Three SNP (Single Nucleotide Polymorphism) molecular markers related to oil content of common camellia oleifera seed kernel and application of three SNP molecular markers

Abstract

The invention relates to the technical field of molecular markers, in particular to three SNP (Single Nucleotide Polymorphism) molecular markers related to the oil content of common camellia oleifera kernels and application of the three SNP molecular markers. The invention provides three SNP (Single Nucleotide Polymorphism) molecular markers Chr03186508315, Chr05105254880 or Chr38117180360 which are highly associated with the oil content of the kernel of the common camellia oleifera, the three SNP molecular markers are respectively positioned at the 186508315 site of the chromosome 3 of the common camellia oleifera, the 105254880 site of the chromosome 5 of the common camellia oleifera and the 117180360 site of the chromosome 38 of the common camellia oleifera, the polymorphic genotypes are respectively T / A, T / G and G / A, and the phenotypic variances of the oil content of 2.82%, 2.44% and 2.74% can be respectively explained. By detecting the SNP molecular marker, identification and auxiliary screening can be carried out in the seedling stage, the production cost is greatly saved, and the selection efficiency is improved.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to three SNP molecular markers related to the oil content of common camellia seed kernels and their applications. Background Technology

[0002] Common tea oil ( Camellia oleifera Camellia oleifera (Abel.) belongs to the genus Camellia in the family Theaceae and is one of the world's four major woody oilseed tree species. Camellia seed oil produced from common camellia is a high-quality edible oil rich in nutrients. Its unsaturated fatty acid content is as high as 90%, mainly oleic acid and linoleic acid, and it is also rich in active ingredients such as vitamin E, squalene, and phytosterols, which have significant nutritional and health benefits.

[0003] In recent years, significant progress has been made in the genetic breeding research of Camellia oleifera. Sequencing and fine mapping of multiple Camellia oleifera genomes have been completed, leading to a deeper understanding of the molecular mechanisms of seed oil synthesis and accumulation. Based on this foundation, discovering and screening molecular markers for early selection of high-oil-content germplasm resources, and establishing corresponding detection systems, has become an effective way to accelerate the breeding process of high-oil-content varieties.

[0004] Compared to traditional breeding methods, marker-assisted selection can significantly shorten the breeding cycle, which is especially important for economic forest breeding aimed at improving fruit yield and quality. Efficient and accurate molecular markers are a key prerequisite for conducting marker-assisted breeding.

[0005] Therefore, developing molecular markers closely related to the oil content of common Camellia oleifera kernels is of great theoretical and practical significance for molecular marker-assisted breeding and genetic improvement of Camellia oleifera oil yield. Summary of the Invention

[0006] To address the aforementioned technical problems, the present invention proposes the following technical solution.

[0007] Firstly, this invention provides SNP molecular markers related to the oil content of common camellia seed kernels, wherein the SNP molecular markers are selected from any one of SNP1, SNP2, and SNP3 molecular markers; Specifically, the SNP1 molecular marker is located at position 186508315 on chromosome 3 of the Camellia oleifera genome, with a base polymorphism of T / A; the SNP2 molecular marker is located at position 105254880 on chromosome 5 of the Camellia oleifera genome, with a base polymorphism of T / G; and the SNP3 molecular marker is located at position 117180360 on chromosome 38 of the Camellia oleifera genome, with a base polymorphism of G / A. The version number of the common Camellia oleifera genome is Changlin 40 V1.0.

[0008] Preferably, the SNP1 molecular marker is located at position 175 of the nucleotide sequence shown in SEQ ID NO.7; The SNP2 molecular marker is located at position 180 of the nucleotide sequence shown in SEQ ID NO.8; The SNP3 molecular marker is located at position 180 of the nucleotide sequence shown in SEQ ID NO.9.

[0009] SEQ ID NO.7: CTGTATACCCTGCCTTCATCCTCAACCATCACTAGTCTCAATGACTCGGCCACTGAGTCTCTGGTGAACGAGCCGTCCTGCTTGTCTCTCGGTATCAAGTATGCCATCTTCTTCTCTTCCAAAAGCCTAGCGATCAACCC TGTGTCTGCCAAGAAAGACAGCAAAATGAGGGATTTCTCGAATTGTATGGCCTCAATTACCGAACTCCACCCAGAGTGAGACAAGAATCCACCCACTGAGTCATGACTCAGTATCTTGAGTTGAGGAGCCCAACTTGTGCA SEQ ID NO.8: AGTTACCTGATTAGTATTCAATTTTCTGTTATTTTGGCATTGATTATAATTGTGTACATTTTTTCTTTTGGGTCTTTCACACCAGAGGACAGAATGGATCAGCAAGGACAACTGCATTATGATACAAGCCAATATGAACCA AACCAAGTTATGGGAAATCCTAGTCAAGGATCAGTAGTTACATCAGGTGGGCCTGCTCGTTCTCCTAGTCAGCCATCAGGATCTCATCTCGCGCATCACCAGCTTGCCTATCAACATATCCACCAAGCAGCAGCAACACCAA SEQ ID NO.9: ACCTAATCACGTGCCTTTTGGACTTAGCATTCCTCAAAAGAATGAAACTCAGTCAAGTAACCGTGAAAAATATTCACAATTCCCAGACACACAGCGTGATGGGAGAAGGATGGGGAATCTTGATCTGAACTTTATGAATCTGAATGCTAA CAGTCTTGAAATTCAGAATGGGAATTTTGGTTCAGAATCTTTCAGAAGGACATCTACCGAATATCCATTTGCTTGCAAGCGGGGGGGATTTGATCTCAACACAAAGGTATCAGGATCACTCGATCTACATTCTAATGAAACCATACCTGC In the specific implementation process, among the SNP1 molecular markers, the genotype of the polymorphic site is A / A, corresponding to high oil content; the genotype of the polymorphic site is T / T, corresponding to candidate high oil content; and the genotype of the polymorphic site is A / T, corresponding to low oil content. In the SNP2 molecular marker, the genotype of the polymorphic site is T / T, which corresponds to high oil content; the genotype of the polymorphic site is T / G or G / G, which corresponds to low oil content. In the SNP3 molecular marker, the genotype of the polymorphic site is A / A or A / G, which corresponds to high oil content; the genotype is G / G, which corresponds to low oil content.

[0010] The development process of the above-mentioned SNP molecular markers of the present invention is basically as follows: (1) Collect camellia germplasm resources extensively in the entire distribution area of ​​common camellia and establish a natural population of common camellia with widely separated kernel oil content.

[0011] (2) Fully mature seeds of 221 common camellia oleifera germplasms from natural populations were collected, and the oil content of the kernels was determined by Soxhlet extraction.

[0012] (3) Kernels from 221 common camellia oleifera plants in a natural population during the high-speed oil synthesis period were collected. Total RNA was extracted using the RNAprepPure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (centrifuge column type, TIANGEN kit code no. DP441). A cDNA library was constructed for each sample and analyzed using Illumina HiSeq. TM Second-generation transcriptome sequencing was performed on the 4000 platform.

[0013] (4) Using the genome of common Camellia oleifera 'Changlin 40' (Zhu, H., Wang, F., Xu, Z., Wang, G., Hu, L., Cheng, J., Ge, X., Liu, J., Chen, W., Li, Q., Xue, F., Liu, F., Li, W., Wu, L., Cheng, X., Tang, X., Yang, C., Lindsey, K., Zhang, X., Ding, F., Hu, H., Hu, X. and Jin, S. (2024) The complex hexaploid oil-Camellia genometraces back its phylogenomic history and multi-omics analysis of Camellia oilbiosynthesis. Plant Biotechnol. J., https: / / doi.org / 10.1111 / pbi.14412.) as the reference sequence, the SNP sites of the transcriptome sequences of 221 samples obtained in (3) were analyzed by multiple sequence alignment.

[0014] (5) SNP data were strictly filtered according to the following principles: each locus had only 2 alleles; genotype deletion rate ≤20%; minimum allele frequency ≥5%; SNP quality value ≥100; number of homozygous genotype samples exceeded 10; heterozygous genotype rate ≤70%. The software bcftools v1.9 (http: / / www.htslib.org / doc / bcftools.html) used in the process is publicly available and free.

[0015] (6) Input the genotype data of the population into GCTA v1.25.2 (Jian Y, S Hong L, Goddard ME, Visscher PM, 2011. GCTA: a tool for genome-wide complex trait analysis. American Journal of Human Genetics 88, 76-82.) software to perform principal component analysis (PCA).

[0016] (7) The genotype data, the top 10 principal component (PC) data, the phenotypic data of seed oil content, and the Kinship matrix data of the population were input into the IIIVmrMLM software. The linkage disequilibrium of SNP molecular markers and common Camellia oleifera seed oil content traits was analyzed using the unified mixed linear model (MLM) method. The results showed that the above traits were highly significantly associated with the common Camellia oleifera seed oil content. P <10 -5 The three SNP molecular markers of ) are shown in Table 1.

[0017] Table 1 SNP molecular marker information

[0018] Each SNP molecular marker of the present invention can be used individually or in combination for phenotypic identification of oil content in common camellia seed kernels. When used in combination, the identification accuracy is higher.

[0019] Secondly, the present invention provides a combination of SNP molecular markers related to the oil content of common camellia seed kernels, wherein the combination of SNP molecular markers includes at least two of the SNP1 molecular marker, the SNP2 molecular marker, and the SNP3 molecular marker.

[0020] As a preferred technical solution, the SNP molecular marker combination includes the SNP1 molecular marker, the SNP2 molecular marker, and the SNP3 molecular marker.

[0021] Third, the present invention provides primers for amplifying the SNP molecular markers or combinations of the SNP molecular markers.

[0022] As a preferred technical solution, the primers include the primers shown in SEQ ID NO.1-2 and / or SEQ ID NO.3-4 and / or SEQ ID NO.5-6.

[0023] SEQ ID NO.1: CTGTATACCCTGCCTTCATCCT SEQ ID NO.2: TGCACAAGTTGGGCTCCTCAAC SEQ ID NO.3: TGGCATTGATTATAATTGTGTAC SEQ ID NO.4: TTGGTGTTGCTGCTGCTTGGTGG SEQ ID NO.5: CACGTGCCTTTTGGACTTAGCAT SEQ ID NO.6: GCAGGTATGGTTTCATTAGAA Fourth, the present invention provides a kit containing the primers.

[0024] As a preferred technical solution, the kit is used to identify the oil content of common camellia seeds.

[0025] As a preferred technical solution, the kit is a PCR kit.

[0026] Fifth, this invention provides a method for identifying the oil content of common camellia seed kernels, including: Using the genomic DNA of the common camellia oleifera seed as a template, PCR amplification was performed using primers that amplify the SNP molecular markers or primers that amplify the combinations of SNP molecular markers. The phenotype of oil content in the kernel of common camellia oleifera seed was identified based on the genotype of the SNP molecular marker loci.

[0027] As a preferred technical solution, the identification method includes: (1) Extract genomic DNA from the common camellia oleifera to be identified; (2) Using the genomic DNA as a template, perform PCR amplification using the primers; (3) Analyze the genotype of the SNP molecular markers in the PCR amplification products, and determine the phenotype of the oil content of the kernel of the common camellia to be identified based on the genotype.

[0028] As a preferred technical solution, the reaction program for the PCR amplification reaction is as follows: 94~95℃, 3~5min; 94~95℃, 15~30s, 65~69℃, 40~60s, 38~45 cycles; 67~70℃, 3~6min.

[0029] As a more preferred technical solution, the reaction procedure for the PCR amplification reaction is as follows: 95℃, 3min, 1 cycle of pre-denaturation; 95℃, 15s denaturation, 68℃, 45s extension, 40 cycles; 68℃, 5min, 1 cycle of complete extension.

[0030] In practical implementation, when using SNP1, SNP2, or SNP3 molecular markers for identification alone: In the SNP1 molecular marker, if the genotype of the polymorphic site is A / A, then the tested Camellia oleifera has a high oil content; if the genotype of the polymorphic site is T / T, then the tested Camellia oleifera is a candidate for high oil content; if the genotype of the polymorphic site is A / T, then the tested Camellia oleifera has a low oil content. In the SNP2 molecular marker, if the genotype of the polymorphic site is T / T, then the tested Camellia oleifera has a high oil content; if the genotype of the polymorphic site is T / G or G / G, then the tested Camellia oleifera has a low oil content. In the SNP3 molecular marker, if the genotype of the polymorphic site is A / A or A / G, the tested common camellia has a high oil content; if the genotype is G / G, the tested common camellia has a low oil content.

[0031] In the specific implementation process, when two or more molecular markers among SNP1, SNP2, and SNP3 are used for identification: if at least two SNP molecular marker loci are high oil content genotypes and / or candidate high oil content genotypes, then the tested common camellia oleifera is high oil content; if all three SNP molecular marker loci are low oil content genotypes, then the tested common camellia oleifera is low oil content.

[0032] In some implementations, the Camellia oleifera to be identified can be any Camellia oleifera breeding material, including individuals from natural populations or sexual populations.

[0033] In some implementations, genomic DNA of common Camellia oleifera is extracted using the TaKaRa MiniBEST Plant Genomic DNA Extraction Kit (TaKaRa, Dalian, China).

[0034] In some implementations, after the PCR amplification, the obtained PCR product is detected and recovered by agarose gel electrophoresis.

[0035] In some embodiments, the concentration of agarose gel in the agarose gel electrophoresis is 1.2%. Gel recovery is performed using the AxyPrep DNA Gel Recovery Kit (AxyGEN, Code No. AP-GX-50).

[0036] In some implementations, the genotype of the SNP molecular marker can be analyzed using conventional techniques in the art, such as gene sequencing, for example, sequencing using SEQ ID NO.1-2, SEQ ID NO.3-4, and SEQ ID NO.5-6 as sequencing primers.

[0037] Sixth, the present invention provides the application of the SNP molecular marker, or the SNP molecular marker combination, or the primer, or the kit, or the identification method in at least one of the following aspects: (1) Identification of the oil content phenotype of common camellia seeds; (2) Identification, improvement or molecular marker-assisted breeding of common camellia oleifera germplasm resources; (3) Early prediction of oil content in common camellia seeds; (4) Screening common camellia with high oil content.

[0038] As a preferred technical solution, the target trait for the identification, improvement, or molecular marker-assisted breeding of common camellia oleifera germplasm resources is the oil content of common camellia oleifera kernels.

[0039] Compared with the prior art, the beneficial effects of the present invention are as follows: In the traditional breeding process of common Camellia oleifera, the evaluation of the trait of kernel oil content usually requires 5-6 years after seedling planting, a time-consuming and labor-intensive process. In contrast, the three SNP molecular markers involved in this invention have clear physical locations and can explain 2.82%, 2.44%, and 2.74% of the phenotypic variance of oil content, respectively. The detection method of this invention is simple and rapid, enabling early identification and assisted screening at the seedling stage. It can significantly reduce breeding costs, improve selection efficiency, and is unaffected by environmental conditions. With clear objectives and minimal operational workload, it helps to significantly accelerate the breeding process of common Camellia oleifera varieties with high oil content. It has important value for promoting molecular marker-assisted breeding and genetic improvement of Camellia oleifera oil yield and has broad application prospects. Detailed Implementation

[0040] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0041] Unless otherwise specified, all techniques and conditions described in this invention shall be performed in accordance with conventional methods in the field, techniques and conditions described in relevant published literature, or corresponding product instructions. Unless otherwise specified, all reagents and instruments used are conventional products that can be purchased through legitimate commercial channels.

[0042] This invention relates to experiments related to molecular biology. Unless otherwise specified, experimental methods can be found in *Molecular Cloning: A Laboratory Manual* (J. Sambrook, E.F. Fritsch, T. Maniatis, Science Press, 1994) and subsequent editions, a commonly used guide for those skilled in the art to conduct molecular biology experiments. Furthermore, depending on the specific needs of different experiments, those skilled in the art can also complete the experiments according to the instructions accompanying commercially available kits, or entrust qualified professional institutions to provide services such as primer synthesis and gene sequencing.

[0043] The 221 natural population materials used in this invention, all of which are common Camellia oleifera clones, were collected and evaluated by the Woody Oilseed Breeding and Cultivation Research Group of the Subtropical Forestry Research Institute, Chinese Academy of Forestry, and are preserved in the germplasm resource nursery of Dongfanghong Forest Farm, Wucheng District, Jinhua, Zhejiang Province. The oil content mentioned in this invention is the oil content of the kernel.

[0044] Example 1: Construction and trait determination of an isolated population of oil content from common Camellia oleifera seed kernels. In this embodiment, 221 natural populations of common Camellia oleifera germplasm resources were collected from a nursery. Their origins covered most of my country's main Camellia oleifera producing areas, including Zhejiang, Hunan, Jiangxi, Guangxi Zhuang Autonomous Region, Fujian, and Guangdong provinces. After the fruits of all 221 individuals were fully mature (5% of the fruits split open), seeds were collected, and the oil content of the kernels was determined using Soxhlet extraction. The operational steps are as follows: (1) Prepare medium-speed filter paper packs and place them in an aluminum box. Dry them at 105°C until constant weight is achieved. Record the weight of the aluminum box and the filter paper packs. W 1 ).

[0045] (2) Remove the hard seed coat from an appropriate amount of common camellia seeds, dry them at 105℃ to constant weight, crush them with a pulverizer, pack them into a filter paper bag and wrap them up, and record the total weight of the aluminum box, filter paper bag and sample. W 2 ).

[0046] (3) Using a Swiss Buchi Soxhlet extractor B-811LSV, the weighed sample filter paper package was placed in an extraction flask, and about 100 ml of petroleum ether was added. Extraction was carried out for 6 hours, and the petroleum ether was recovered. The filter paper package (containing residue) was placed in an aluminum box and dried at 105°C until constant weight was achieved. The weights of the aluminum box, filter paper package, and residue were recorded. W 3 ).

[0047] Kernel oil content = [( W 2 - W 3 ) / ( W 2 - W 1 )]×100% The results of the oil content determination of common camellia seeds showed that the oil content of natural population seeds exhibited a normal distribution, indicating that this trait has quantitative characteristics.

[0048] Example 2: Transcriptome sequencing and polymorphic site identification of seed kernels during the rapid lipid synthesis period 1. Total RNA extraction from the kernels of 221 common Camellia oleifera clones during the high-speed oil synthesis period: Total RNA was extracted from immature kernels of various common Camellia oleifera clones using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (centrifugal column type, TIANGEN Kit Code No. DP441).

[0049] 2. Transcriptome sequencing: Total RNA from each sample was tested for purity and concentration, and ribosomal RNA was removed to maximize the retention of all coding RNA and ncRNA. The resulting RNA was randomly fragmented into short segments, and cDNA first-strand was synthesized using the fragmented RNA as a template with six-base random hexamers. Then, buffer, dNTPs (dUTP instead of dTTP), RNase H, and DNA polymerase I were added to synthesize cDNA second-strand. The cDNA was purified using a QiaQuick PCR kit and eluted with EB buffer. End repair, addition of base A, and the addition of sequencing adapters were performed, followed by degradation of the second strand by UNG (Uracil-N-Glycosylase). Fragment size selection was performed using agarose gel electrophoresis, followed by PCR amplification. Finally, the constructed sequencing library was analyzed using Illumina HiSeq. TM Second-generation transcriptome sequencing was performed on the 4000 platform.

[0050] 3. Polymorphic site identification: To ensure data quality, the clean reads obtained after initial filtering are further filtered more rigorously to obtain high-quality clean reads for subsequent information analysis. The filtering steps are as follows: (1) Remove reads containing connectors; (2) Remove reads that are all A bases; (3) Remove reads containing more than 10% N; (4) Remove low-quality reads (the number of bases with a quality value of Q≤20 accounts for more than 50% of the total reads).

[0051] Using Tophat v2.1.1 ADDIN EN.CITE <endnote> <cite> <author> Trapnell < / author> <year> 2012< / year> <recnum> 274< / recnum> <displaytext> (Trapnell et al.,2012) < / displaytext> <record> <rec-number> 274< / rec-number> <foreign-keys> <key app="EN" db-id="x0ra2x99mztapaexad8xvx9f229dzer0pd9f" timestamp="1563852418"> 274< / key> < / foreign-keys> <ref-type name="Journal Article"> 17< / ref-type> <contributors> <authors> <author> Trapnell, Cole < / author> <author> Roberts, Adam < / author> <author> Goff, Loyal < / author> <author> Pertea, Geo < / author> <author> Kim,Daehwan < / author> <author> Kelley, David R. < / author> <author> Pimentel, Harold < / author> <author> Salzberg, Steven L. < / author> <author> Rinn, John L. < / author> <author> Pachter, Lior < / author> < / authors> < / contributors> <titles> <title> Differential gene and transcript expression analysis of RNA-seq experimentswith TopHat and Cufflinks < / title> <secondary-title> Nature protocols < / secondary-title> <alt-title> Nat Protoc < / alt-title> < / titles> <periodical> <full-title> Nature protocols < / full-title> <abbr-1> Nat Protoc < / abbr-1> < / periodical> <alt-periodical> <full-title> Nature protocols < / full-title> <abbr-1> Nat Protoc < / abbr-1> < / alt-periodical> <pages> 562-578< / pages> <volume> 7< / volume> <number> 3< / number> <keywords> <keyword>DNA, Complementary / genetics< / keyword> <keyword>GeneExpression Profiling / methods< / keyword> <keyword>Genetic Association Studies / methods< / keyword> <keyword>Genomics / methods< / keyword> <keyword>SequenceAnalysis, DNA / methods< / keyword> <keyword> Software< / keyword> < / keywords> <dates> <year> 2012< / year> < / dates> <isbn> 1750-2799 1754-2189< / isbn> <accession-num> 22383036< / accession-num> <urls> <related-urls> <url> https: / / www.ncbi.nlm.nih.gov / pubmed / 22383036 < / url> <url> https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3334321 / < / url> < / related-urls> < / urls> <electronic-resource-num> 10.1038 / nprot.2012.016 < / electronic-resource-num> <remote-database-name> PubMed < / remote-database-name> <language> eng< / language> < / record> < / cite> < / endnote>(Trapnell C, Roberts A, Goff L, et al., 2012. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature protocols 7, 562-78.) The software aligns the high-quality reads of each sample to the hexaploid reference genome sequence (Zhu, H., Wang, F., Xu, Z., Wang, G., Hu, L., Cheng, J., Ge, X., Liu, J., Chen, W., Li, Q., Xue, F., Liu, F., Li, W., Wu, L., Cheng, X., Tang, X., Yang, C., Lindsey, K., Zhang, X., Ding, F., Hu, H., Hu, X. and Jin, S. (2024) The complex hexaploid oil-Camellia genome traces back its phylogenomichistory and multi-omics analysis of Camellia oil biosynthesis. PlantBiotechnol. J., https: / / doi.org / 10.1111 / pbi.14412. Sequences that did not align were removed, and the remaining sequences were used to identify SNP sites using bcftools v1.9 software (http: / / www.htslib.org / doc / bcftools.html). The identified SNP sites underwent rigorous filtering to obtain high-quality SNP data. The filtering criteria are as follows: (1) There are only 2 alleles at each locus; (2) Genotype deletion rate ≤ 20%; (3) Minimum allele frequency (MAF) ≥ 5%; (4) SNP quality value ≥ 100; (5) The number of homozygous genotype samples is greater than 10; (6) The heterozygous genotype sample rate is ≤70%.

[0052] Example 3: Screening of SNP molecular markers related to oil content in common camellia seed kernels 1. Group structure analysis: Principal component analysis (PCA) was performed on the natural population of Camellia oleifera using GCTA v1.25.2 (Jian Y, S Hong L, Goddard ME, Visscher PM, 2011.GCTA: a tool for genome-wide complex trait analysis. American Journal of Human Genetics 88, 76-82.). The first 10 principal components (PCs) were used as fixed effects for subsequent association analysis (Table 2).

[0053] Table 2. Top 10 PC values ​​of selected individuals in a natural population.

[0054] 2. Association Analysis: All SNP locus data, the top 10 PC values, phenotypic data (see Example 1), and Kinship matrix data were imported into IIIVmrMLM software. MLM analysis was used to analyze the linkage disequilibrium between SNPs and kernel oil content. SNP molecular markers significantly associated with kernel oil content were screened. After multiple validation corrections, three loci with extremely significant associations to kernel oil content were detected. P <10 -5 (Table 1) These three loci are located in the exon regions and intergenic regions of chromosomes 3, 5 and 38, respectively, and their contribution rates to the difference in oil content are 2.82%, 2.44% and 2.74% (Table 1).

[0055] Example 4: Application of the SNP molecular markers of the present invention in high-oil breeding of common camellia oleifera (1) Select a common Camellia oleifera hybrid F1 generation family as material (the maternal parent is 'Changlin 53' and the paternal parent is 'Changlin 40', both of which are nationally approved improved varieties with improved variety numbers 'Guo S-SC-CO-012-2008' and 'Guo S-SC-CO-011-2008' respectively), and collect young leaves to extract total genomic DNA according to the method in Example 2.

[0056] (2) Genomic DNA was amplified by PCR using the primers shown in SEQ ID NO.1-2, SEQ ID NO.3-4 and SEQ ID NO.5-6 respectively. The reaction system is shown in Table 3.

[0057] Table 3 Reaction System

[0058] The PCR amplification program was as follows: 95℃, 3 min, 1 cycle for pre-denaturation; 95℃, 15 s for denaturation, 68℃, 45 s for extension, 40 cycles; 68℃, 5 min, 1 cycle for complete extension.

[0059] (3) PCR amplification products were subjected to gel detection, purification, recovery, sequencing, and genotyping. Gel detection and purification were performed according to the instructions of the AxyPrep DNA Gel Recovery Kit (AxyGEN, Code No. AP-GX-50). DNA was recovered from the gel, and the corresponding amplification primers were used as sequencing primers. The nucleotide sequence of the amplification products was determined by Sanger sequencing, and the genotype of each SNP site on the sequencing peak map was interpreted using Chromas software.

[0060] (4) Identify the genotypes of all individuals at three loci. Compare the relationship between the genotypes at each locus and the oil content.

[0061] When using SNP1 molecular marker (Chr03_186508315), SNP2 molecular marker (Chr05_105254880), or SNP3 molecular marker (Chr38_117180360) for identification alone: In the SNP1 molecular marker, if the genotype of the polymorphic site is A / A, then the tested Camellia oleifera has a high oil content; if the genotype of the polymorphic site is T / T, then the tested Camellia oleifera is a candidate for high oil content; if the genotype of the polymorphic site is A / T, then the tested Camellia oleifera has a low oil content. In the SNP2 molecular marker, if the genotype of the polymorphic site is T / T, then the tested Camellia oleifera has a high oil content; if the genotype of the polymorphic site is T / G or G / G, then the tested Camellia oleifera has a low oil content. In the SNP3 molecular marker, if the genotype of the polymorphic site is A / A or A / G, the tested Camellia oleifera has a high oil content; if the genotype is G / G, the tested Camellia oleifera has a low oil content. When two or more of the SNP1, SNP2, and SNP3 molecular markers are used for identification: if at least two SNP molecular marker loci are high-oil-content genotypes and / or candidate high-oil-content genotypes, then the tested common camellia oleifera has a high oil content; if all three SNP molecular marker loci are low-oil-content genotypes, then the tested common camellia oleifera has a low oil content.

[0062] (5) Collect fully mature seeds from all F1 generation individuals and determine their kernel oil content (method as in Example 1). The results are shown in Table 4: A. Among individual plants with the high oil content genotype at Chr03_186508315, 79.49% of the individuals had a kernel oil content higher than the average kernel oil content of the population. Among individual plants with the candidate high oil content genotype at Chr03_186508315, 58.57% of the individuals had a kernel oil content higher than the average kernel oil content of the population. Among individual plants with the low oil content genotype at Chr03_186508315, only 44.64% of the individuals had a kernel oil content higher than the average kernel oil content of the population.

[0063] B. Among the individual plants with the low oil content genotype at the Chr05_105254880 locus, only 13.64% of the individual kernels had an oil content higher than the average oil content of the population kernels.

[0064] In individual plants with the high oil content genotype at locus C, Chr38_117180360, 68.18% of the individual kernels had an oil content higher than the average oil content of the population kernels.

[0065] Two individuals at loci D, Chr03_186508315, Chr05_105254880, and Chr38_117180360 all had high oil content genotypes or were candidate high oil content genotypes, with oil contents of 46.54% and 53.99%, respectively, which were 19.39% and 38.51% higher than the population average oil content (38.98%). Among the individuals at all three loci with low oil content genotypes, 90.91% of the individuals had kernel oil contents lower than the population average kernel oil content.

[0066] Among individual plants with high oil content genotypes at loci E, Chr03_186508315, and Chr05_105254880, 82.86% of the individual kernels had an oil content higher than the average oil content of the population kernels.

[0067] This demonstrates that the three SNP molecular markers of the present invention are effective in assisting selection. They can be used alone or in combination of two or three to identify the oil content of common Camellia oleifera in the early stage or as an auxiliary identification, which can greatly save production and breeding costs, improve selection efficiency, and accelerate the breeding process of high-oil Camellia oleifera.

[0068] Table 4. Kernel oil content and genotype data of F1 individual plants

[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP molecular marker associated with the oil content of common camellia seed kernels, characterized in that, The SNP molecular marker is selected from any one of the SNP1 molecular marker, SNP2 molecular marker, and SNP3 molecular marker; Specifically, the SNP1 molecular marker is located at position 186508315 on chromosome 3 of the Camellia oleifera genome, with a base polymorphism of T / A; the SNP2 molecular marker is located at position 105254880 on chromosome 5 of the Camellia oleifera genome, with a base polymorphism of T / G; and the SNP3 molecular marker is located at position 117180360 on chromosome 38 of the Camellia oleifera genome, with a base polymorphism of G / A. The version number of the common Camellia oleifera genome is Changlin 40 V1.

0.

2. The SNP molecular marker according to claim 1, characterized in that, The SNP1 molecular marker is located at position 175 of the nucleotide sequence shown in SEQ ID NO. 7; The SNP2 molecular marker is located at position 180 of the nucleotide sequence shown in SEQ ID NO.8; The SNP3 molecular marker is located at position 180 of the nucleotide sequence shown in SEQ ID NO.

9.

3. The SNP molecular marker according to claim 1 or 2, characterized in that, In the SNP1 molecular marker, the genotype of the polymorphic site is A / A, corresponding to high oil content; the genotype of the polymorphic site is T / T, corresponding to candidate high oil content; and the genotype of the polymorphic site is A / T, corresponding to low oil content. In the SNP2 molecular marker, the genotype of the polymorphic site is T / T, which corresponds to high oil content; the genotype of the polymorphic site is T / G or G / G, which corresponds to low oil content. In the SNP3 molecular marker, the genotype of the polymorphic site is A / A or A / G, which corresponds to high oil content; the genotype is G / G, which corresponds to low oil content.

4. A combination of SNP molecular markers associated with the oil content of common camellia seed kernels, characterized in that, The SNP molecular marker combination includes at least two of the SNP1 molecular marker, SNP2 molecular marker, and SNP3 molecular marker; The SNP1, SNP2, and SNP3 molecular markers are the same as those described in claim 1 or 2.

5. Primers, characterized in that, The primers are used to amplify the SNP molecular markers of any one of claims 1 to 3 or the SNP molecular marker combination of claim 4.

6. The primer according to claim 5, characterized in that, The primers include those shown in SEQ ID NO. 1-2 and / or SEQ ID NO. 3-4 and / or SEQ ID NO. 5-6.

7. A kit containing the primers of claim 5 or 6; preferably, the kit is used to identify the oil content of common camellia seeds.

8. A method for identifying the oil content of common camellia seed kernels, characterized in that, include: Using the genomic DNA of the common camellia oleifera to be tested as a template, PCR amplification reaction is performed using primers for amplifying the SNP molecular markers described in any one of claims 1 to 3 or primers for amplifying the SNP molecular marker combination described in claim 4. The genotype of the common camellia oleifera seed kernel oil content phenotype is identified based on the genotype of the SNP molecular marker locus. Preferably, the reaction program for the PCR amplification reaction is as follows: 94~95℃, 3~5min; 94~95℃, 15~30s, 65~69℃, 40~60s, 38~45 cycles; 67~70℃, 3~6min.

9. The identification method according to claim 8, characterized in that, When using SNP1, SNP2, or SNP3 molecular markers alone for identification: In the SNP1 molecular marker, if the genotype of the polymorphic site is A / A, then the tested Camellia oleifera has a high oil content; if the genotype of the polymorphic site is T / T, then the tested Camellia oleifera is a candidate for high oil content; if the genotype of the polymorphic site is A / T, then the tested Camellia oleifera has a low oil content. In the SNP2 molecular marker, if the genotype of the polymorphic site is T / T, then the tested Camellia oleifera has a high oil content; if the genotype of the polymorphic site is T / G or G / G, then the tested Camellia oleifera has a low oil content. In the SNP3 molecular marker, if the genotype of the polymorphic site is A / A or A / G, the tested Camellia oleifera has a high oil content; if the genotype is G / G, the tested Camellia oleifera has a low oil content. When two or more of the SNP1, SNP2, and SNP3 molecular markers are used for identification: if at least two SNP molecular marker loci are high-oil-content genotypes and / or candidate high-oil-content genotypes, then the tested common camellia oleifera has a high oil content; if all three SNP molecular marker loci are low-oil-content genotypes, then the tested common camellia oleifera has a low oil content.

10. The use of the SNP molecular marker of any one of claims 1 to 3, or the SNP molecular marker combination of claim 4, or the primer of claim 5 or 6, or the kit of claim 7, or the identification method of claim 8 or 9, in at least one of the following aspects: (1) Identification of the oil content phenotype of common camellia seeds; (2) Identification, improvement or molecular marker-assisted breeding of common camellia oleifera germplasm resources; (3) Early prediction of oil content in common camellia seeds; (4) Screening common camellia with high oil content; Preferably, the target trait for the identification, improvement, or molecular marker-assisted breeding of the common camellia oleifera germplasm resource is the oil content of the common camellia oleifera kernel.

Images