown in SEQ ID NO: 1.
[0038] Amplification xylA, xylB, xylR The gene sequence was inserted into the vector plasmid pRSFtrc using a one-step cloning method involving enzyme digestion to obtain the expression plasmid; Amplification was performed using the following primers. xylA Gene sequence: xylA-F: cacacaggaaacagaccatGatgcaagcctattttgaccag xylA-R: CAGGTCGACTCTAGAGGATCttatttgtcgaacagataatggtttacc Amplification was performed using the following primers. xylB Gene sequence: xylB-F: TGTTTAACTTTAAGAAGGAGATATACCATGTATATCGGGATAGATCTTGGCAC xylB-R: GTGCCAAGATCTATCCCGATATACATGGTATATCTCCTTCTTAAAGTTAAACA Amplification was performed using the following primers. xylR Gene sequence: xylR-F: TGTTTAACTTTAAGAAGGAGATATACCATGTTTACTAAACGTCACCGC xylR-R: GTAAATAGCGAGGTCATGTTGTAGGATCCTCTAGAGTCGACCTG The pRSFtrc plasmid is a pRSFduet plasmid in which the T7 promoter is replaced with the trc promoter by one-step PCR cloning. The final plasmid sequence is shown in SEQ ID NO: 2.
[0039] The expression plasmids were introduced into the knockout cells via chemical transformation. crr and ptsG In the chassis strain: competent cells were prepared by adding glycerol-calcium chloride solution, and plasmids were introduced into the strain through heat shock transformation.
[0040] The xylA sequence is shown in SEQ ID NO: 3; the xylB sequence is shown in SEQ ID NO: 4; the xylR sequence is shown in SEQ ID NO: 5; the glk sequence is shown in SEQ ID NO: 6; the galp sequence is shown in SEQ ID NO: 7; and the lysC gene sequence is shown in SEQ ID NO: 8. ectABC The nucleotide sequence of the gene cluster is shown in SEQ ID NO: 9.
[0041] Examples 2-5 Examples 2-5 show the results of glucose and xylose utilization by strains with different knockout modifications, investigating the effect of modification methods on xylose utilization by engineered E. coli. The strains in the examples have been overexpressed. ectABC and aspartate kinase lysC The modification involved adding 10 g / L glucose and 10 g / L xylose as carbon sources, and the results are shown in Table 1: Table 1. Fermentation results of Examples 2-5 Serial Number Modification method <![CDATA[OD 600 ]]> Glucose utilization (g / L) Xylose utilization (g / L) Ectocin yield (g / L) Example 2 Unmodified 7.25 9.8 2.4 3.01 Example 3 Knockout 5.68 8.6 3.8 4.48 Example 4 Knockout 5.38 8.4 3.7 4.29 Example 5 Knockout and 5.81 8.6 4.2 4.53 It can be seen that joint knockout crr and ptsG It is beneficial to the utilization of xylose and the production of ectoine, increasing the yield by 5.6% compared to knocking out ptsG alone, and increasing xylose consumption by 10% when both are knocked out.
[0042] Examples 6-13 Examples 6-13 show the results of glucose and xylose utilization by strains with different knockout modifications, investigating the effect of modification methods on xylose utilization by engineered E. coli. The strains in these examples have been overexpressed. ectABC and aspartate kinase lysC, Knockout crr and ptsG The modification involved adding 20 g / L glucose and 10 g / L xylose as carbon sources, and the results are shown in Table 2. Table 2 Fermentation results of Examples 6-13 Serial Number Modification method <![CDATA[OD 600 ]]> Glucose utilization (g / L) Xylose utilization (g / L) Ectocin yield (g / L) Example 6 overexpression 6.2 9.2 4.6 4.69 Example 7 overexpression 6.1 8.7 4.5 4.40 Example 8 overexpression 6.8 9.5 5.8 5.31 Example 9 overexpression 6.9 9.4 6.1 5.49 Example 10 overexpression 6.3 11.8 4.4 5.20 Example 11 overexpression 6.6 10.6 5.0 5.36 Example 12 overexpression 7.2 14.6 4.2 6.27 Example 13 overexpression 7.4 12.4 7.2 6.75 It can be seen that enhancing the uptake of both xylose and glucose is beneficial to ectoine production, and synergistic enhancement further improves sugar utilization efficiency and ectoine yield. Ultimately, ectoine yield increased by 43% through enhanced sugar uptake.
[0043] Example 14
[0044] Example 14 investigated the ability to produce ectoine using cellulose hydrolysate fermentation under near-realistic fermentation conditions.
[0045] This embodiment uses the genetically engineered strain modified in Example 13: which has already been overexpressed. ectABC and aspartate kinase lysC Knockout crr and ptsG Based on the modification, further express xylA , xylB , xylR , glk , galp Gene.
[0046] The method for preparing cellulose hydrolysate is as follows: First, wheat straw is pretreated by steam explosion, then treated with alkali at a dry weight ratio of potassium sulfite to potassium hydroxide of 30:3:1. The treated wheat straw is then soaked in 1% sulfuric acid (H₂SO₄), followed by the addition of a 5×10⁻⁶ solution. 9 CFU of Clostridium thermocellum and 500 FPU (filter paper enzyme units) of cellulase were used for hydrolysis, followed by detoxification with activated charcoal powder. The main components of the cellulose hydrolysate were 12.8 g / L glucose, 5.8 g / L xylose, and 0.3 g / L arabinose.
[0047] (1) Plate culture: The engineered Escherichia coli was streaked onto LB solid medium and cultured at 37℃ for 12-18 h. (2) Seed culture: Pick a spot from the plate containing the strain or take the strain from the seed tube, inoculate it into a test tube containing 5 mL LB medium, place it in a shaker at 37℃ and culture at 180 rpm for 12 h to obtain the seed culture; (3) Fermentation tank culture: The activated seed culture was inoculated into the fermentation tank at an inoculation rate of 10% (v / v). The stirring speed was 600-800 rpm, the dissolved oxygen was controlled at 40%, and the fermentation culture was carried out at 37℃. The pH was maintained at 7.0 throughout the process using ammonia water. The fermentation medium consisted of 6 g / L ammonium chloride, 2 g / L sodium citrate dihydrate, 4 g / L potassium dihydrogen phosphate, 1.2 g / L magnesium sulfate, 0.2 g / L ferric sulfate, and 0.2 g / L manganese sulfate. At the beginning of fermentation, 100 mg / L ampicillin, 50 mg / L kanamycin, and 50 mg / L streptomycin were added. The initial hydrolysate concentration was 20 g / L. When glucose was depleted, glucose was replenished to maintain a glucose concentration of about 1 g / L. 600 When the concentration reaches 8, add 0.1 mmol / L of IPTG.
[0048] Table 3 Fermentation results of Example 14 Serial Number Use carbon source <![CDATA[OD 600 ]]> Ectocin (g / L) Glucose utilization (g / L) Xylose utilization (g / L) Production rate (g / L / h) Yield (g / g) Example 14 Cellulose hydrolysate 73.2 162.2 292.0 145.7 3.53 0.37 The results of Example 14 are as follows Figure 1 , Figure 2 As shown, the consumption curves of glucose and xylose decreased synchronously during fermentation, with no significant metabolic lag. Escherichia coli OD 600 The yield can reach 73.2 g / L, with a relatively high yield of 0.37 g / g sugar, and approximately 98% of the added xylose is utilized. The highest yield of ectoine can reach 162.2 g / L at 46 h, with a production rate of 3.53 g / L / h.
[0049] Compared to other ectoine-producing strains that have difficulty utilizing xylose, this method demonstrates better utilization of xylose as a carbon source and cellulose hydrolysate, with a higher proportion of xylose being utilized. This approach further improves the yield of ectoine produced from mixed sugars and reduces the production cost of ectoine, potentially bringing considerable economic benefits to the industrial-scale production of ectoine using engineered E. coli strains.
Claims
1. An engineered strain for producing ectoine using polysaccharides, characterized in that, The engineered strain is a recombinant Escherichia coli that has undergone chassis microbial modification. The chassis microbial modification uses Escherichia coli MG1655 as the starting strain and knocks out... crr、ptsG The strain also includes an ectoin synthesis module and a carbon flow enhancement module to inhibit the PTS system; the ectoin synthesis module is an overexpressed gene. ectA, ectB, ectC The carbon flow enhancement module is an overexpression gene. lysC, glk, galp xylA, xylB, xylR .
2. The method for constructing the engineered strain according to claim 1, characterized in that, include: The MG1655 strain of E. coli was knocked out using CRISPR-Cas9 technology. crr and ptsG Genes, resulting in gene knockout chassis strains; Amplification ectABC Gene cluster gene sequences are inserted into vector plasmids using a one-step cloning method involving enzyme digestion to obtain expression plasmids; Amplification lysC, glk, galp The gene sequence is inserted into the vector plasmid using a one-step cloning method involving enzyme digestion to obtain the expression plasmid; Amplification xylA, xylB, xylR The gene sequence is inserted into the vector plasmid using a one-step cloning method involving enzyme digestion to obtain the expression plasmid; The expression plasmids were introduced into the bacterial strains in the chassis.
3. The construction method according to claim 2, characterized in that, The vector plasmids selected are pTrc99a plasmid, pCDFtrc plasmid, and pRSFtrc plasmid.
4. The construction method according to claim 3, characterized in that, The pCDFtrc plasmid is a pCDFduet plasmid that replaces the T7 promoter with the trc promoter through a one-step PCR cloning process. The pRSFtrc plasmid is a pRSFduet plasmid that replaces the T7 promoter with the trc promoter through a one-step PCR cloning process.
5. The construction method according to claim 3, characterized in that, ectABC Gene cluster gene sequences were inserted into the vector plasmid pTrc99a; lysC, glk, galp Gene sequence inserted into the vector plasmid pCDFtrc; xylA, xylB, xylR The gene sequence was inserted into the vector plasmid pRSFtrc.
6. The construction method according to claim 2, characterized in that, The lysC Genes include endogenous E. coli genes, or exogenous genes. lysC Genes; and including mutated genes that resist feedback inhibition.
7. The use of the strain described in claim 1 in the fermentation production of ectoine.
8. The application according to claim 7, characterized in that, The fermentation medium for the strain consisted of: 20-30 g / L carbon source, 6 g / L nitrogen source, 2 g / L sodium citrate dihydrate, 4 g / L potassium dihydrogen phosphate, 1.2 g / L magnesium sulfate, 0.2 g / L ferric sulfate, and 0.2 g / L manganese sulfate.
9. The application according to claim 7, characterized in that, When using a fermenter, the carbon source is a mixture of glucose and xylose, or cellulose hydrolysate. The carbon source is added by feedstock to maintain a concentration of 1-5 g / L.
10. The application according to claim 7, characterized in that, include: The ectoin-synthetic strain was streaked onto solid LB medium and cultured at 35-39℃ for 8-16 hours. Select the cultured bacterial strains, inoculate them into liquid LB medium, and incubate at 35-39℃ for 8-16 hours to obtain seed culture; Inoculate the seed culture into the fermentation medium, add ampicillin, streptomycin, kanamycin and IPTG inducer, and ferment at 35-39℃ for 36-100h.