KASP molecular marker linked with loose cauliflower globule gene and application of KASP molecular marker
By developing KASP molecular markers linked to the cauliflower head gene, and using PCR technology and fluorescent adapter sequences to design primers, rapid and accurate identification and screening of head size was achieved, solving the problem of difficulty in improving head size in cauliflower breeding and improving breeding efficiency.
Patent Information
- Application Number
- CN202610246850.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-02
- Publication Date
- 2026-05-19
AI Technical Summary
Existing technologies lack effective genetic markers and gene resources, making it difficult to efficiently and directionally improve the size of cauliflower heads, which affects breeding efficiency and marketability.
A KASP molecular marker linked to the cauliflower head gene was developed. Primers were designed using PCR technology and fluorescent adapter sequences, and touchdown PCR amplification was performed to achieve rapid and accurate identification and screening of cauliflower head size.
It enables efficient screening in the early breeding stage, improves selection accuracy, significantly reduces the scale of field planting and the workload of phenotypic identification, shortens the breeding cycle, and improves breeding efficiency.
Smart Images

Figure CN122060897A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular breeding of cauliflower and relates to a KASP molecular marker linked to the gene for cauliflower head size and its application. Background Technology
[0002] brocoli( Brassica oleracea var. botrytis As an important vegetable crop of the Brassicaceae family, *Brassica oleracea* is increasingly favored by consumers for its rich nutritional value. my country has become the world's largest producer and consumer of cauliflower, and its production plays a vital role in ensuring year-round vegetable supply and promoting export earnings. In recent years, loose-leaf cauliflower (commonly known as "loose cauliflower") has become the mainstream consumption type in China due to its superior quality and wide adaptability, accounting for over 90% of the total cauliflower planting area, and has become an important pillar for increasing agricultural efficiency and farmers' income.
[0003] In the development of the cauliflower industry, head size is a core trait determining yield and marketability. Ideal head size not only affects yield per unit area but is also closely related to adaptability to mechanized harvesting, post-harvest processing efficiency, and market acceptance. Heads that are too small lead to reduced marketability and lower economic benefits; heads that are too large may increase plant load, affect lodging resistance, and reduce planting efficiency per unit area. Therefore, cultivating cauliflower varieties with moderately sized and uniform head sizes has become an important breeding objective.
[0004] However, the mechanism of cauliflower head size formation is complex, regulated by multiple genes and easily influenced by environmental factors, and its genetic basis remains unclear. Currently, research on the localization and cloning of key genes related to cauliflower head size is lacking both domestically and internationally. Molecular breeding lacks effective genetic markers and gene resources, hindering the efficiency of targeted improvement of this trait. Therefore, conducting genetic analysis and key gene discovery for the cauliflower head size trait, and elucidating its molecular regulatory mechanism, is not only of significant scientific value for deepening the theory of cauliflower growth and development, but also provides technical support for marker-assisted selection breeding, accelerating the cultivation of new cauliflower varieties with moderate head size and excellent marketability, and has urgent practical significance for enhancing the competitiveness of my country's cauliflower industry.
[0005] In our previous research, we created a small sphere mutant 'JL-148' from the cauliflower inbred line 'JL-137' through EMS mutagenesis. This invention uses this mutant as the main material to conduct localization of sphere-related genes and development of linkage molecular markers. Summary of the Invention
[0006] The primary objective of this invention is to provide a molecular marker linked to the small head gene in cauliflower, thus offering a new approach for screening small head mutants, addressing the phenomenon of large and small flower heads in cauliflower.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: A KASP molecular marker linked to the cauliflower ball gene is a C-to-T mutation at 48,105,638 bp on chromosome 6 of cauliflower.
[0008] Furthermore, the genotypes corresponding to the molecular markers are: T:T, which is the genotype with the microglobulin phenotype, and C:T and C:C, which are the genotypes without the microglobulin phenotype.
[0009] Furthermore, the primers designed for this mutation site are as follows: Forward primer Primer_AlleleX (SC-1): GAAGGTGACCAAGTTCATGCTAACACGTGATGCTAGCGTTAAATC (SEQ ID NO.1); Forward primer Primer_AlleleY (SC-2): GAAGGTCGGAGTCAACGGATTAACACGTGATGCTAGCGTTAAATT (SEQ ID NO.2); Reverse primer Primer_Common: AAGACAGTAAATGGTCTGTGTCGA (SEQ ID NO.3); The connector sequence is as follows: FAM: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.4); HEX:GAAGGTCGGAGTCAACGGATT (SEQ ID NO.5); The fluorescent adapter sequence is either FAM or HEX (synthesized by LGC). Preferably, the forward primer SC-1 is connected to the FAM fluorescent adapter, and the forward primer SC-2 is connected to the HEX fluorescent adapter.
[0010] The second objective of this invention is to provide applications of the aforementioned molecular markers, which are beneficial for the breeding of cauliflower head sizes and lay the foundation for cloning head size genes and studying the molecular mechanisms of plant growth and development. Specifically: The molecular markers mentioned above are used to identify and assist in the identification of cauliflower bulbs of different sizes.
[0011] Furthermore, the molecular markers are used for screening breeding of cauliflower heads of different sizes, especially for screening small head mutants.
[0012] Furthermore, when the molecular markers are applied, PCR reaction is used for detection.
[0013] This invention also discloses a method for identifying loose cauliflower florets, specifically including the following steps: (1) Extract genomic DNA from the cauliflower to be tested; (2) Using the genomic DNA of the cauliflower to be tested as a template, PCR amplification was performed using the primers corresponding to the molecular markers described in claim 1 to obtain the amplification products; (3) Perform fluorescence detection and analysis on the amplification products. If only the fluorescent signal corresponding to primer SC-2 with fluorescent adapter sequence is detected in the sample PCR product, the detection site is T:T genotype, and it is determined to be a mutant single plant with microsphere phenotype. If only the fluorescent signal corresponding to primer SC-1 with fluorescent adapter sequence is detected in the sample PCR product, the detection site is C:T genotype, and it is determined to be a wild single plant without microsphere phenotype. If both fluorescent signals corresponding to primers SC-1 and SC-2 with fluorescent adapter sequence are detected at the same time, the detection site is C:T genotype, and it is determined to be a wild single plant without microsphere phenotype.
[0014] In this invention, wild plants that do not have a small-ball phenotype are all large-ball plants.
[0015] The molecular markers were applied using Touchdown PCR.
[0016] Furthermore, the Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.
[0017] The beneficial effects of this invention are: This invention utilizes BSA (Bulked Segregant Analysis) population mapping combined with traditional genetic linkage analysis to successfully identify a molecular marker closely linked to the head-size trait in cauliflower. This key mutation site is located at 48,105,638 bp on chromosome 6. We further developed the corresponding KASP molecular marker, which can be used to rapidly and accurately distinguish between the head-size and head-size phenotypes of cauliflower and their corresponding genotypes. This molecular marker allows for efficient screening of target plants in the early breeding stages, significantly reducing the scale of field planting and the workload of later phenotypic identification, thereby improving the accuracy of selection and the breeding process. This invention not only has significant application value for breeding practices related to the head-size trait in cauliflower but also provides valuable genetic resources for theoretical research on plant growth and development. Attached Figure Description
[0018] Figure 1The figures show the phenotypic diagrams of the wild-type large-ball cauliflower material 'JL-137' and the small-ball mutant 'JL-148' in this invention. In the figures, A: wild-type large-ball JL-137; B: small-ball mutant JL-148. Bar =5cm.
[0019] Figure 2 The population mapping results for 'JL-148' and 'JL-137' of this invention are shown in the figure. In the figure, A: BSA mapping results; B: Schematic diagram of marker development and linkage mapping within the candidate region of this invention. Big curd: large sphere; Small curd: small sphere; Chr1-9 represent chromosome numbers, with the small sphere gene located at the end of chromosome 6.
[0020] Figure 3 This figure shows partial results of genotyping using the molecular markers of the present invention in the F2 population constructed from 'JL-148' and 'JL-137'. In the figure, A: the PCR product is the fluorescence signal corresponding to primer SC-2 with a fluorescent adapter sequence, indicating a homozygous microglobulin; B: the PCR product is the fluorescence signal corresponding to primer SC-1 with a fluorescent adapter sequence, indicating a homozygous macroglobulin; C: the PCR product has both fluorescent signals from primers SC-1 and SC-2 with fluorescent adapter sequences, indicating a heterozygous macroglobulin.
[0021] Figure 4 Genotyping diagrams of the SNP marker Cau-SC in the parents and 40 natural populations; in the diagram, A: genotyping of the parent "JL-148"; B: genotyping of the parent "JL-137" and 40 natural population materials. Detailed Implementation
[0022] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the embodiments. Unless otherwise specified, the materials, reagents, instruments, and methods used in the following embodiments are all conventional materials, reagents, instruments, and methods in the art and can be obtained through commercial channels. The cauliflower germplasm involved in the present invention was provided by the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences and can be guaranteed for sale for at least 20 years.
[0023] Example 1: Obtaining molecular markers linked to the cauliflower bulb gene 1. Construction of segregated groups The high-generation inbred line of cauliflower 'JL-137' (large ball, Figure 1 A) was used as the maternal parent, and its mutant 'JL-148' (small ball, Figure 1B) Using 'JL-137' as the male parent, 'JL-148' was crossed to obtain the F1 generation. The F1 generation was then self-crossed to obtain the F2 population. The wild-type 'JL-137' grew normally, with a mature flower head diameter of 18–20 cm. The mutant 'JL-148' had smaller plants throughout its growth period, with a mature flower head diameter of 10–12 cm. All the above materials are from the following literature: Zhang, X.; Wen, Z.; Jiang, H.; Niu, G.; Liu, L.; Yao, X.; Sun, D.; Shan, X. Identification of Loci for Four Important Agronomic Traits in Loose-Curd Cauliflower Based on Genome-Wide Association Studies. Horticulturae 2023, 9, 970. https: / / doi.org / 10.3390 / horticulturae9090970.
[0024] 2. Identifying the size of the flower head During the head maturation period, the head size can be determined. Those consistent with the wild type 'JL-137' are classified as having a large head phenotype, while those consistent with the mutant 'JL-148' are classified as having a small head phenotype.
[0025] 3. Preliminary localization of microsphere genes In this study, 20 plants with large cytoplasm (dominant phenotype) and 20 plants with small cytoplasm (recessive phenotype) were randomly selected from the F2 population constructed from JL-137 × JL-148. Leaves from these plants were then mixed to form a large cytoplasm pool (BC-pool) and a small cytoplasm pool (SC-pool). In the parental lines, JL-137 was dominant and JL-148 was recessive. Total DNA was extracted from the four pools (JL-137, JL-148, BC-pool, and SC-pool) using the CTAB method. Libraries were constructed using the TruSeq DNA Sample Preparation kit (Illumina), and genome resequencing was performed using the Illumina NovaSeq 6000 platform. The obtained sequencing data were aligned using BWA, and SNPs were detected using Samtools. The filtering conditions were: base quality value ≥30, alignment quality value ≥30, and sequencing depth of SNP sites in each pool ≥2 and ≤60. After the above screening, a total of 9540 differential SNPs were obtained. Further, using a sliding window of 20 SNPs and a step size of 10 SNPs, the SNP-index distribution was calculated and plotted. Figure 2A). The results showed that the genome-wide average Δ(SNP-index) was close to 0, while in the region of 44,260,542-48,422,990 bp on chromosome 6, the Δ(SNP-index) was significantly higher than 0.5. Based on this, this region was identified as a candidate region.
[0026] 4. Fine mapping of microsphere genes To further refine the localization of the gene controlling the ball-shaped trait, this study expanded the F2 population and developed the KASP molecular marker based on the alignment results of parental resequencing data with the cauliflower reference genome C-8 (NGDC, https: / / ngdc.cncb.ac.cn / gwhgwh / , GWHBJSH00000000). By genotyping the expanded population and identifying key exchanger plants and their phenotypes, the gene was ultimately located within the interval 48,022,952-48,422,990 bp on chromosome 6. Figure 2 B). Further analysis of the variant annotations within the interval revealed that a site at 48,105,638 bp fully conformed to the G / C→A / T preference of EMS mutagenesis (manifested as C→T conversion). This mutation was a non-synonymous mutation and showed 100% linkage with the microglobulin phenotype in the F2 population. This marker was named the Cau-SC marker.
[0027] 5. Development of molecular markers linked to microsphere genes Genotyping was performed on 550 individuals from the F2 population constructed using the Cau-SC marker (JL-137 × JL-148). The results showed the following genotype distribution: 177 individuals were T:T homozygous, 188 were C:T heterozygous, and 185 were C:C homozygous. Phenotypic data validation confirmed that the genotype and phenotype of each individual were completely consistent, achieving a 100% concordance rate. Figure 3 The above results indicate that the Cau-SC marker developed in this study has good universality and accuracy, and can be effectively applied to genotype prediction, phenotypic identification, and molecular marker-assisted screening of cauliflower ball traits.
[0028] 6. Application of molecular markers in identifying loosely packed cauliflower bulbs The application of molecular markers specifically includes the following steps: (1) Extract genomic DNA from the cauliflower to be tested; (2) Using the genomic DNA of the cauliflower to be tested as a template, Touchdown PCR amplification was performed using molecular marker amplification primers to obtain the amplification product; (3) Detect and analyze the amplification products; Forward primer Primer_AlleleX (SC-1): GAAGGTGACCAAGTTCATGCTAACACGTGATGCTAGCGTTAAATC; Forward primer Primer_AlleleY (SC-2): GAAGGTCGGAGTCAACGGATTAACACGTGATGCTAGCGTTAAATT; Reverse primer Primer_Common: AAGACAGTAAATGGTCTGTGTCGA.
[0029] The two forward primers are connected to different fluorescent adapter sequences; the 5' end of the forward primer SC-1 is connected to the FAM fluorescent adapter sequence, and the 5' end of the forward primer SC-2 is connected to the HEX fluorescent adapter sequence.
[0030] When performing fluorescence detection on the amplification products, if only the fluorescent signal corresponding to primer SC-2 with the fluorescent adapter sequence is detected in the sample PCR product, the detection site is the T:T genotype, and it is determined to be a mutant single plant with the microglobulin phenotype; if only the fluorescent signal corresponding to primer SC-1 with the fluorescent adapter sequence is detected in the sample PCR product, the detection site is the C:T genotype, and it is determined to be a wild single plant without the microglobulin phenotype; if both fluorescent signals corresponding to primers SC-1 and SC-2 with the fluorescent adapter sequence are detected simultaneously, the detection site is the C:T genotype, and it is determined to be a wild single plant without the microglobulin phenotype.
[0031] The Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles. The sample to be tested was a leaf.
[0032] The Cau-SC marker's phenotypes and genotypes in the F2 population (partial results) are shown in Table 1.
[0033] Table 1. Cau-SC marker phenotypes and genotypes of large and small spheres in the F2 population (partial results)
[0034] Furthermore, the inventors used Cau-SC molecular markers to genotype the two parents and a natural population (40 randomly selected cauliflower materials). Combined with phenotypic data, the results showed that the phenotypes of the parents and the 40 randomly selected cauliflower materials were consistent with the actual measurements; only the mutant material JL-148 exhibited a small-ball phenotype, while the rest showed a large-ball phenotype (Table 2). Figure 4The results show that the Cau-SC marker of the present invention can effectively distinguish the small-ball mutant, and the auxiliary selection rate for the small-ball trait in natural cauliflower populations is 100%. Based on this result, it is shown that the molecular marker Cau-SC of the present invention can effectively distinguish whether a cauliflower plant is a small-ball material.
[0035] Table 2. Material numbers, genotypes, and phenotypes of the 40 natural populations of *Cauliflower* used for validation.
[0036] The above results demonstrate that when using the molecular markers of this invention for assisted selection, target genotype materials can be efficiently screened based on fluorescence signal type: materials detecting only the fluorescence signal corresponding to primer SC-2 are homozygous for the small-ball trait and can be retained for breeding stable small-ball lines; materials detecting only the fluorescence signal corresponding to primer SC-1 are homozygous for the large-ball trait and can be used for breeding stable large-ball lines; materials detecting both SC-1 and SC-2 fluorescence signals are heterozygous for the large-ball trait and can be used for hybridization breeding and subsequent segregation selection. This method enables accurate genotype identification in the early stages of breeding, significantly reducing the workload of later field phenotypic screening and effectively shortening the breeding cycle.
Claims
1. A KASP molecular marker linked to the loose cauliflower ball gene, characterized in that, The KASP molecular marker is a C-to-T mutation at 48,105,638 bp on chromosome 6 of cauliflower. The genotypes corresponding to the KASP molecular marker are: T:T, which is the genotype with a microglobulin phenotype; and C:C and C:T, which are the genotypes without a microglobulin phenotype. The primers corresponding to the KASP molecular marker are as follows: Forward primer SC-1: GAAGGTGACCAAGTTCATGCTAACACGTGATGCTAGCGTTAAATC; Forward primer SC-2: GAAGGTCGGAGTCAACGGATTAACACGTGATGCTAGCGTTAAATT; Reverse primer Primer_Common: AAGACAGTAAATGGTCTGTGTCGA.
2. The KASP molecular marker according to claim 1, characterized in that, Two forward primers are attached to different fluorescent adapter sequences. The 5' end of forward primer SC-1 is attached to the FAM fluorescent adapter sequence, and the 5' end of forward primer SC-2 is attached to the HEX fluorescent adapter sequence. The adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT; HEX: GAAGGTCGGAGTCAACGGATT.
3. The application of the KASP molecular marker as described in claim 1 or 2 in the identification or auxiliary identification of loose cauliflower bulbs.
4. A method for identifying loose cauliflower heads, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the cauliflower to be tested; (2) Using the genomic DNA of the cauliflower to be tested as a template, PCR amplification was performed using the primers corresponding to the KASP molecular marker described in claim 1 to obtain the amplification product; (3) Fluorescence detection and analysis of the amplification products: If the PCR product of the sample only detects the fluorescent signal corresponding to primer SC-2 with the fluorescent adapter sequence, the detection site is the T:T genotype, and it is determined to be a mutant single plant with the microsphere phenotype. If the PCR product of the sample only detects the fluorescent signal corresponding to primer SC-1 with the fluorescent adapter sequence, the detection site is the C:T genotype, and it is determined to be a wild single plant without the microsphere phenotype. If both fluorescent signals corresponding to primers SC-1 and SC-2 with the fluorescent adapter sequences are detected simultaneously, the detection site is the C:T genotype, and it is determined to be a wild single plant without the microsphere phenotype.
5. The method according to claim 4, characterized in that, Touchdown PCR was used; the Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.