KASP molecular marker closely linked with pod number and grain number characters of single soybean plant and application of KASP molecular marker

By using KASP molecular markers that are closely linked to the number of pods and seeds per soybean plant, the tedious and time-consuming problem of selecting the number of pods and seeds in traditional breeding has been solved, enabling genotype screening at the seedling stage and improving breeding efficiency and yield.

CN122060907APending Publication Date: 2026-05-19黑龙江省农业科学院大豆研究所(黑龙江农业科技杂志社)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610436599.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-03
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

In traditional soybean breeding, the selection of traits such as the number of pods and seeds per plant relies on field phenotypic measurements. This process is cumbersome, time-consuming, and prone to errors, making it difficult to simultaneously improve these traits in early generations. This results in long breeding cycles, high costs, and low efficiency.

Method used

We provide KASP molecular markers that are closely linked to the traits of pod number and grain number per soybean plant. Genotype screening is used for seedling-assisted selection. Using the SNP locus on chromosome 19 of the soybean genome Wm82.a4.v1, we design primer combinations for KASP molecular markers to perform PCR amplification and fluorescence signal detection, thereby achieving efficient screening of materials with high pod number and grain number per plant.

Benefits of technology

It can replace large-scale phenotypic screening, reduce field workload, improve screening accuracy and efficiency, shorten the breeding cycle, and increase soybean yield per unit area.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060907A_ABST
    Figure CN122060907A_ABST
Patent Text Reader

Abstract

The invention discloses a KASP molecular marker closely linked with the pod number and grain number characters of a soybean single plant and application of the KASP molecular marker, and belongs to the technical field of soybean agronomic character molecular marker development and molecular marker assisted breeding. The KASP molecular marker closely linked with the characters of the pod number and the grain number of the single soybean plant is positioned at the 45799056 bp site of the No.19 chromosome of the Wm82. A4. V1 version of the soybean genome, and the genotype is C or T. The invention also discloses a method for preparing the KASP molecular marker closely linked with the characters of the pod number and the grain number of the single soybean plant. By developing a functional KASP marker for regulating and controlling the pod number and grain number characters of a single soybean plant, a set of efficient and convenient molecular marker-assisted selection system is provided, and accurate typing and early screening of the pod number and grain number characters of the single soybean plant can be realized. The marker can rapidly identify genotypes of phenotypic materials with different single plant pod numbers and grain numbers in a natural population, traditional phenotypic screening is replaced with molecular marker assisted breeding, the field test cost can be greatly reduced, and the breeding selection efficiency and accuracy are remarkably improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker development for soybean agronomic traits and molecular marker-assisted breeding technology, and more specifically to KASP molecular markers closely linked to the traits of pod number and grain number per soybean plant and their applications. Background Technology

[0002] The final yield of soybeans is determined by multiple factors, among which the number of pods per plant and the number of grains per plant are considered key yield components (Liu et al., 2020). Theoretically, the more pods per plant and the higher the number of grains per pod, the greater the yield potential per plant. However, these traits are typical complex quantitative traits, controlled by multiple genes and easily influenced by environmental conditions (such as light, temperature, and water) and genotype-environment interactions. This complexity makes it exceptionally difficult to simultaneously improve these traits through traditional phenotypic selection, resulting in long cycles, high costs, and low efficiency.

[0003] In traditional soybean breeding, the selection of pod number and grain number mainly relies on field phenotypic measurements. This method requires extensive manual testing during crop maturity, including counting the number of pods per plant and counting the number of grains after pod removal. The process is extremely tedious, time-consuming, and labor-intensive, and subjective errors are difficult to avoid. Because these traits are unstable at the individual plant level in early generations (such as F2 and F3), and because there are pleiotropic effects and negative correlations between traits, the accuracy of phenotypic-based selection is greatly reduced.

[0004] The emergence of marker-assisted selection (MAS) technology provides an effective way to overcome the aforementioned bottlenecks. By utilizing DNA molecular markers closely linked to the target trait, breeders can precisely screen genotypes at the seedling stage without waiting for plant maturity, thus significantly shortening the breeding cycle and improving selection efficiency and accuracy. Over the past few decades, researchers have used linkage analysis and association analysis to locate hundreds of quantitative trait loci (QTLs) related to pod number and seed number in the soybean genome, laying the theoretical foundation for the application of MAS.

[0005] The number of pods and seeds per soybean plant are core components of yield traits, and elucidating their genetic mechanisms has significant theoretical value and practical guiding significance for the breeding of high-yielding soybean varieties. Academician Gai Junyi's team conducted multi-year, multi-environment phenotypic identification using different genetic populations, constructing high-density genetic maps to discover stable QTLs. Researcher Feng Xianzhong's team, through GWAS analysis of 809 soybean germplasm accessions, identified SNP loci significantly associated with the number of pods and seeds per plant on multiple chromosomes. A strong signal locus associated with the number of pods per plant was found on Chr19. The advantage of GWAS is its higher resolution and ability to directly provide candidate genes. They further analyzed the genetic networks of these yield traits, revealing their complex genetic basis. Researcher Zhang Chunbao's team, using a specific RIL population, located multiple yield trait QTLs. For the number of pods per plant, they detected major-effect QTLs on Chr06, Chr13, and Chr20. These studies provide tightly linked molecular markers, making it possible to simultaneously improve multiple yield traits through marker-assisted selection. The number of pods and seeds per soybean plant is not only a key breeding objective, but also an ideal entry point for studying soybean domestication, genetic evolution, and molecular regulatory mechanisms. In the future, integrating multi-omics analysis and gene editing technologies to deeply elucidate its genetic basis will provide important scientific support for molecular design breeding and the development of breakthrough varieties.

[0006] Therefore, providing KASP molecular markers closely linked to the traits of pod number and seed number per soybean plant and their applications is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0007] In view of this, the present invention provides KASP molecular markers closely linked to the traits of pod number and grain number per soybean plant and their applications.

[0008] The molecular markers obtained in this invention are closely linked to the traits of pod number and grain number per soybean plant, and can be used for assisted selection breeding to screen soybean materials with different pod numbers and grain numbers per plant and their offspring.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] To achieve the screening function, this invention provides a KASP molecular marker for identifying different pod numbers and seed numbers per soybean plant. The molecular marker is an SNP mutation marker located at 45799056 bp on chromosome 19 of soybean genome Wm82.a4.v1, with the sequence of the first and last 50 bp as shown in SEQ ID NO.1 or SEQ ID NO.2.

[0011] The KASP molecular marker genotype is C or T; the sequence of the C genotype within 50 bp before and after is shown in SEQ ID NO.1, and the corresponding phenotype is low pod number and seed number per plant; the sequence of the T genotype within 50 bp before and after is shown in SEQ ID NO.2, and the corresponding phenotype is high pod number and seed number per plant.

[0012] ATCATTTTGAGGAGGAAGAAGCCACCGTTGGTTCCAAAAAGATCACAGAA C TCGCAGAAGAAAAGTTAGTGATTACTAAAATGCCATCGTGCAACAATAAT; SEQ ID NO.1.

[0013] ATCATTTTGAGGAGGAAGAAGCCACCGTTGGTTCCAAAAAGATCACAGAA T TCGCAGAAGAAAAGTTAGTGATTACTAAAATGCCATCGTGCAACAATAAT; SEQ ID NO. 2.

[0014] In addition, this invention also provides a KASP molecular marker primer combination for identifying the number of pods and seeds per soybean plant, the primer sequences of which are as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCT GTAATCACTAACTTTTCTTCTGCGAG -3';SEQ ID NO.3.

[0015] Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATT GTAATCACTAACTTTTCTTCTGCGAA -3';SEQ ID NO.4.

[0016] Reverse primer R: 5'-ACAACCTACCCGAGCTAGCG-3'; SEQ ID NO. 5.

[0017] This invention also provides KASP molecular markers closely linked to the traits of pod number and grain number per soybean plant and their applications for molecular-assisted selection breeding of soybean materials or their progeny with different pod numbers and grain numbers per plant.

[0018] Specifically, the application of the KASP molecular marker or the KASP molecular marker primer combination in identifying or assisting in the identification of the number of pods and seeds per soybean plant.

[0019] The aforementioned molecular markers can be used to conduct molecular-assisted selection breeding for soybeans with high pod number and seed number per plant. The KASP molecular markers designed and developed are closely linked to traits of high pod number and seed number per plant. These markers can be used for preliminary screening of soybean varieties with high pod and seed number per plant, thus achieving marker-assisted breeding and accelerating the breeding process. In production, these molecular markers can also be used to detect high pod and seed number per plant during the seedling stage, screening for plants with high pod and seed number traits, improving soybean photosynthetic efficiency, promoting dry matter accumulation, and ultimately increasing soybean yield per unit area.

[0020] A method for identifying the number of pods and seeds per soybean plant includes the following steps: (1) Extract genomic DNA from soybean samples to be tested; use the KASP molecular marker primer combination to perform PCR amplification of soybean sample genomic DNA on an ABI Stepone PCR instrument; use an ABI Stepone PCR instrument to detect fluorescence signals and analyze genotyping; (2) Judgment based on genotype results: When the genotype result of the sample is consistent with the genotype CC of soybean material with low number of pods and grains per plant, the soybean sample being identified exhibits the trait of high number of pods and grains per plant; when the genotype result of the sample is consistent with the genotype TT of material with high number of pods and grains per plant, the soybean sample being identified exhibits the trait of low number of pods and grains per plant.

[0021] As can be seen from the above technical solution, compared with the prior art, this invention discloses KASP molecular markers closely linked to the traits of pod number and grain number per soybean plant and their applications. The obtained KASP markers of soybean genes regulating pod number and grain number per plant provide a novel and simple molecular marker and marker-assisted selection method, suitable for rapid screening and marker-assisted breeding of soybean plants with relatively high or low pod number and grain number. These molecular markers can detect genotypes of materials with different pod and grain numbers per plant in natural populations, and can also be used for molecular-assisted selection breeding of soybean materials with different pod and grain numbers per plant, replacing large-scale phenotypic screening, reducing field workload, and greatly improving the accuracy and efficiency of screening. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0023] Figure 1The molecular marker gene typing map and phenotypic association verification results of natural soybean populations with different pod numbers and grain numbers per plant in this invention are shown below; Allele1 / Allele1 represents FAM, indicating genotype CC; Allele2 / Allele2 represents HEX, indicating genotype TT; yellow indicates negative control with no signal. Detailed Implementation

[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Development and validation of KASP molecular markers for pod number and grain number traits in soybean plants By screening molecular markers, the KASP molecular marker closely linked to the traits of pod number and seed number per soybean plant was finally obtained. The primer combination sequence for this molecular marker is as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCT GTAATCACTAACTTTTCTTCTGCGAG -3';SEQ ID NO.3.

[0026] Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATT GTAATCACTAACTTTTCTTCTGCGAA -3';SEQ ID NO.4.

[0027] Reverse primer R: 5'-ACAACCTACCCGAGCTAGCG-3'; SEQ ID NO. 5.

[0028] The SNP marker is located at position 45,799,056 bp on soybean chromosome 19. The molecular marker is an SNP mutation marker, classified into C and T genotypes. The 50 bp sequences before and after the molecular marker site are as follows: ATCATTTTGAGGAGGAAGAAGCCACCGTTGGTTCCAAAAAGATCACAGAA C TCGCAGAAGAAAAGTTAGTGATTACTAAAATGCCATCGTGCAACAATAAT; SEQ ID NO.1.

[0029] or ATCATTTTGAGGAGGAAGAAGCCACCGTTGGTTCCAAAAAGATCACAGAA T TCGCAGAAGAAAAGTTAGTGATTACTAAAATGCCATCGTGCAACAATAAT; SEQ ID NO. 2.

[0030] The number of pods and seeds per plant in natural soybean populations was measured, as follows: (1) DNA extraction Genomic DNA was extracted from natural soybean populations using the CTAB method.

[0031] (2) PCR amplification The PCR reaction system consisted of: 5.0 μl of 30-50 ng / μl soybean genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (primer concentrations were all 10 ng / μl and met the molar ratio of F-HEX:F-FAM:R=2:2:5), for a total volume of 10.14 μl.

[0032] The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 31-35 cycles. 30℃, 1 minute (read fluorescence signal).

[0033] PCR amplification was performed on the ABI Step One PCR instrument, and the genotyping information could be obtained directly after the instrument detected the fluorescence signal.

[0034] The forward primers F-HEX and F-FAM each have their own fluorescent adapters (displayed as different colors on the genotyping map, e.g., red for CC genotype, blue for TT genotype, and green for CT genotype). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. The fluorescence difference indicates whether the tested material is homozygous CC or TT genotype. If the material being tested is heterozygous, both primers will amplify, producing a third fluorescent signal, thus distinguishing heterozygous genotypes.

[0035] The results for the natural population are shown in Table 1.

[0036] Table 1 Genotyping data of natural populations and data on pod and seed count per plant

[0037] Note: - indicates no data.

[0038] like Figure 1 (Where blue represents the TT genotype with high pod and grain number per plant; red represents the CC genotype with low pod and grain number per plant; and yellow represents the negative control with no fluorescence signal.) As shown in Table 1, the results of pod and grain number per plant and molecular marker identification of 166 soybean germplasm natural materials are as follows: Theoretically, soybeans with the TT genotype should have high pod and grain numbers per plant, while soybeans with the CC genotype should have low pod and grain numbers per plant. The theoretical results are largely consistent with the measured pod and grain numbers per plant. Molecular markers can detect different genotypes with varying pod and grain numbers per plant in natural populations, further clarifying that these molecular markers can be used for molecular-assisted selection breeding of soybean materials with different pod and grain numbers per plant.

[0039] like Figure 1 Analysis of the data in Table 1 shows that the number of pods per plant (90.3 / plant (Harbin), 48.4 / plant (Sanya)) and the number of seeds per plant (199.9 seeds / plant (Harbin), 90.3 seeds / plant (Sanya)) of homozygous TT genotype soybeans were significantly higher than those of CC genotype soybeans (77.2 pods / plant (Harbin), 38.1 pods / plant (Sanya)) and (176.1 seeds / plant (Harbin), 74.4 seeds / plant (Sanya)). Therefore, the molecular markers of this invention are mainly used for the initial screening of soybean varieties with high pod and seed counts per plant, in order to achieve the purpose of molecular marker-assisted breeding.

[0040] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A KASP molecular marker closely linked to the traits of pod number and seed number per soybean plant, characterized in that, The KASP molecular marker genotype is C or T, located at 45799056 bp on chromosome 19 of soybean genome Wm82.a4.v1.

2. The KASP molecular marker closely linked to the traits of pod number and seed number per soybean plant as described in claim 1, characterized in that, When the KASP molecular marker genotype is C, the sequence of the first and last 50 bp is shown in SEQ ID NO. 1, and the corresponding phenotype is low pod number and seed number per plant; when the KASP molecular marker genotype is T, the sequence of the first and last 50 bp is shown in SEQ ID NO. 2, and the corresponding phenotype is high pod number and seed number per plant.

3. A KASP molecular marker primer combination for identifying the number of pods and seeds per soybean plant, characterized in that, The primer sequences are as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTGTAATCACTAACTTTTCTTCTGCGAG-3'; SEQ ID NO.3; Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTGTAATCACTAACTTTTCTTCTGCGAA-3'; SEQ ID NO.4; Reverse primer R: 5'-ACAACCTACCCGAGCTAGCG-3'; SEQ ID NO.

5.

4. A kit for identifying the number of pods and seeds per soybean plant, characterized in that, Contains the KASP molecular marker primer combination as described in claim 3.

5. The use of the KASP molecular marker according to any one of claims 1-2, the KASP molecular marker primer combination according to claim 3, or the kit according to claim 4 in identifying or assisting in the identification of the number of pods and seeds per soybean plant.

6. A method for identifying the number of pods and seeds per soybean plant, characterized in that, Includes the following steps: (1) Extract genomic DNA from soybean samples to be tested; perform PCR amplification of soybean sample genomic DNA using the KASP molecular marker primer combination described in claim 3 on an ABI Stepone PCR instrument; detect fluorescence signals using an ABI Stepone PCR instrument and analyze genotyping; (2) Judgment based on genotype results: When the genotype result of the sample is consistent with the genotype CC of soybean material with low number of pods and grains per plant, the soybean sample being identified exhibits the trait of low number of pods and grains per plant; when the genotype result of the sample is consistent with the genotype TT of soybean material with high number of pods and grains per plant, the soybean sample being identified exhibits the trait of high number of pods and grains per plant.