Application of reagents for detecting lncRNA-NONHSAT178169.1 expression levels

The reagent for detecting the expression level of lncRNA-NONHSAT178169.1 has solved the problem of HBV-specific T cell function decline in patients with chronic hepatitis B, enabling the upgrading of precise staging and treatment strategies for CHB patients, and providing a new target for assessing T cell functional status.

CN122081484APending Publication Date: 2026-05-26QUAN ZHOU SHI DI YI YI YUAN
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
QUAN ZHOU SHI DI YI YI YUAN
Filing Date
2026-04-13
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing technologies are unable to effectively eliminate the HBV-specific T cell dysfunction in patients with chronic hepatitis B (CHB), resulting in limited efficacy of immunotherapy. Furthermore, existing nucleotide analogs are unable to achieve HBsAg loss, limiting the progress towards functional cure.

Method used

By using reagents to detect the expression level of lncRNA-NONHSAT178169.1, and employing lncRNA-NONHSAT178169.1 antibodies, specific probes, or primer pairs in conjunction with PCR amplification systems, the staging of chronic hepatitis B, especially the immune tolerance phase, can be predicted or diagnosed. This provides a new target for assessing T cell functional status.

Benefits of technology

It can specifically and sensitively predict or diagnose the immune tolerance phase of chronic hepatitis B, providing a new target for assessing T cell functional status and helping to achieve precise staging and upgrade treatment strategies for CHB patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122081484A_ABST
    Figure CN122081484A_ABST
Patent Text Reader

Abstract

This invention provides an application of a reagent for detecting the expression level of lncRNA-NONHSAT178169.1, belonging to the field of biomedical technology. Research results showed significant differences in BTLA expression in peripheral blood T cells of CHB patients at different stages, with the highest expression in the IT phase, and CD8 expression... + T-cell differential expression was more pronounced. RNA-seq identified 29 differentially expressed lncRNAs, among which lncRNA-NONHSAT178169.1 was continuously downregulated under αBTLA treatment and validated by qPCR. Detection of lncRNA-NONHSAT178169.1 expression levels in test samples can specifically and sensitively predict or diagnose the immune tolerance phase of chronic hepatitis B. lncRNA-NONHSAT178169.1 provides more targets for predicting or diagnosing the immune tolerance phase of chronic hepatitis B.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to the application of a reagent for detecting the expression level of lncRNA-NONHSAT178169.1. Background Technology

[0002] Chronic hepatitis B (CHB) remains a significant global infectious disease burden. Progress reports on elimination also indicate that complications such as CHB-related cirrhosis and hepatocellular carcinoma continue to contribute significantly to the mortality burden. Currently, first-line nucleoside (nucleotide) analogs (NAs) can effectively inhibit viral replication, but due to the difficulty in directly clearing or silencing cccDNA and integrated DNA, overall HBsAg loss remains difficult to achieve, limiting progress towards functional cure.

[0003] One of the core immunological characteristics of CHB is the gradual functional decline of HBV-specific T cells under continuous antigen exposure, manifested as decreased cytotoxicity and cytokine secretion, restricted proliferation, and "exhaustion-like" changes such as the upregulation of multiple inhibitory receptors. This exhaustion state is closely related to extensive remodeling of signal transduction, metabolic adaptation, and transcriptional programs. In the inflammatory microenvironment of CHB liver, multiple inhibitory mechanisms overlap and run concurrently, and HBV-specific T cells exhibit significant heterogeneity, making it difficult for them to regain effective clearance capabilities. Therefore, elucidating the coupling mechanism between "immune checkpoint signals—transcriptional programs—metabolic adaptation" is a crucial scientific issue for advancing CHB immunotherapy strategies.

[0004] BTLA (B and T lymphocyte attenuator) and its HVEM axis have been considered as important inhibitory pathways besides PD-1 in recent years. Clinical studies suggest that BTLA can be upregulated in hepatic and peripheral T cells of chronic hepatitis B (CHB) and participate in functional regulation. Its intracellular signaling can inhibit TCR / CD28 signaling through phosphatase modules such as SHP1 / SHP2. Meanwhile, lipid uptake and utilization (such as exogenous lipid uptake mediated by the FABP family) can affect the survival and function of specific T cell subsets; lncRNAs can translate receptor signals into more stable transcriptional / epigenetic output; the immediate early gene FOS / AP-1 axis is at a critical node of T cell activation, and its imbalance under chronic stimulation can drive exhaustion-like programs. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide an application of a reagent for detecting the expression level of lncRNA-NONHSAT178169.1.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a reagent for detecting the expression level of lncRNA-NONHSAT178169.1 in the preparation of products for predicting or diagnosing the staging of chronic hepatitis B.

[0007] Preferably, the stage is the immune tolerance stage.

[0008] Preferably, the reagent for detecting the expression level of lncRNA-NONHSAT178169.1 includes an antibody against lncRNA-NONHSAT178169.1, a specific probe, or a primer pair.

[0009] Preferably, the nucleotide sequences of the primer pair are shown in SEQ ID NO.1~SEQ ID NO.2.

[0010] Preferably, the product includes one or more of a reagent kit, a test strip, and a gene chip.

[0011] Preferably, the kit also includes a PCR amplification system.

[0012] This invention provides a system for predicting or diagnosing the staging of chronic hepatitis B, comprising a data processing device and a detection device, wherein the detection device is used to detect the expression level of lncRNA-NONHSAT178169.1 in test samples and control samples.

[0013] Preferably, the control samples are samples from the immune clearance phase of chronic hepatitis B, samples from the inactive phase of chronic hepatitis B, and samples from the reactivation phase of chronic hepatitis B.

[0014] Preferably, the data processing device includes a conclusion output module. If the expression level of lncRNA-NONHSAT178169.1 in the test sample is significantly lower than that in the positive sample, the test sample is predicted or diagnosed as being in the immune tolerance phase of chronic hepatitis B.

[0015] Preferably, the sample to be tested includes peripheral blood.

[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of a reagent for detecting the expression level of lncRNA-NONHSAT178169.1. The study results showed significant differences in BTLA expression in peripheral blood T cells of CHB patients at different stages, with the highest expression in the IT phase, and CD8 expression was also observed. +T-cell differential expression was more pronounced. RNA-seq identified 29 differentially expressed lncRNAs, among which lncRNA-NONHSAT178169.1 was continuously downregulated under αBTLA treatment and validated by qPCR. Detection of lncRNA-NONHSAT178169.1 expression levels in test samples can specifically and sensitively predict or diagnose the immune tolerance phase of chronic hepatitis B. lncRNA-NONHSAT178169.1 provides a novel target for predicting or diagnosing the immune tolerance phase of chronic hepatitis B. Attached Figure Description

[0017] Figure 1 The expression of BTLA in different CHB natural history stages is shown on the left, with CD4 counts for patients at different stages on the right. + Comparison of BTLA molecule expression levels on T lymphocytes, with the right side showing CD8 expression levels in patients at different stages. + Comparison of BTLA molecule expression levels on T lymphocytes.

[0018] Figure 2 The results of BTLA-related lncRNA screening and qPCR validation are shown in Figure A (Venn plot comparing differentially expressed lncRNAs); Figure B (heatmap of differentially expressed lncRNAs, where red indicates upregulation and blue indicates downregulation); Figure C (expression changes of lncRNA-NONHSAT178169.1 at different dose gradients (n=4 per group); and Figure D (expression changes of lncRNA-NONHSAT178169.1 at different time gradients (n=4 per group).

[0019] Figure 3 The results of BTLA-FLAG immunoprecipitation-mass spectrometry identification of interacting proteins and RPISeq prediction are shown in Figure A. Western blot shows successful BTLA-FLAG precipitation; B. Mass spectrometry relative abundance comparison; C. RPISeq prediction of the interaction probability between FABP5 and DSP and lncRNA-NONHSAT178169.1.

[0020] Figure 4 For the prediction and expression analysis of lncRNA-NONHSAT178169.1 related transcription factors, A is a Venn diagram comparing differentially expressed transcription factors; B is a heatmap of differential expression of transcription factors; C is a regulatory network (green squares represent lncRNAs; blue triangles represent transcription factors; red circles represent target genes); D is the change in expression of FOS, ATF3, and MAFF mRNA under different dose gradients (n=4 per group); E is the change in expression of FOS, ATF3, and MAFF mRNA under different time gradients (n=4 per group).

[0021] Figure 5 This is a schematic diagram of the working model.

[0022] Figure 6 Comparison of lncRNA-NONHSAT178169.1 expression levels in samples from different groups.

[0023] Figure 7 ROC curves were used to differentiate between the tolerant and non-tolerant phases of chronic hepatitis B by detecting the expression level of lncRNA-NONHSAT178169.1. Detailed Implementation

[0024] This invention provides a reagent for detecting the expression level of lncRNA-NONHSAT178169.1 in the preparation of products for predicting or diagnosing the staging of chronic hepatitis B.

[0025] This invention describes the expression characteristics of BTLA in peripheral T cells at different natural history stages of CHB, and proposes, in conjunction with transcriptomics and interactionomics, that the lncRNA-NONHSAT178169.1 / FOS module is associated with BTLA-related repression processes.

[0026] In this invention, the stage refers to the immune tolerance phase. lncRNA-NONHSAT178169.1 refers to a human long non-coding RNA transcript indexed and annotated in the NONCODE database, numbered NONHSAT178169.1. The reagents for detecting the expression level of lncRNA-NONHSAT178169.1 include an antibody against lncRNA-NONHSAT178169.1, a specific probe, or a primer pair. The nucleotide sequences of the primer pairs are shown in SEQ ID NO.1~SEQ ID NO.2. The primer pairs of this invention can specifically amplify lncRNA-NONHSAT178169.1. The product includes one or more of a kit, test strip, and gene chip. The kit preferably includes a PCR amplification system. The kit also includes control samples, which are peripheral blood samples from the immune clearance phase of chronic hepatitis B, the inactive phase of chronic hepatitis B, and the reactivation phase of chronic hepatitis B. The PCR amplification system consisted of: 10 μL of 2×SuperReal PreMix Plus, 0.6 μL of 10 μM upstream primer, 0.6 μL of 10 μM downstream primer, 0.4 μL of 50×ROXReference Dye, 1 μL of cDNA template, and 7.4 μL of RNase-Free ddH2O. The PCR amplification program was 95℃ pre-denaturation for 15 min, followed by 40 cycles at 95℃ for 10 s and 60℃ for 20 s. When the expression level of lncRNA-NONHSAT178169.1 in the test sample was significantly lower than that in samples from the immune clearance phase of chronic hepatitis B, the inactive phase of chronic hepatitis B, and the reactivation phase of chronic hepatitis B, it suggested that the individual in the test sample was in the immune tolerance phase of chronic hepatitis B, or that the test sample had the potential to be predicted or used for auxiliary diagnosis of the immune tolerance phase of chronic hepatitis B.

[0027] This invention provides a system for predicting or diagnosing the staging of chronic hepatitis B, comprising a data processing device and a detection device, wherein the detection device is used to detect the expression level of lncRNA-NONHSAT178169.1 in test samples and control samples.

[0028] In this invention, the control samples are samples from the immune clearance phase of chronic hepatitis B, samples from the inactive phase of chronic hepatitis B, and samples from the reactivation phase of chronic hepatitis B.

[0029] In this invention, the data processing device includes a conclusion output module. If the expression level of lncRNA-NONHSAT178169.1 in the test sample is significantly lower than that in the positive sample, then the test sample is predicted or diagnosed as being in the immune tolerance phase of chronic hepatitis B. The test sample includes peripheral blood.

[0030] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0031] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0032] In the following examples, statistical analysis was performed using GraphPad Prism 9.0. Continuous variables were first tested for normality: normally distributed data were expressed as mean ± standard deviation, and comparisons between groups were performed using t-tests / ANOVA; non-normally distributed data were expressed as median (interquartile range, Q1–Q3), and comparisons between groups were performed using the Mann–Whitney U test or the Kruskal–Wallis test. Paired data were tested using paired t-tests or the Wilcoxon signed-rank test. Categorical variables were analyzed using χ². 2 The test or Fisher's exact test was used. Correlation analysis was performed using the Pearson or Spearman method. A p-value < 0.05 was considered statistically significant.

[0033] Example 1 Materials and Methods 1. Research Subjects and Ethics Peripheral blood samples were obtained from 149 CHB patients and 66 healthy volunteers in the Department of Infectious Diseases, First Affiliated Hospital of Fujian Medical University. Patients were divided into IT (immune tolerance phase, n=24), IC (immune clearance phase, n=80), LH (low replication phase, also known as inactive phase, n=24) and LR (reactivation phase, n=21) according to natural history stages. The diagnostic criteria were in accordance with the diagnostic criteria in the "Guidelines for the Prevention and Treatment of Hepatitis B in China (2015 Updated Edition)" [1] formulated by the Chinese Society of Infectious Diseases and the Chinese Society of Hepatology. The specific details are as follows: (1) Immune tolerance period (IT): Serum HBsAg and HBeAg positive, HBV DNA level high, ALT normal, liver tissue with no obvious abnormalities or mild inflammation and necrosis, no or only slow progression of liver fibrosis. (2) Immune clearance phase (IC): Serum HBV DNA level >2000 IU / mL, ALT is continuously or intermittently elevated, liver histology shows moderate or severe inflammation and necrosis, liver fibrosis can progress rapidly, and some may develop into cirrhosis and liver failure. (3) Inactive period (LH): Serum HBeAg negative, anti-HBe positive, HBV DNA level low or undetectable, ALT normal, liver tissue without inflammation or only mild inflammation; (4) Reactivation phase (LR): characterized by HBeAg negative, anti-HBe positive, HBV DNA level often >2000 IU / mL, and ALT persistent or recurrent abnormality.

[0034] Exclusion criteria: co-infection with other hepatitis viruses or HIV, liver disease of other causes, malignant tumors, pregnancy, and serious comorbidities. The study was approved by the hospital's ethics committee, and all participants signed informed consent forms.

[0035] Table 1 shows the comparison results of basic information and laboratory indicators for the four natural history stages of HBV (IT / IC / LH / LR).

[0036] Table 1. Comparison of basic information and laboratory indicators of HBV in the four natural history stages (IT / IC / LH / LR)

[0037] Note: Continuous variables are represented by median (interquartile range, Q1–Q3); categorical variables are represented by n (%); values ​​are taken directly from the original table without normality tests or statistical comparisons.

[0038] 2. PBMC isolation and flow cytometry PBMCs were separated using Ficoll-Hypaque density gradient centrifugation. PBMCs were then surface-stained with fluorescently labeled monoclonal antibodies against CD3 (APC anti-human CD3, Biolegend), CD4 (FITC anti-human CD4, Biolegend), CD8 (PE / Cy7 anti-human CD8, BD), and BTLA (Percp / Cy5.5 anti-human BTLA, Biolegend) (incubated at 4°C in the dark for 30 min), washed, and analyzed by flow cytometry. A unified gating strategy (lymphocyte-monocyte-CD3) was employed for flow cytometry analysis. + T cell phylum—CD4 + / CD8 + Subgroups), and non-specific signals were controlled by isotype control / fluorescence minus one (FMO).

[0039] 3. In vitro BTLA stimulation and qPCR verification To assess the impact of BTLA signaling on the transcriptional response of immune cells, PBMCs were incubated with an αBTLA antibody (Anti-BTLA, eBioscience) and PBS was used as a control. Dosage and time gradients were set according to the experimental design. After treatment, total RNA was extracted and qPCR was performed to detect changes in the expression of candidate lncRNAs and transcription factors. qPCR was performed using the SYBR Green system, with at least three technical replicates and biological replicates in independent samples.

[0040] 4. RNA sequencing and lncRNA screening Total RNA was extracted using TRIzol, and ribosomal RNA was removed before constructing libraries. Paired-end sequencing of 150 bp was performed on an Illumina NovaSeq 6000 platform. RNA-seq was performed on three CHB subjects and three healthy controls (NCs), who were treated with PBS and αBTLA (BTLA pathway intervention) in a paired design. Specifically, they were stimulated with different doses of anti-BTLA antibody (0, 2, 2.5, 5, and 10 μg / mL) for 6 h, or with 1 μg / mL of anti-BTLA antibody for 0, 1, 3, 6, and 12 h, respectively, resulting in 12 libraries. Sequences were aligned to the human reference genome (GRCh38), transcripts were assembled using StringTie, and differentially expressed lncRNAs (FDR < 0.05, |log2FC| > 1) were screened using DESeq2. Candidate lncRNAs were validated by qPCR in independent samples, and their correlation with BTLA expression was analyzed.

[0041] Figure 1 The results showed that there were differences in BTLA expression on peripheral blood T cells at different natural history stages. Specifically, in 149 CHB patients (IT n=24, IC n=80, LH n=24, LR n=21), there were significant differences in BTLA expression on the surface of peripheral blood T cells at different immune stages. The BTLA molecule expression level on CD4+ and CD8+ T lymphocytes of CHB patients in the immune tolerance stage was significantly higher than that in the other three stages.

[0042] To elucidate downstream transcriptional changes related to BTLA pathway intervention, PBMCs were treated with αBTLA and RNA sequencing was performed using PBS as a control (3 CHBs and 3 NCs, paired design).

[0043] Differential analysis identified 29 differentially expressed lncRNAs, among which lncRNA-NONHSAT178169.1 showed the largest variation and consistent performance across multiple batches of samples. Figure 2(A, B). In dose-time gradient experiments, lncRNA-NONHSAT178169.1 showed a continuous downregulation trend with increasing αBTLA treatment intensity or duration, and this was confirmed by qPCR in independent samples. Figure 2 (C, D)

[0044] 5. Co-immunoprecipitation-mass spectrometry and interaction prediction Full-length BTLA was cloned into a FLAG-tagged expression vector and transfected into HEK293 cells. After lysis, the BTLA complex was immunoprecipitated with an anti-FLAG antibody, and interacting proteins were identified by mass spectrometry. Untransfected or empty vector controls were included to exclude non-specific binding. Priority molecules were screened by combining transcriptomic differences with the functional background of candidate proteins, and RPISeq was used to predict the interaction probability between candidate proteins and lncRNA-NONHSAT178169.1 (random forest and SVM model scores >0.5 indicated potential interaction).

[0045] To identify potential molecular partners for BTLA in regulating transcriptional responses, BTLA-FLAG was expressed in HEK293 cells, and immunoprecipitation-mass spectrometry analysis identified 34 candidate interacting proteins. Considering transcriptional differences, protein functional background, and feasibility, FABP5 and DSP were prioritized as candidate molecules. Figure 3 (A, B). RPISeq predictions indicate that the interaction probabilities of FABP5, DSP, and lncRNA-NONHSAT178169.1 are all >0.5. Figure 3 (C). BTLA interactomics suggests that FABP5 and DSP are potential linking molecules.

[0046] 6. Transcription factor prediction and validation A co-expression network was constructed based on RNA sequencing results, and transtargeting prediction of lncRNAs was used to screen for potentially related transcription factors (such as FOS, ATF3, and MAFF). qPCR was used to verify the expression changes of these transcription factors in peripheral blood samples at different stages and in dose / time gradient experiments induced by αBTLA stimulation.

[0047] Co-expression network and trans prediction suggest that FOS, ATF3, and MAFF may reside in the same regulatory module as lncRNA-NONHSAT178169.1 (see...). Figure 4 (A~C). In dose- and time-gradient experiments of αBTLA stimulation, qPCR showed that FOS mRNA was consistently downregulated with increasing stimulation intensity or time, while the changes in ATF3 and MAFF were relatively less consistent (see...). Figure 4(D, E). Based on existing data, a working model of "BTLA–FABP5 / DSP–lncRNA-NONHSAT178169.1–FOS" is proposed to summarize the possible relationship between BTLA signaling and the transcription module (see D, E). Figure 5 ).

[0048] The above results suggest an association or interaction between lncRNA-NONHSAT178169.1 and BTLA, with BTLA potentially exerting its effect by inhibiting the expression of lncRNA-NONHSAT178169.1. Given the correlation between BTLA and chronic hepatitis B staging, the expression level of lncRNA-NONHSAT178169.1 could serve as one of the molecular markers reflecting chronic hepatitis B staging.

[0049] Example 2 Application of a reagent for detecting the expression level of lncRNA-NONHSAT178169.1 in the preparation of products for assessing the immune tolerance phase of chronic hepatitis B. Peripheral blood was collected from the test samples, and total RNA was extracted using a kit. The expression level of NONHSAT178169.1 was detected by real-time quantitative PCR. The PCR amplification system consisted of: 10 μL of 2×SuperReal PreMix Plus, 0.6 μL of 10 μM upstream primer, 0.6 μL of 10 μM downstream primer, 0.4 μL of 50×ROX Reference Dye, 1 μL of cDNA template, and 7.4 μL of RNase-Free ddH2O. The PCR amplification program was 95℃ pre-denaturation for 15 min, followed by 40 cycles of 95℃ for 10 s and 60℃ for 20 s. Melting curve analysis was performed after amplification.

[0050] The upstream and downstream primers for PCR amplification are: Upstream primer F (5'-3'): AGCGATAGTCATCACGGGG (SEQ ID NO.1); Downstream primer R (5'-3'): TGCTGCTCTTTGGCCTCTTT (SEQ ID NO.2).

[0051] According to the test results, when the expression level of lncRNA-NONHSAT178169.1 in the test sample is significantly lower than that in samples from the immune clearance phase of chronic hepatitis B, the inactive phase of chronic hepatitis B, and the reactivation phase of chronic hepatitis B, it suggests that the individual in the test sample is in the immune tolerance phase of chronic hepatitis B, or that the test sample may be predicted or used to assist in the diagnosis of the immune tolerance phase of chronic hepatitis B.

[0052] Example 3 Peripheral blood samples were collected from 56 CHB patients in the Department of Infectious Diseases, the First Affiliated Hospital of Fujian Medical University in Quanzhou. The sample subset used for detecting lncRNA-NONHSAT178169.1 expression levels was divided into three groups: 11 patients in the IT stage (test group), 20 patients in the IC stage, 13 patients in the LH stage, and 12 patients in the LR stage (control group). The expression level of lncRNA-NONHSAT178169.1 was detected according to the method described in Example 2, and the determination method in Example 2 was used to determine whether the test sample was predicted to be in the immune tolerance phase of chronic hepatitis B.

[0053] Figure 6 The results showed that the expression level of lncRNA-NONHSAT178169.1 in the test sample was significantly lower than that in the control samples of IC, LH, and LR in chronic hepatitis B. This indicates that the test sample was a sample in the immune tolerance phase of chronic hepatitis B. This result is consistent with the actual results, demonstrating that detecting the expression level of lncRNA-NONHSAT178169.1 can correctly distinguish whether the test sample is in the immune tolerance phase of chronic hepatitis B.

[0054] Furthermore, the sensitivity and specificity of lncRNA-nonhsat178169.1 in differentiating between the IT group and the non-IT group (IC, LH, and LR groups) were analyzed, and ROC curves were plotted.

[0055] Figure 7 The results showed that the AUC value for distinguishing the IT group from the non-IT group by detecting the expression level of lncRNA-nonhsat178169.1 was 0.65, with a sensitivity of 90%.

[0056] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a reagent for detecting the expression level of lncRNA-NONHSAT178169.1 in the preparation of staging products for predicting or diagnosing chronic hepatitis B.

2. The application according to claim 1, characterized in that, The stage described is the immune tolerance stage.

3. The application according to claim 1 or 2, characterized in that, The reagents used to detect the expression level of lncRNA-NONHSAT178169.1 include lncRNA-NONHSAT178169.1 antibodies, specific probes, or primer pairs.

4. The application according to claim 3, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.1~SEQ ID NO.

2.

5. The application according to claim 1, characterized in that, The products include one or more of the following: reagent kits, test strips, and gene chips.

6. The application according to claim 5, characterized in that, The kit also includes a PCR amplification system.

7. A system for predicting or diagnosing the staging of chronic hepatitis B, characterized in that, It includes a data processing device and a detection device, wherein the detection device is used to detect the expression level of lncRNA-NONHSAT178169.1 in the test sample and the control sample.

8. The system according to claim 7, characterized in that, The control samples were samples from the immune clearance phase of chronic hepatitis B, samples from the inactive phase of chronic hepatitis B, and samples from the reactivation phase of chronic hepatitis B.

9. The system according to claim 7, characterized in that, The data processing device includes a conclusion output module. If the expression level of lncRNA-NONHSAT178169.1 in the test sample is significantly lower than that in the positive sample, the test sample is predicted or diagnosed as being in the immune tolerance phase of chronic hepatitis B.

10. The system according to claim 8, characterized in that, The sample to be tested includes peripheral blood.