Reagent for improving methylation level of FANCB promoter and application

Abstract

The invention relates to a reagent for improving the methylation level of a FANCB promoter and application, and particularly provides an epigenetic editing reagent which enables the methylation level of a FANCB promoter region to be increased, so that FANCB is inactivated, and then ovarian cancer is treated and the drug sensitivity of the ovarian cancer is increased.

Description

Technical Field

[0001] This invention relates to epigenetics and tumor treatment, specifically to epigenetic editing techniques that suppress FANCB expression, thereby increasing drug sensitivity in ovarian cancer. Background Technology

[0002] Platinum-based drugs, first-line treatments for ovarian cancer, induce DNA double-strand breaks (DSBs) by causing interstrand cross-linking (ICL) damage. PARP inhibitors (PARPi), on the other hand, further promote DSB formation by inhibiting the base excision repair (BER) pathway of single-strand DNA breaks (SSBs), leading to cell cycle arrest and apoptosis. Activation of the DNA damage response (DDR) is a key mechanism for tumor cell survival and the development of platinum / PARPi resistance. The Fanconi anemia (FA) pathway is a molecular pathway specifically dedicated to repairing ICL damage. FANCB It is a core component of the FA complex; its loss of function will lead to the loss of the FA repair pathway. FANCB It also regulates H3K9 methylation.

[0003] Epigenetic regulation of DNA methylation plays a crucial role in the development of ovarian cancer (OC) drug resistance. Epigenetic editing can selectively knock down drug resistance-related genes and overexpress sensitizing genes, leading to cell death by platinum-based chemotherapy drugs / PARPi inhibitors. Therefore, research into the epigenetic regulatory mechanisms of drug sensitivity in ovarian cancer is needed to provide novel intervention targets for drug sensitization. Summary of the Invention

[0004] To address the aforementioned deficiencies, this invention provides a reagent for improving the methylation level of the FANCB promoter and its uses.

[0005] The first aspect of the present invention provides the use of an agent that inhibits FANCB gene expression in the preparation of a pharmaceutical composition for treating cancer, improving the efficacy of anticancer drugs, increasing the sensitivity of tumor cells to anticancer drugs, and / or reducing the drug resistance of tumor cells, wherein the anticancer drug is a chemotherapeutic drug and / or a PARP inhibitor.

[0006] In one or more embodiments, the agent for inhibiting FANCB gene expression is an agent that increases the methylation level of the FANCB promoter region or a fragment thereof.

[0007] In one or more embodiments, the FANCB promoter region is the region from 2000 bp upstream to 1000 bp downstream of the transcription start site.

[0008] In one or more embodiments, the FANCB promoter region is from position 14890192 to position 14893191 of the human X chromosome, and the segment of the FANCB promoter region is a segment from position 14890192 to position 14893191 of the human X chromosome containing positions 14891454 to 14891530.

[0009] In one or more embodiments, the chromosome number of the FANCB promoter region is referenced to the human reference genome GRCh37 (hg19).

[0010] In one or more embodiments, the FANCB promoter region is shown as SEQ ID NO:12.

[0011] In one or more embodiments, increasing the methylation level of the FANCB promoter region or a fragment thereof means increasing the average methylation level of any one or all of the CG dinucleotides in the sequence from position 14891454 to position 14891530 of the human X chromosome.

[0012] In one or more embodiments, the fragment of the FANCB promoter region comprises one or more sequences selected from the following: a 20-800bp fragment containing 14,891,494 bits, a 20-800bp fragment containing 14,891,429 bits, and a 20-800bp fragment containing 14,891,330 bits.

[0013] In one or more embodiments, the FANCB promoter region fragment comprises one or more sequences selected from the following: (1) a 20-800 bp fragment of the FANCB promoter region containing 14891494, preferably a 300-500 bp fragment of the FANCB promoter region containing 14891494; (2) a 20-800 bp fragment of the FANCB promoter region containing 14891429, preferably a 300-500 bp fragment of the FANCB promoter region containing 14891330, preferably a 300-500 bp fragment of the FANCB promoter region containing 14891330.

[0014] In one or more embodiments, the cancer is a cancer with upregulated FANCB expression, and the tumor cells are tumor cells with upregulated FANCB expression. In one or more embodiments, the cancer is not a cancer with downregulated FANCB expression, and the tumor cells are not tumor cells with downregulated FANCB expression.

[0015] In one or more embodiments, the cancer is ovarian cancer.

[0016] In one or more embodiments, the tumor cells are ovarian cancer cells.

[0017] In one or more embodiments, the cancer is ovarian cancer with upregulated or no significant change in FANCB expression, and the tumor cells are ovarian cancer cells with upregulated or no significant change in FANCB expression.

[0018] In one or more embodiments, the tumor cells are A2780 cells, SKOV3 cells, or OVCAR3 cells. In one or more embodiments, the tumor cells are A2780 cells, SKOV3 cells, or OVCAR3 cells with upregulated or no significant change in FANCB expression.

[0019] In one or more embodiments, the chemotherapy drug is a platinum-based drug.

[0020] In one or more embodiments, the platinum-based drug includes cisplatin, carboplatin, nedaplatin, oxaliplatin, and lobaplatin, preferably cisplatin.

[0021] In one or more embodiments, the PARP inhibitor includes olaparib, niraparib, fluzoparib, pamiparib, and preferably, the PARP inhibitor is olaparib.

[0022] In one or more embodiments, the reagent for increasing the methylation level of the FANCB promoter region or a fragment thereof comprises: (1) sgRNA or its complementary sequence, or (2) a nucleic acid construct containing said sgRNA or its complementary sequence.

[0023] In one or more embodiments, the nucleic acid construct is the sgRNA or its complementary sequence, or a cloning vector or expression vector.

[0024] In one or more embodiments, the sgRNA has a sequence as shown in SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:3 or a variant thereof having at least 80% sequence identity.

[0025] In one or more embodiments, the reagent further comprises an epigenetic editing reagent.

[0026] In one or more embodiments, the epigenetic editing reagent comprises a DNA methyltransferase or its expression vector, and / or a Cas enzyme or its expression vector.

[0027] In one or more embodiments, the DNA methyltransferase is selected from one or more of DNMT1, DNMT2, DNMT3A, or DNMT3B; the DNA methyltransferase optionally further comprises a DNA-binding protein, such as DNMT3L. Preferably, the N-segment or C-segment of the DNA methyltransferase is fused with DNMT3L.

[0028] In one or more embodiments, the Cas enzyme is Cas9, preferably a Cas9 mutant dCas9 without endonuclease activity. Preferably, the N-segment or C-segment of the Cas enzyme is fused with a KRAB domain.

[0029] In one or more embodiments, the epigenetic editing reagent further comprises a marker or expression vector thereof for detection, such as a peptide epitope or a fluorescent protein.

[0030] In one or more embodiments, the epigenetic editing reagent comprises a fusion protein or its expression vector, the fusion protein comprising...

[0031] (1) DNA methyltransferases, such as DNMT1, DNMT2, DNMT3A, or DNMT3B, (2) Cas enzyme, such as Cas9, preferably the Cas9 mutant dCas9 without endonuclease activity. Optionally, it may also contain DNA-binding proteins located in the N- or C-segment of DNA methyltransferases, such as DNMT3L. Optionally, it may also include a KRAB domain located in the N or C segment of the Cas enzyme. The optional component also includes nuclear positioning signals. Optional features may also include biomarkers for detection, such as peptide epitopes and fluorescent proteins.

[0032] In one or more embodiments, the fusion protein has a connector between its domains or components, such as XTEN80.

[0033] In one or more embodiments, the fusion protein comprises, from the N-terminus to the C-terminus, the following: dCas9, KRAB structural domains dCas9, DNMT3A, DNMT3L, KRAB structural domain, dCas9, DNMT3A, DNMT3L, or dCas9, DNMT3A, DNMT3L, KRAB structural domains.

[0034] A second aspect of the invention also provides the use of reagents and anticancer drugs that inhibit FANCB gene expression in the preparation of pharmaceutical compositions for treating cancer, wherein the reagents, anticancer drugs, and anticancer drugs that inhibit FANCB gene expression are as described in any embodiment of the first aspect of the invention.

[0035] A third aspect of the present invention provides a method for treating cancer, comprising administering a therapeutically effective amount of a reagent for inhibiting FANCB gene expression and a therapeutically effective amount of an anticancer drug, wherein the reagent for inhibiting FANCB gene expression, the anticancer drug, and the cancer are as described in any embodiment of the first aspect of the present invention.

[0036] In one or more embodiments, the anticancer drug is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days after administration of the agent that inhibits FANCB gene expression.

[0037] A fourth aspect of the present invention provides a non-therapeutic method for reducing FANCB expression in cells in vitro, including increasing the methylation level of the FANCB promoter region or a fragment thereof.

[0038] In one or more embodiments, the agent for inhibiting FANCB gene expression is an agent that increases the methylation level of the FANCB promoter region or a fragment thereof.

[0039] In one or more embodiments, the FANCB promoter region is the region from 2000 bp upstream to 1000 bp downstream of the transcription start site.

[0040] In one or more embodiments, the FANCB promoter region is from position 14890192 to position 14893191 of the human X chromosome, and the segment of the FANCB promoter region is a segment from position 14893191 to position 14890192 of the human X chromosome containing positions 14891454 to 14891530.

[0041] In one or more embodiments, the reference genome version of the FANCB promoter region is hg19 (GRCh37).

[0042] In one or more embodiments, the FANCB promoter region is shown as SEQ ID NO:12.

[0043] In one or more embodiments, increasing the methylation level of the FANCB promoter region or a fragment thereof means increasing the average methylation level of any one or all of the CG dinucleotides in the sequence from position 14891454 to position 14891530 of the human X chromosome.

[0044] In one or more embodiments, the method includes: Introduce the following reagents into cells: (1) sgRNA or its complementary sequence, or a nucleic acid construct containing said sgRNA or its complementary sequence, and (2) an epigenetic editing reagent; or Introduce the following reagents into cells containing epigenetic editing reagents: sgRNA or its complementary sequence, or a nucleic acid construct containing said sgRNA or its complementary sequence. The epigenetic reagent is as described in any embodiment of the first aspect of this document.

[0045] The fifth aspect of the present invention provides a kit or composition comprising (1) sgRNA or its complementary sequence, or a nucleic acid construct containing said sgRNA or its complementary sequence, and (2) an epigenetic editing reagent.

[0046] In one or more embodiments, the nucleic acid construct is the sgRNA or its complementary sequence, or a cloning vector or expression vector.

[0047] In one or more embodiments, the sgRNA has a sequence as shown in SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:3 or a variant thereof having at least 80% sequence identity.

[0048] In one or more embodiments, the reagent further comprises an epigenetic editing reagent.

[0049] In one or more embodiments, the epigenetic editing reagent comprises a DNA methyltransferase or its expression vector, and / or a Cas enzyme or its expression vector.

[0050] In one or more embodiments, the DNA methyltransferase is selected from one or more of DNMT1, DNMT2, DNMT3A, or DNMT3B; the DNA methyltransferase optionally further comprises a DNA-binding protein, such as DNMT3L. Preferably, the N-segment or C-segment of the DNA methyltransferase is fused with DNMT3L.

[0051] In one or more embodiments, the Cas enzyme is Cas9, preferably a Cas9 mutant dCas9 without endonuclease activity. Preferably, the N-segment or C-segment of the Cas enzyme is fused with a KRAB domain.

[0052] In one or more embodiments, the epigenetic editing reagent further comprises a marker or expression vector thereof for detection, such as a peptide epitope or a fluorescent protein.

[0053] In one or more embodiments, the epigenetic editing reagent comprises a fusion protein or its expression vector, the fusion protein comprising...

[0054] (1) DNA methyltransferases, such as DNMT1, DNMT2, DNMT3A, or DNMT3B, (2) Cas enzyme, such as Cas9, preferably the Cas9 mutant dCas9 without endonuclease activity. Optionally, it may also contain DNA-binding proteins located in the N- or C-segment of DNA methyltransferases, such as DNMT3L. Optionally, it may also include a KRAB domain located in the N or C segment of the Cas enzyme. The optional component also includes nuclear positioning signals. Optional features may also include biomarkers for detection, such as peptide epitopes and fluorescent proteins.

[0055] In one or more embodiments, the fusion protein has a connector between its domains or components, such as XTEN80.

[0056] In one or more embodiments, the fusion protein comprises, from the N-terminus to the C-terminus, the following: dCas9, KRAB structural domains dCas9, DNMT3A, DNMT3L, KRAB structural domain, dCas9, DNMT3A, DNMT3L, or dCas9, DNMT3A, DNMT3L, KRAB structural domains.

[0057] In one or more embodiments, the epigenetic editing agent is a CRISPRoff system or CRISPR-dCas9-DNMT3A.

[0058] The sixth aspect of the invention also provides the use of reagents for detecting the methylation level of the FANCB promoter region or fragments thereof in the preparation of kits for diagnosing and / or treating cancer, improving the sensitivity of tumor cells to anticancer drugs and / or reducing the drug resistance of tumor cells.

[0059] In one or more embodiments, the FANCB promoter region is the region from 2000 bp upstream to 1000 bp downstream of the transcription start site.

[0060] In one or more embodiments, the FANCB promoter region is from position 14890192 to position 14893191 of the human X chromosome, and the segment of the FANCB promoter region is a segment from position 14890192 to position 14893191 of the human X chromosome containing positions 14891454 to 14891530.

[0061] In one or more embodiments, the chromosome number of the FANCB promoter region is referenced to the human reference genome GRCh37 (hg19).

[0062] In one or more embodiments, the FANCB promoter region is shown as SEQ ID NO:12.

[0063] In one or more embodiments, increasing the methylation level of the FANCB promoter region or a fragment thereof means increasing the average methylation level of any one or all of the CG dinucleotides in the sequence from position 14891454 to position 14891530 of the human X chromosome.

[0064] In one or more embodiments, the cancer is ovarian cancer.

[0065] In one or more embodiments, the tumor cells are ovarian cancer cells.

[0066] In one or more embodiments, the cancer is ovarian cancer with upregulated or no significant change in FANCB expression, and the tumor cells are ovarian cancer cells with upregulated or no significant change in FANCB expression.

[0067] In one or more embodiments, the tumor cells are A2780 cells, SKOV3 cells, or OVCAR3 cells. In one or more embodiments, the tumor cells are A2780 cells, SKOV3 cells, or OVCAR3 cells with upregulated or no significant change in FANCB expression.

[0068] In one or more embodiments, the anticancer drug includes chemotherapy drugs and PARP inhibitors.

[0069] In one or more embodiments, the chemotherapy drug is a platinum-based drug.

[0070] In one or more embodiments, the platinum-based drug includes cisplatin, carboplatin, nedaplatin, oxaliplatin, and lobaplatin, preferably cisplatin.

[0071] In one or more embodiments, the PARP inhibitor includes olaparib, niraparib, fluzoparib, pamiparib, and preferably, the PARP inhibitor is olaparib.

[0072] The beneficial effects of this invention are as follows: The inventors designed an editing method targeting a specific FANCB promoter region. Validation of the editing effects revealed that epigenetic inactivation of FANCB significantly improved sensitivity to platinum-based and PARP inhibitors. Attached Figure Description

[0073] Figure 1 The methylation level of the FANCB gene promoter is shown in ovarian cancer tissue and normal ovarian tissue samples. The horizontal axis represents the various samples (normal ovarian tissue and ovarian cancer tissue), and n represents the number of samples; the vertical axis represents the methylation level.

[0074] Figure 2 The methylation level of the FANCB gene promoter is shown in primary / recurrent ovarian cancer tissues. The horizontal axis represents the various samples (primary ovarian cancer tissues, recurrent ovarian cancer tissues), and n represents the number of samples; the vertical axis represents the methylation level.

[0075] Figure 3 The effect of FANCB promoter methylation status on homologous recombination defect (HRD) is shown. The horizontal axis represents chromosome location, and the vertical axis represents methylation level. The square broken line represents FANCB promoter methylation in HRD-positive samples, and the dotted broken line represents FANCB promoter methylation in HRD-negative samples.

[0076] Figure 4 The correlation between FANCB promoter methylation and HRD score is shown. A and B represent the correlation between methylation levels at FANCB promoter sites Chr.X 14891488 and Chr.X 14891470 and HRD score, respectively. The x-axis represents HRD score, and the y-axis represents FANCB promoter methylation level.

[0077] Figure 5 FANCB gene promoter methylation regulates gene expression. The effect of FANCB promoter methylation on transcriptional activity was detected using a dual-luciferase reporter gene assay. The x-axis represents the control reporter vector pCpGL-basic and the reporter vectors with unmethylated / methylated FANCB promoters, respectively; the y-axis represents FANCB transcriptional activity. P<0.05, p<0.01, p<0.001, p<0.0001)

[0078] Figure 6 A schematic diagram of the epigenetic editing design for the FANCB promoter.

[0079] Figure 7 This study validated the epigenetic editing of the FANCB promoter. AD represents the changes in DNA methylation around the sgRNA binding sites in 293T, A2780, SKOV3, and OVCAR3 48 hours post-transfection. The horizontal axis represents the chromosomal location of the CG site, and the vertical axis represents the methylation level at that site.

[0080] Figure 8 The epigenetic expression level of the FANCB promoter was altered after editing. Statistical analysis was performed using a two-tailed Student's t-test. p < 0.05, p < 0.01).

[0081] Figure 9 The effect of epigenetic editing of the FANCB promoter on the sensitivity of OC cells to HR drugs. AC represents the proliferation curves of A2780, SKOV3, and OVCAR3 cells 48 hours after epigenetic editing, after treatment with the corresponding concentrations of DDP and Olaparib for 4 days, expressed as OD450. DF represents the OD450 of A2780, SKOV3, and OVCAR3 cells 4 days after drug treatment, expressed as mean ± SD.

[0082] Figure 10 FANCB epigenetic editing affects cell cloning ability. Figure A shows the change in clone number of three cell types (A2780, SKOV3, and OVCAR3) after FANCB epigenetic editing. Figures B and D show the changes in clone number of the three cell types in bar graphs. P<0.05, p<0.01, p<0.001)

[0083] Figure 11 The effect of FANCB epigenetic editing on the migration ability of A2780, SKOV3, and OVCAR3 cells. A represents the scratch width of OC cells at 0 and 24 hours after FANCB epigenetic editing 24 hours later. BD represents the migration distance of A2780, SKOV3, and OVCAR3 cells at 0 and 24 hours after scratching and FANCB epigenetic editing, as well as after DDP administration. P<0.05, p<0.01, p<0.001)

[0084] Figure 12 The effect of FANCB epigenetic editing on apoptosis in A2780, SKOV3, and OVCAR3 cells was investigated. In this study, A represents the apoptosis of A2780, SKOV3, and OVCAR3 cells after 48 hours of FANCB epigenetic editing and 24 hours of DDP administration. After Annexin V-FITC / propidium iodide (PI) staining, apoptosis was detected by flow cytometry. A scatter plot of PI (y-axis) and Annexin V (x-axis) shows the distribution of normal viable cells, early apoptotic cells, late apoptotic cells, and dead cells. BD represents the percentage of apoptotic cells in A2780, SKOV3, and OVCAR3 cells after FANCB epigenetic editing and DDP administration. P<0.05, p<0.01, p<0.001). Detailed Implementation

[0085] The inventors investigated the epigenetic regulatory mechanisms of drug sensitivity in ovarian cancer, providing novel intervention targets for drug sensitization. They designed an editing method targeting a specific FANCB promoter region. Validation of the editing effects revealed that epigenetic inactivation of FANCB significantly improved sensitivity to platinum-based and PARP inhibitors.

[0086] This invention provides a kit or composition comprising (1) sgRNA or its complementary sequence, or a nucleic acid construct containing said sgRNA or its complementary sequence, and (2) an epigenetic editing reagent. This kit or composition can increase the methylation level at positions 14890192 to 14893191, or 14891454 to 14891530, of the TSS region of the cellular FANCB promoter.

[0087] In this document, "TSS region" refers to the transcription start site of a gene. This region typically contains gene promoters, regulatory elements, and transcription factor binding sites. The TSS site of the FANCB gene is located at chrX.14891191. The detection region is located 300 bp upstream of the TSS site, with a fragment length of 137 bp. This region is part of a CpG island and contains 12 CpG sites. This application targets epigenetic editing of a DNA region or fragment thereof from 2,000 bp upstream to 1,000 bp downstream of the FANCB promoter region (14890192-14893191). The fragment of the FANCB promoter region is a segment of the human X chromosome from positions 14890192 to 14893191, including positions 14891454 to 14891530. In one or more embodiments, the FANCB promoter region, as shown in SEQ ID NO:12, corresponds to positions 14890192 to 14893191 on the X chromosome. The chromosome numbering in this article is based on the human reference genome GRCh37.

[0088] In one or more embodiments, increasing the methylation level of the FANCB promoter region or a fragment thereof refers to an increase in the average methylation level of any one or all of the CG dinucleotides in the sequence from positions 14891454 to 14891530 of the human X chromosome. Positions 14891454 to 14891530 of the human X chromosome contain CG dinucleotides at the following positions: 14891530, 14891526, 14891524, 14891516, 14891509, 14891499, 14891496, 14891493, 14891488, 14891474, 14891470, and 14891454.

[0089] In one or more embodiments, increasing the methylation level of the FANCB promoter region or a fragment thereof refers to increasing the methylation level at the following sites from position 14891454 to position 14891530 on the human X chromosome: 14891530, 14891526, 14891524, 14891516, 14891509, 14891499, 14891496, 14891493, 14891488, 14891474, 14891470, and 14891454.

[0090] In one or more embodiments, the FANCB promoter region fragment comprises one or more sequences selected from the following: (1) a 20-800 bp fragment of the FANCB promoter region containing 14891494, for example, fragments containing 100, 200, 300, 400, 500, 600, 700, 800 bp of 14891494 or a range between any two values, preferably a 300-500 bp fragment of 14891494; (2) a 20-800 bp fragment of the FANCB promoter region containing 14891429, for example, fragments containing 100, 200, 300, 400, 500, 600, 700, 800 bp of 14891494 or a range between any two values, preferably a 300-500 bp fragment of 14891494; (2) 100, 200, 300, 400, 500, 600, 700, 800 bp segments of 14891429 or any range between two values, preferably including 300-500 bp segments of 14891429; (3) FANCB promoter region includes 20-800 bp segments of 14891330, for example including 100, 200, 300, 400, 500, 600, 700, 800 bp segments of 14891330 or any range between two values, preferably including 300-500 bp segments of 14891330.

[0091] In one or more embodiments, the fragments of the FANCB promoter region comprise one or more sequences selected from the following: 400bp, 300bp, 200bp, and 100bp fragments upstream and downstream of FANCB promoter region 14891494; 400bp, 300bp, 200bp, and 100bp fragments upstream and downstream of FANCB promoter region 14891429; and 400bp, 300bp, 200bp, and 100bp fragments upstream and downstream of FANCB promoter region 14891330.

[0092] In this article, "DNA methylation" or "methylation" can be used interchangeably, referring to the process of acquiring a methyl (CH3) group through covalent binding. This is a chemical modification process of S-adenosylmethionine (SAM), which acts as a CH3 donor, under the catalysis of DNMT at specific bases in the DNA sequence. Cytosine (C) is the most commonly methylated base in this process, and C-site methylation mainly occurs on CpG sequences. In mammals, some CpG dinucleotides are scattered throughout the genome, while others appear in dense clusters of CpG islands. CpG islands are usually unmethylated and are often located in promoter regions of genes that regulate transcription initiation and repression. Hypermethylation of CpG sites in enhancers or promoters usually leads to transcriptional silencing, while hypomethylation of CpG sites in the genome usually leads to gene expression activation. Therefore, methylation typically regulates gene expression through gene transcription. In this invention, the inventors discovered that methylating a specific region of the FANCB promoter using epigenetic editing tools can inactivate FANCB, thereby improving drug sensitivity in ovarian cancer. DNA methylation ratio is the proportion of methylated cytosine to cytosine, expressed as a percentage from 0% to 100%.

[0093] In this document, the calculation of "methylation level" can be performed in various ways known in the art. Exemplarily, the methylation level can be the proportion of cells with methylation at a given site to the total number of cells. The methylation level at multiple sites can be the mean, weighted mean, median, or obtained using methylation level calculation procedures known in the art.

[0094] In this article, epigenetic editing tools or reagents may include the CRISPRoff system and sgRNA. The CRISPRoff system contains DNA methyltransferases responsible for adding methyl groups to cytosine on DNA molecules, including DNMT1, DNMT2, DNMT3A, and DNMT3B. The CRISPRoff system may also include DNMT3L, which interacts with the DNMT3A protein to form a complex and can enhance the methylation activity of DNMT3A on DNA. The DNA methyltransferases may fuse with nuclear localization signals to carry the fusion protein into the nucleus. The CRISPRoff system also includes Cas enzymes, such as dCas9 without endonuclease activity. Cas enzymes and sgRNA bind to recognize specific sites. The CRISPRoff system may also include the KRAB domain for further recruitment of DNA methyltransferases to increase DNA methylation levels and recruiting histone deacetylases to reduce H3 acetylation. Cas enzymes may fuse with nuclear localization signals to carry the fusion protein into the nucleus. The CRISPRoff system may also include peptide epitopes for antibody detection, such as those containing HA. The CRISPRoff system may also include a fluorescent protein for observing the expression of the fusion protein; preferably, the fluorescent protein is BFP.

[0095] The CRISPRoff system may be a fusion protein comprising its components or its expression vector. For example, the fusion protein may comprise (1) a DNA methyltransferase, such as DNMT1, DNMT2, DNMT3A, or DNMT3B, and (2) a Cas enzyme, such as Cas9, preferably a Cas9 mutant dCas9 without endonuclease activity. The fusion protein may optionally further comprise a DNA-binding protein, such as DNMT3L, located at the N- or C-segment of the DNA methyltransferase; optionally, a KRAB domain located at the N- or C-segment of the Cas enzyme; optionally, a nuclear localization signal; and optionally, a marker for detection, such as a peptide epitope or a fluorescent protein. The domains or components of the fusion protein may or may not have linkers, such as XTEN80.

[0096] In one or more embodiments, the CRISPRoff system comprises a fusion protein or its expression vector, the fusion protein comprising, from the N-terminus to the C-terminus, DNMT3A, DNMT3L, XTEN80, dCas9, HA, NLS, BFP, and KRAB. An exemplary CRISPRoff plasmid was purchased from Addgene.

[0097] sgRNA is a guide RNA and an important component of the CRISPR gene knockout / knockin system. It consists of two parts: tracRNA and crRNA. When these two parts are fused and expressed, the sgRNA can effectively perform its guide function, binding to the Cas9 protein and guiding the Cas9 enzyme to target and cleave genomic DNA. In some embodiments, the sgRNA described herein has the sequences shown in SEQ ID NO:1, SEQ ID NO:2, and / or SEQ ID NO:3.

[0098] The kits of the present invention may include one or more associated reagents, along with instructions describing the intended use and proper use of these reagents. In some embodiments, the kit may include instructions regarding mixing one or more components of the kit and / or separating and mixing samples and administering them to a subject. In some embodiments, the reagents in the kit are pharmaceutical formulations and dosages suitable for a particular application and method of administration. Kits for research purposes may contain appropriate concentrations or amounts of components for performing various experiments.

[0099] The kit may be designed to facilitate use of the methods described herein and may take many forms. Where applicable, each composition of the kit may be provided in liquid form (e.g., in solution) or in solid form (e.g., dry powder). In some cases, some compositions may be constructible or additionally processable (e.g., processed into an active form), for example by adding a suitable solvent or other substance (e.g., water or cell culture medium), which may or may not be provided with the kit. In some embodiments, the compositions may be provided in a preservation solution (e.g., a cryopreservation solution). Non-limiting examples of preservation solutions include DMSO and paraformaldehyde. In some embodiments, the preservation solution contains a certain amount of a metalloproteinase inhibitor.

[0100] In some embodiments, the kit contains any one or more of the components described herein in one or more containers. Therefore, in some embodiments, the kit may include a container holding the reagents described herein. The reagents may be in liquid, gel, or solid (powder) form. The reagents may be aseptically prepared, packaged in syringes, and transported frozen. Alternatively, they may be contained in vials or other containers for storage. A second container may contain other aseptically prepared reagents. Alternatively, the kit may include premixed active agents and be transported in syringes, vials, tubes, or other containers. The kit may have one or more components required to administer the reagents to a subject, such as syringes, topical application devices, or IV needles and bags.

[0101] The present invention also provides a non-therapeutic method for reducing FANCB expression in cells in vitro, comprising an agent that increases the methylation level of the FANCB promoter region or a fragment thereof.

[0102] This invention also provides a method and reagents for increasing the sensitivity of ovarian cancer cells to platinum-based drugs and PARP inhibitors. The method primarily involves epigenetic editing of the FANCB promoter to alter the response of ovarian cancer cells to platinum-based drugs. This editing can be achieved using the specific epigenetic editing tool CRISPRoff.

[0103] Specifically, the method of the present invention includes the following steps: 1. Designing and synthesizing the epigenetic editing tool CRISPRoff. 2. Designing and synthesizing a guide RNA to direct the tool to perform specific editing of the FANCB promoter. 3. Introducing the tool and guide RNA into ovarian cancer cells to edit the FANCB promoter. 4. Verifying the editing effect and whether the edited ovarian cancer cells show increased sensitivity to platinum-based drugs through experimental methods.

[0104] Furthermore, this invention also provides a reagent for carrying out the above-described method. This reagent includes CRISPRoff, a tool for epigenetic editing, and guide RNA (gRNA) for directing the tool to edit the FANCB promoter. Using the method and reagent of this invention, the sensitivity of ovarian cancer cells to platinum-based drugs and PARP inhibitors can be effectively increased, thereby improving the efficacy of drug treatment for ovarian cancer.

[0105] This invention also provides the use of substances (including sgRNA and epigenetic editing reagents) that increase the methylation level of positions 14890192 to 14893191 or 14891454 to 14891530 in the FANCB promoter region of cells in the preparation of a drug for treating ovarian cancer or for improving the sensitivity of ovarian cancer cells to platinum-based drugs and / or PARP inhibitors. The ovarian cancer cells show upregulated FANCB expression or no significant change compared to the control, and the tumor cells show upregulated FANCB expression or no significant change compared to the control. The control can be a negative control commonly used in the art, such as FANCB expression in normal cells or tissues of the subject, FANCB expression in adjacent normal cells, or the average FANCB expression of a population. Ovarian cancer cells include A2780 cells, SKOV3, or OVCAR3. In the drug, sgRNA, epigenetic editing reagents, platinum-based drugs, and PARP inhibitors are all active ingredients.

[0106] "Platinum-based drugs" primarily refer to medications used to treat neoplastic diseases, including cisplatin, carboplatin, nedaplatin, oxaliplatin, and lobaplatin. In some embodiments, the platinum-based drug is cisplatin. "PARP inhibitors," also known as poly(ADP-ribose) polymerase inhibitors, can affect the self-replication of cancer cells. These include olaparib, niraparib, fluzoparib, and pamiparib. In some embodiments, the PARP inhibitor is olaparib.

[0107] The medicaments described in this invention also include pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients include, but are not limited to, diluents, carriers, solubilizers, emulsifiers, preservatives, and / or adjuvants. The excipients are preferably non-toxic to the recipient at the dosage and concentration used. Such excipients include (but are not limited to): saline, buffer solutions, glucose, water, glycerol, ethanol, and combinations thereof. In some embodiments, the pharmaceutical composition may contain substances for improving, maintaining, or retaining, for example, the composition's pH, permeability, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption, or permeation. These substances are known in the art. An optimal pharmaceutical composition may be determined based on the intended route of administration, delivery method, and required dosage.

[0108] Pharmaceutical compositions for internal administration are typically provided in sterile formulations. Sterilization is achieved by filtration through a sterile filter membrane. When the composition is lyophilized, sterilization can be performed using this method before or after lyophilization and rehydration. The pharmaceutical compositions of the present invention may be used for parenteral delivery. Compositions for parenteral administration may be lyophilized or stored in solution. They are prepared, for example, by conventional methods using physiological saline or aqueous solutions containing glucose and other excipients. Parenteral compositions are typically placed in containers with sterile access openings, such as intravenous solution bands or vials with stoppers puncturable by a hypodermic needle. Alternatively, the compositions may be used for inhalation or delivery via the digestive tract (e.g., orally). The preparation of the pharmaceutically acceptable compositions is within the scope of the art. Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations containing antibodies in sustained or controlled-release delivery formulations. Techniques for formulating a variety of other sustained or controlled delivery methods (such as liposome carriers, bioeasily perishable microparticles or porous beads, and accumulation injection) are also known to those skilled in the art.

[0109] Once formulated, the pharmaceutical composition is stored in sterile vials as a solution, suspension, gel, emulsion, solid, crystal, or as a dehydrated or lyophilized powder. The formulation may be stored in a ready-to-use form or rehydrated before administration (e.g., lyophilized). The present invention also provides kits for generating single-dose administration units. The kits of the present invention may each contain a first container with dried protein and a second container with an aqueous formulation. In some embodiments of the invention, kits containing single-lumen and multi-lumen pre-filled syringes (e.g., liquid syringes and lyophilized syringes) are provided.

[0110] This invention also provides a method for treating patients (particularly patients with ovarian cancer) by administering the reagents or pharmaceutical compositions described in any embodiment of the invention. In this document, the terms “patient,” “subject,” “individual,” and “object” are used interchangeably and include any living organism, preferably an animal, more preferably a mammal (e.g., rat, mouse, dog, cat, rabbit, etc.), and most preferably a human. “Treatment” refers to a subject employing the treatment regimen described herein to achieve at least one positive therapeutic effect (e.g., increasing the sensitivity of tumor cells to anticancer drugs, reducing tumor cell resistance). Effective treatment regimens for patients can vary depending on various factors, such as the patient's disease state, age, weight, and the ability of the therapy to elicit an anti-disease response in the subject.

[0111] The following specific embodiments further illustrate the invention. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise specified. Unless otherwise specified, percentages and parts are by weight. The experimental materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0112] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form preferred technical solutions.

[0113] Example

[0114] Materials and Methods

[0115] 1. Clinical Sample Collection

[0116] Seventy-two formalin-fixed paraffin-embedded (FFPE) ovarian cancer (OC) samples and 12 normal ovarian control samples were collected from Xiangya Hospital, School of Basic Medical Sciences, Central South University (Changsha, China). Among these, 42 samples of high-grade serous ovarian cancer (HGSOC) had matched peripheral blood samples available for HRD analysis. Our study received ethical approval from the local committee, and all participants provided written informed consent.

[0117] 2. HRD Score Calculation

[0118] According to the article (Marquard AM, Eklund AC, Joshi T, et al. Biomark Res.2015;3:9. doi:10.1186 / s40364-015-0033-4), genomic scar features were calculated using the R program to determine the HRD score. The calculation included determining scores for telomere allelic imbalance (TAI), large-scale variation (LST), and loss of heterozygosity (LOH). TAI indicates an allelic imbalance region extending into the telomere, LOH indicates a chromosomal LOH region longer than 15 Mb, and LST refers to the breakpoint between regions longer than 10 Mb after filtering out regions shorter than 3 Mb. The HRD score was calculated by summing the TAI, LST, and LOH scores.

[0119] 3. Bisulfite amplicon sequencing (BSAS)

[0120] Genomic DNA was extracted from normal ovarian tissue samples and ovarian cancer cell samples using the High Pure PCR Template Preparation Kit (Roch, 11796828001) following the manufacturer's instructions. Genomic DNA was extracted from FFPE samples of ovarian cancer tissue using the GeneRead™ DNA FFPE Kit (QIAGEN, 180134) following the manufacturer's instructions. DNA methylation levels of candidate genes were assessed by bisulfite amplification and next-generation sequencing (NGS). Specifically, 10 ng of genomic DNA was bisulfite-converted using the EZ DNA Methylation-Lightning Kit (Zymo Research, USA). Subsequently, target sequences were amplified by PCR, and second-generation sequencing libraries were constructed using the TaKaRa EX Taq Hotstart Kit (China). Methylation-independent PCR / MIP primers were designed using MethPrimer 2.0 software. The primer sequences for detecting the methylation level of the FANCB promoter are as follows: forward primer (SEQ ID NO:4): 5'-TTTAGAGGTAGATAGAGAAGGGTGG-3', reverse primer (SEQ ID NO:5): 5'-AAACCTAAACTAAAAACCTAATCCC-3'.

[0121] The quality of the sequencing data was validated using the FastQC software package on the NGS HiSeq platform (Illumina, Inc.). Aptamer removal and quality trimming were performed using Cutadapt v1.9.1, and the reads were aligned to the reference genome (UCSC hg19) using Bismark. The methylation level of individual cytosines was determined using the R software package MethylKit v1.26.0.

[0122] 4. Plasmid construction

[0123] The CRISPRoff plasmid was purchased from Addgene (Addgene #167981). The sgRNA plasmid was generated by restriction cloning of the protospacer downstream of the U6 promoter using the BsmBI splice site in the pLentiGuide-puro plasmid. Notably, the CRISPRoff plasmid also expresses a blue fluorescent protein (BFP) marker to facilitate the measurement of transfection efficiency. The sgRNA sequences targeting the FANCB promoter are as follows: (SEQ ID NO:1) 5'-CATTGGATTGGGCGGTGCGG-3' targeting chromosome X coordinate 14891494, (SEQ ID NO:2) 5'-TTCGATTCTCGTCTGGCCTC-3' targeting chromosome X coordinate 14891429, and (SEQ ID NO:3) 5'-CCCTAGAGAGCTCGCGGGCT-3' targeting chromosome X coordinate 14891330.

[0124] 5. Cell Culture and Drug Treatment

[0125] Four human cell lines—A2780, SKOV3, OVCAR3, and 293T cells—were cultured. 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM), while the OC cell lines A2780 and OVCAR3 were cultured in RPMI-1640 medium, and the OC cell line SKOV3 was cultured in McCoy's 5A medium. These cell cultures were supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S) antibiotics. Culture conditions included maintaining cells at 37°C and ensuring appropriate humidity in an environment containing 5% CO2. When cells reached 70%–90% confluence, transfection experiments were performed in 24-well plates in Opti-MEM medium using 300 ng of CRISPRoff plasmid and 150 ng of sgRNA-encoding plasmid, combined with Lipofectamine 3000 (Thermo Fisher Scientific, USA).

[0126] 6. Identification of transcriptional activity

[0127] The pCpGL-basic vector was obtained from Shanghai Medical College of Fudan University, and the pRL vector was preserved in the laboratory. Primers with three FANCB promoter regions containing HindIII and BamHI restriction sites were designed using Primer5 software. The primer sequences are as follows: forward primer (SEQ ID NO:6): 5'-CGCGGATCCCACCGTCGTGGATGTGATTGC-3', reverse primer (SEQ ID NO:7): 5'-CCCAAGCTTTGGAAGGATACTGAAGGGATG-3'. The vector and primers were digested with the above enzymes and then ligated with T4 ligase. The plasmid was methylated in vitro using CpG methyltransferase M.Sss I (NEB), and the methylation level of the constructed plasmid was detected using the methylation-sensitive restriction endonuclease HpaII. 293T cells were seeded in 96-well plates. After 24 hours, methylated / unmethylated pCpGL-FANCB-promoter and pRL vector were co-transfected with Lipofectamine 3000. The effect of methylation on the transcriptional activity of the target gene promoter was detected using a dual-luciferase reporter gene assay kit (Yisheng). The specific operation was performed according to the instructions.

[0128] 7. Real-time quantitative polymerase chain reaction

[0129] Total RNA was extracted from cultured cells and tissue samples using TRIzol reagent (Sigma, USA). Reverse transcription of mRNA was performed using the PrimeScriptRT kit (TaKaRa, China) with a mixture of oligo-dT and random primers. qPCR was performed using the standard three-step amplification protocol of SYBR Premix Ex Taq™ (TaKaRa, China). qPCR reactions were performed using a CFX96 Real-Time PCR instrument (Bio-Rad, USA) and SYBR Green PCR Mixture (TaKaRa, China). Changes were calculated using the comparative Cq method. Amplification conditions were 60°C for 60 min, followed by 95°C for 5 min, 95°C for 15 sec, and 60°C for 1 min, for 45 PCR cycles. FANCB primers: forward 5'-CGGGAATTACGGCAGCATCT-3' (SEQ ID NO:8), reverse 5'-TGCTGGGAAAGGATTTGTAC-3' (SEQ ID NO:9); β-actin primers: forward 5'-AGCGAGCATCCCCCAAAGTT-3' (SEQ ID NO:10), reverse 5'-GGGCACGAAGGCTCATCATT-3' (SEQ ID NO:11).

[0130] 8. Cell proliferation assay

[0131] Twenty-four hours before transfection, A2780, SKOV3, and OVCAR3 cells were seeded into 6-well plates to achieve 70%-90% confluency. Simultaneously, methylation-editing plasmids pLentiGuide-puro-FANCB (500 ng / well) and CRISPRoff (500 ng / well) were transfected. Plasmids without editing function served as controls. Cells were harvested 24 hours after transfection, and A2780, SKOV3, and OVCAR3 cells were seeded at 2 × 10⁶ cells / well. 4 1, 2 × 10 4 The sum of 4 × 10 3 Cells were seeded at a density of [number] cells / well in 96-well plates. After 24 hours of culture, cisplatin (DDP) (0.75 μg / ml) (Sigma, USA) and olaparib (A2780 10 μM, SKOV3 100 μM, and OVCAR3 200 μM) (MedChemExpress, USA) were added for drug sensitivity testing. 10 μl of cell counting reagent (DOJINDO, China) was added on days 0, 1, 2, 3, and 4 after drug administration. After 2 hours of culture, the optical density (OD450) at 450 nm was measured to analyze cell proliferation.

[0132] 9. Cloning experiments

[0133] Twenty-four hours after plating A2780, SKOV3, and OVCAR3 plasmids, cells were simultaneously transfected with pLentiGuide-puro-FANCB (500 ng / well) and CRISPRoff (500 ng / well), with a non-editing plasmid serving as a control. Twenty-four hours after transfection, cells were trypsinized, counted to 1000 cells, and seeded into 6-well plates. Cells were cultured for 14 days, with fresh medium changed every two days. After colony formation, cells were fixed with 4% paraformaldehyde for 15-30 minutes, washed with PBS, stained with crystal violet, and photographed for cell counting.

[0134] 10. Scratch test

[0135] Twenty-four hours after plating A2780, SKOV3, and OVCAR3, cells were simultaneously transfected with pLentiGuide-puro-FANCB (500 ng / well) and CRISPRoff (500 ng / well), with a non-editing plasmid serving as a control. Scratches were created 24 hours after transfection, and images were taken on the day of the scratch and the following day. Cell migration distance was measured using ImageJ software.

[0136] 11. Apoptosis detection

[0137] After trypsin digestion of adherent cells with EDTA-free trypsin, cells were collected by centrifugation at 300×g for 5 minutes at 4°C. Apoptosis rate was determined using a cell cycle and apoptosis assay kit (Yeasen, China). Specifically, cells were washed twice with pre-cooled PBS. Approximately 1-5 × 10⁶ cells were collected. 5 Cells were collected. PBS was removed, and cells were resuspended in 100 μl binding buffer. 5 μl Annexin V-FITC and 10 μl PI staining solution were added and gently mixed. The mixture was incubated in the dark at room temperature for 10–15 minutes. 400 μl binding buffer was added and thoroughly mixed. The sample was placed on ice and analyzed by flow cytometry within 1 hour.

[0138] Example 1: Significant changes in FANCB promoter methylation were observed in clinical samples from ovarian cancer.

[0139] The inventors detected DNA methylation levels in the FANCB promoter region of normal ovarian tissue samples and ovarian cancer tissue samples from healthy ovarian individuals. The TSS site of the FANCB gene is located at chrX.14891191, and the detection region is 300 bp upstream of the TSS site, with a fragment length of 137 bp. This region is part of a CpG island containing 12 CpG sites. The results showed significant differences in methylation at multiple sites in the detected fragment of the FANCB promoter region. Figure 1 A comparison of the average methylation levels at 12 sites in the target fragment revealed that the FANCB promoter methylation level in ovarian cancer tissue was significantly lower than that in normal ovarian tissue. Furthermore, the methylation levels at multiple sites in this region were significantly lower in ovarian cancer tissue compared to normal ovarian tissue, with a 20.01% decrease at Chr.X 14891516 (p<0.001, see...). Figure 1 The Chr.X 14891509 site decreased by 17.16% (p<0.01, see...). Figure 1 The Chr.X 14891493 site decreased by 20.16% (p<0.01, see...). Figure 1 These results indicate that the methylation status of the target fragment of the FANCB gene has the potential to be applied clinically to ovarian cancer screening.

[0140] The inventors also detected the DNA methylation level of the FANCB gene target region in 11 FFPE samples from the primary ovarian cancer group and 14 FFPE samples from the recurrent ovarian cancer group. The results showed that the average methylation level of the FANCB promoter target region in recurrent ovarian cancer tissue (19.96%) was significantly lower than that in primary ovarian cancer tissue (31.34%). Figure 2Furthermore, the methylation levels of recurrent ovarian cancer tissue at multiple sites in this region were significantly lower than those of primary ovarian cancer tissue, with a 20.85% decrease at Chr.X14891530 site (p<0.01, see...). Figure 2 The Chr.X 14891454 site decreased by 14.36% (p<0.05, see...). Figure 2 These results indicate that the methylation status of the target fragment of the FANCB gene has the potential to serve as an indicator for ovarian cancer recurrence.

[0141] Example 2: FANCB promoter methylation is associated with homologous recombination defects.

[0142] HRD (human ovarian cancer) leads to defects in the repair pathway of DNA double-strand breaks, resulting in high sensitivity to platinum-based chemotherapy drugs and PARP inhibitors. Therefore, HRD has become a key biomarker for ovarian cancer treatment. This study analyzed the correlation between FANCB promoter methylation and HRD score using 42 clinical ovarian cancer samples with HRD scores, predicting the methylation status of the target fragment of the FANCB gene as an indicator of HRD score and platinum sensitivity in clinical ovarian cancer. Comparison of FANCB promoter methylation levels between HRD-positive (HRD score ≥ 42) and HRD-negative (HRD score < 42) ovarian cancer samples showed significantly higher methylation in HRD-positive samples. Figure 3 ).

[0143] Furthermore, the inventors also observed a significant positive correlation between methylation at multiple sites of the FANCB promoter and HRD scores. Figure 4 (p<0.05). These results further indicate that the methylation level of the FANCB promoter is associated with homologous recombination defects and may affect survival time through different responses to treatment, such as drug resistance. This suggests that the methylation status of the target fragment of the FANCB gene has the potential to serve as an indicator for clinical ovarian cancer HRD score and platinum sensitivity / resistance.

[0144] Example 3: FANCB gene promoter methylation regulates gene expression

[0145] The effect of FANCB promoter methylation on transcriptional activity was detected using a dual-luciferase reporter gene assay. The results showed that the transcriptional activity of the methylated promoter was only 32% of that of the unmethylated promoter. Figure 5 This indicates that the expression of the FANCB gene is directly regulated by its promoter methylation.

[0146] Example 4: Design and Validation of an Epigenetic Editor for the FANCB Promoter

[0147] The epigenetic editing plasmid CRISPRoff (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-BFP-KRAB) enhances DNA methylation while reducing histone modifications (such as H3K27ac). The inventors designed three sgRNAs (targeting chromosome X coordinates 14891494, 14891429, and 14891330, respectively), focusing particularly on the FANCB TSS region, and then constructed the pLentiGuide-puro-FANCB plasmid for precise site-specific epigenetic modification. Figure 6 ).

[0148] The inventors simultaneously transfected CRISPRoff plasmid and pLentiGuide-puro plasmid into 293T, A2780, SKOV3, and OVCAR3 cells. Forty-eight hours after transfection, the DNA methylation level within a total of 400 bp upstream and downstream of the sgRNA binding site was significantly increased in these cells. Figure 7 DNA methylation editing was significantly effective, with most CG cells showing an increase of 20-40% in 293T, A2780, and OVCAR3 cells, while the methylation level of most CG cells in SKOV3 cells increased by 10%-20%.

[0149] Cells collected 48 hours after methylation editing were used to detect FANCB expression levels. qPCR results showed that methylation editing had a good silencing effect on FANCB gene expression in different cell types. Figure 8 The silencing effect was best for 293T cells, reaching approximately 70%, while the silencing effects for A2780, SKOV3, and OVCAR3 were around 30%. These findings confirm that epigenetic editing can effectively suppress FANCB expression in ovarian cancer.

[0150] Example 5: FANCB epigenetic editing affects cell proliferation

[0151] To conduct drug sensitivity testing, A2780, SKOV3, and OVCAR3 cells were epigenetically edited with FANCB for 48 hours. A2780 cells were treated with 0.75 μg / ml DDP and 10 μM Olaparib for 4 days; SKOV3 cells were treated with 0.75 μg / ml DDP or 100 μM Olaparib for 4 days; and OVCAR3 cells were treated with 0.75 μg / ml DDP or 200 μM Olaparib for 4 days. Cell counting showed that the proliferation of A2780, SKOV3, and OVCAR3 cells was significantly slowed after epigenetic editing treatment. Figure 9Compared with the control group, the number of cells decreased by 5.8%, 42.5%, and 33.3% on day 4 after DDP treatment, while the number of cells decreased by 11.6%, 42.8%, and 20.4% in the Olaparib treatment group. Figure 9 ).

[0152] The above results indicate that FANCB epigenetic editing suppressed gene expression, leading to a significant increase in cellular sensitivity to platinum-based drugs and PARPi. Compared with the unedited control group, the number of A2780 and SKOV3 cells in the epigenetic editing group decreased by 27.8%, 48.2%, and 31.8% on day 4, respectively, which was also significantly lower than that in the control group. Figure 9 This result suggests that FANCB epigenetic editing may increase drug sensitivity by inhibiting OC cell proliferation.

[0153] Example 6: FANCB epigenetic editing affects cell cloning ability

[0154] After 48 hours of FANCB epigenetic editing, A2780, SKOV3, and OVCAR3 cells were counted and reseeded into 6-well plates. Cells were treated with 0.75 μg / ml DDP, and the culture medium was changed every two days. After 14 days, the cells were fixed with 4% paraformaldehyde, stained with crystal violet, and photographed for cell counting (e.g., ...). Figure 10 ).

[0155] The results showed that the cloning ability of A2780, SKOV3, and OVCAR3 cells was significantly reduced after FANCB epigenetic editing treatment. Figure 10 Compared with the control group, the number of edited clones decreased by 54.9%, 19.2%, and 11.7%, respectively, while after DDP treatment, the number of edited clones decreased by 70.7%, 59.8%, and 30.0%, respectively. Figure 10 This indicates that epigenetic editing of the FANCB gene promoter can significantly reduce the clonal ability of various ovarian cancer cells and significantly increase the drug sensitivity of ovarian cancer cells to DDP, achieving a sensitization effect.

[0156] Example 7: FANCB epigenetic editing affects OC cell migration ability

[0157] FANCB epigenetic editing of A2780, SKOV3, and OVCAR3 cells resulted in scratching 48 hours later, followed by administration of 0.75 μg / ml DDP. Images were taken on the day of scratching (0 h) and the second day (24 h). Figure 11ImageJ analysis showed that the migration ability of these three OC cell lines after FANCB epigenetic editing was significantly reduced compared to the control group. At 24 h, the scratch distances of edited A2780, SKOV3, and OVCAR3 cells were 347.1 μm, 359.0 μm, and 283.9 μm, respectively, representing reductions of 19.8%, 5.0%, and 35.3% compared to the control group. At 24 h of DDP treatment, the scratch distances of edited A2780, SKOV3, and OVCAR3 cells were 229.9 μm, 251.3 μm, and 242.4 μm, respectively, representing reductions of 36.9%, 30.3%, and 31.7% compared to the control group. Figure 11 This indicates that epigenetic editing of the FANCB gene promoter can significantly reduce the migration ability of various ovarian cancer cells, and that when used in combination with DDP, it can significantly enhance the inhibitory effect of DDP on the migration of ovarian cancer cells and increase the drug sensitivity of ovarian cancer cells to DDP, thus achieving a sensitization effect.

[0158] Example 8: FANCB epigenetic editing affects OC cell apoptosis

[0159] The inventors analyzed the apoptosis of cells after drug treatment. Figure 12 Under DDP treatment, the apoptosis rate of A2780, SKOV3, and OVCAR3 cells epigenetically edited with the FANCB promoter was significantly higher than that of unedited cells. Even without drug treatment, epigenetically edited cells still exhibited a higher apoptosis rate. Figure 12 This result suggests that epigenetic editing of the FANCB promoter may increase drug sensitivity by promoting apoptosis.

[0160] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this invention, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

[0161] Partial sequence of this article: SEQ ID NO:1: sgRNA targeting the FANCB promoter (targeting chromosome X coordinate 14891494) CATTGGATTGGGCGGTGCGG SEQ ID NO:2: sgRNA targeting the FANCB promoter (targeting chromosome X coordinate 14891429) TTCGATTCTCGTCTGGCCTC SEQ ID NO:3: sgRNA targeting the FANCB promoter (targeting chromosome X coordinate 14891330) CCCTAGAGAGCTCGCGGGCT SEQ ID NO:4: FANCB promoter methylation level detection primers - forward primer TTTAGAGGTAGATAGAGAAGGGTGG SEQ ID NO:5: FANCB promoter methylation level detection primer-reverse primer AAACCTAAACTAAAAACCTAATCCC SEQ ID NO:6: FANCB promoter region primers - forward primers CGCGGATCCCACCGTCGTGGATGTGATTGC SEQ ID NO:7: FANCB promoter region primer-reverse primer CCCAAGCTTTGGAAGGATACTGAAGGGATG SEQ ID NO:8: FANCB primer - forward CGGGAATTACGGCAGCATCT SEQ ID NO:9: FANCB primer-reverse TGCTGGGAAAGGATTTGTAC SEQ ID NO:10: β-actin primer-reverse AGCGAGCATCCCCCAAAGTT SEQ ID NO:11: β-actin primer-reverse GGGCACGAAGGCTCATCATT SEQ ID NO:12: FANCB promoter region > X dna:chromosome chromosome:GRCh37:X:14890192:14893191:-1

Claims

1. Use of an agent that inhibits the expression of the FANCB gene in the preparation of a pharmaceutical composition for the treatment of cancer, the enhancement of the efficacy of an anticancer drug, the enhancement of the sensitivity of tumor cells to an anticancer drug, and / or the reduction of drug resistance of tumor cells, wherein, the anticancer drug is a chemotherapeutic drug and / or a PARP inhibitor, the agent for inhibiting the expression of the FANCB gene is an agent for increasing the methylation level of the FANCB promoter region or a fragment thereof, preferably, the chemotherapeutic drug is a platinum drug, and / or the FANCB promoter region is a region from 2000 bp upstream to 1000 bp downstream of the transcription start site, preferably, the cancer is ovarian cancer, and the tumor cell is an ovarian cancer cell.

2. Use according to claim 1, characterized in that, the FANCB promoter region is from position 14890192 to position 14893191 of the human X chromosome, preferably, the fragment of the FANCB promoter region comprises one or more sequences selected from the group consisting of: (1) a 20-800 bp fragment of the FANCB promoter region containing 14891494, (2) a 20-800 bp fragment of the FANCB promoter region containing 14891429, (3) a 20-800 bp fragment of the FANCB promoter region containing 14891330, preferably, the fragment of the FANCB promoter region is a fragment containing position 14891454 to position 14891530 of the FANCB promoter region from position 14890192 to position 14893191 of the human X chromosome, preferably, increasing the methylation level of the FANCB promoter region or a fragment thereof refers to increasing the average methylation level of any one or more or all CG dinucleotides in the sequence from position 14891454 to position 14891530 of the human X chromosome.

3. Use according to claim 1, characterized in that, the agent for increasing the methylation level of the FANCB promoter region or a fragment thereof comprises: (1) an sgRNA or a complementary sequence thereof, or (2) a nucleic acid construct containing the sgRNA or the complementary sequence thereof, preferably, the sgRNA has a sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2 and / or SEQ ID NO: 3 or a variant having at least 80% sequence identity thereto, and / or preferably, the agent further comprises an epigenetic editing agent, more preferably, the epigenetic editing agent comprises a DNA methyltransferase or an expression vector thereof, and / or a Cas enzyme or an expression vector thereof.

4. Use according to claim 3, characterized in that, the epigenetic editing agent comprises a fusion protein or an expression vector thereof, the fusion protein comprising: (1) a DNA methyltransferase, such as DNMT1, DNMT2, DNMT3A or DNMT3B, (2) a Cas enzyme, such as Cas9, optionally further comprising a DNA binding protein located in the N segment or C segment of the DNA methyltransferase, optionally further comprising a KRAB domain located in the N segment or C segment of the Cas enzyme, optionally further comprising a nuclear localization signal, optionally further comprising a marker for detection, such as a peptide chain epitope, a fluorescent protein; preferably, the fusion protein comprises, in order from N terminus to C terminus: dCas9, KRAB domain, dCas9, DNMT3A, DNMT3L, KRAB domain, dCas9, DNMT3A, DNMT3L, or dCas9, DNMT3A, DNMT3L, KRAB domain.

5. Use of an agent that inhibits the expression of the FANCB gene and an anticancer drug for the manufacture of a pharmaceutical composition for the treatment of cancer, wherein, The reagent, anticancer drug, and cancer inhibitor that inhibit FANCB gene expression are described in any one of claims 1-4.

6. A non-therapeutic method of reducing FANCB expression in a cell in vitro comprising increasing the methylation level of the FANCB promoter region or a fragment thereof, wherein, The FANCB promoter region is located at positions 14890192 to 14893191 of the human X chromosome. Preferably, the fragment of the FANCB promoter region comprises one or more sequences selected from the following: (1) a 20-800 bp fragment of the FANCB promoter region containing 14891494, (2) a 20-800 bp fragment of the FANCB promoter region containing 14891429, (3) a 20-800 bp fragment of the FANCB promoter region containing 14891330. Preferably, the segment of the FANCB promoter region is a segment from positions 14893191 to 14890192 on the human X chromosome, containing positions 14891454 to 14891530. Preferably, increasing the methylation level of the FANCB promoter region or its fragments refers to increasing the average methylation level of any one or more or all CG dinucleotides in the sequence from position 14891454 to position 14891530 of the human X chromosome.

7. A kit or composition comprising (1) sgRNA or its complementary sequence, or a nucleic acid construct containing said sgRNA or its complementary sequence, and (2) an epigenetic editing reagent. Preferably, The nucleic acid construct is the sgRNA or its complementary sequence, or a cloning vector or expression vector, and / or The sgRNA has a sequence as shown in SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:3 or a variant having at least 80% sequence identity with it, and / or The epigenetic editing reagent comprises a DNA methyltransferase or its expression vector, and / or a Cas enzyme or its expression vector.

8. The kit or composition of claim 7, wherein The epigenetic editing reagent comprises a fusion protein or its expression vector, the fusion protein comprising: (1) DNA methyltransferases, such as DNMT1, DNMT2, DNMT3A, or DNMT3B, (2) Cas enzymes, such as Cas9, Optionally, it may also contain DNA-binding proteins located in the N- or C-segment of DNA methyltransferases. Optionally, it may also include a KRAB domain located in the N or C segment of the Cas enzyme. The optional component also includes nuclear positioning signals. Optional features also include markers for detection; Preferably, the fusion protein comprises, from the N-terminus to the C-terminus, the following: dCas9, KRAB structural domains dCas9, DNMT3A, DNMT3L, KRAB structural domain, dCas9, DNMT3A, DNMT3L, or dCas9, DNMT3A, DNMT3L, KRAB structural domains.

9. Use of an agent for detecting the methylation level of the FANCB promoter region or a fragment thereof in the manufacture of a kit for diagnosing and / or treating cancer, increasing the sensitivity of tumor cells to anticancer drugs, and / or reducing the drug resistance of tumor cells, wherein, The FANCB promoter region is located at positions 14890192 to 14893191 of the human X chromosome. Preferably, the fragment of the FANCB promoter region comprises one or more sequences selected from the following: (1) a 20-800 bp fragment of the FANCB promoter region containing 14891494, (2) a 20-800 bp fragment of the FANCB promoter region containing 14891429, (3) a 20-800 bp fragment of the FANCB promoter region containing 14891330. Preferably, the segment of the FANCB promoter region is a segment from positions 14890192 to 14893191 on the human X chromosome, containing positions 14891454 to 14891530. Preferably, the cancer is ovarian cancer, and the tumor cells are ovarian cancer cells.

10. An sgRNA targeting the FANCB promoter region having a sequence as shown in SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:3 or a variant having at least 80% sequence identity with it.

Images