A fluorescence sensor for detecting endocrine disrupting activity in sewage and application thereof
By functionalizing a biosensor chip with ligand-peptide-dye conjugates and using a quantum dot-nuclear receptor fluorescent probe in a fluorescent sensor, the comprehensive activity detection challenge of endocrine disruptors in water has been solved, achieving rapid quantitative detection with high sensitivity and anti-fouling performance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHENZHEN UNIV
- Filing Date
- 2026-04-24
- Publication Date
- 2026-07-07
AI Technical Summary
Existing technologies are insufficient for comprehensive activity detection of endocrine disruptors in water, and they also have low detection sensitivity and insufficient anti-pollution performance in complex water environments, making it difficult to achieve rapid on-site detection.
A fluorescence sensor was designed, employing a ligand-peptide-dye conjugate-functionalized biosensor chip and a quantum dot-nuclear acceptor fluorescent probe. Utilizing the principle of fluorescence resonance energy transfer, a highly sensitive ratiometric fluorescence biosensing analysis method was constructed to achieve rapid quantitative detection of endocrine disruptors.
It achieves broad-spectrum and specific identification of endocrine disruptors, has high sensitivity and anti-pollution performance, and can rapidly and quantitatively detect endocrine disruptors in complex environments. It is suitable for the detection of endocrine disruptors in wastewater.
Smart Images

Figure CN122084916B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomonitoring technology, and in particular to a fluorescent sensor for detecting endocrine disruption activity in wastewater and its application. Background Technology
[0002] Endocrine disruptors, as an important new class of pollutants, are diverse and structurally complex, capable of harming the reproductive development, nervous system, and immune system of organisms even at extremely low concentrations. Urban wastewater systems are complex and rich in organic matter, posing a significant challenge to the rapid quantitative detection of trace endocrine disruptors. Biosensing technology, with its advantages of high sensitivity, low cost, fast response, and simple operation, is easily miniaturized and can be used for on-site detection, making it a research frontier and hot topic in environmental monitoring in recent years. Quantitative detection of endocrine disruptors in wastewater is of great significance; however, the complex environmental matrix, the variety of endocrine disruptors, and their low concentrations pose significant challenges to traditional analytical methods. Existing biosensing technologies for detecting endocrine disruptors mainly include electrochemical, photoelectrochemical, fluorescence, surface-enhanced Raman, and surface plasmon resonance sensors.
[0003] Although the above technologies can detect endocrine disruptors in water to a certain extent, the following bottlenecks still need to be addressed: (1) Overcome the limitation that traditional biometric materials can only achieve single-target analysis and realize comprehensive activity detection of endocrine disruptors in water; (2) Improve the anti-pollution performance of the sensing interface and reduce the interference of complex environmental water matrix on detection; (3) Further improve the sensitivity of the analysis method and combine it with portable sensing technology to achieve rapid on-site detection. Summary of the Invention
[0004] The purpose of this invention is to provide a fluorescent sensor for detecting endocrine disruption activity in wastewater and its application, so as to solve the problems existing in the prior art.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a fluorescent sensor for detecting the activity of endocrine disruptors in wastewater, comprising a ligand-peptide-dye conjugate-functionalized biosensor chip and a quantum dot-nuclear receptor fluorescent probe.
[0007] The preparation method of the ligand-peptide-dye conjugate-functionalized biosensor chip includes the following steps:
[0008] After incubating a solution of a small ligand molecule and a Y-type polypeptide with an amino acid sequence as shown in SEQ ID NO.1, the polypeptide is then mixed with a fluorescent dye and coupled to obtain a multifunctional ligand-peptide-dye conjugate.
[0009] The multifunctional ligand-peptide-dye conjugate was dropped onto a silicon-based sensing chip to obtain a biosensing chip functionalized with the ligand-peptide-dye conjugate.
[0010] The preparation method of the quantum dot-nuclear acceptor fluorescent probe includes the following steps:
[0011] The quantum dot solution was mixed with EDC and NHS, and then mixed with the protein-tagged antibody solution to obtain a quantum dot-labeled protein-tagged antibody solution.
[0012] The quantum dot-labeled protein-tagged antibody solution and the tagged androgen nuclear receptor protein solution were mixed and incubated to obtain a quantum dot-nuclear receptor fluorescent probe.
[0013] Optionally, the molar ratio of the ligand small molecule solution to the Y-type polypeptide with an amino acid sequence as shown in SEQ ID NO.1 is 10:1;
[0014] The concentration of the ligand small molecule in the ligand small molecule solution is 10 mM;
[0015] The ligand small molecules include dihydrotestosterone derivatives, estradiol derivatives, or triiodothyronine.
[0016] Optionally, the molar ratio of the solution obtained after incubating the ligand small molecule solution and the Y-type polypeptide with an amino acid sequence as shown in SEQ ID NO.1 to the fluorescent dye is 1:30.
[0017] The fluorescent dyes include Cy3, Cy5, or Cy5.5.
[0018] Optionally, the concentration of EDC in the mixture obtained by mixing the quantum dot solution with EDC and NHS is 20 mM and the concentration of NHS is 30 mM.
[0019] The concentration of quantum dots in the quantum dot solution is 1 mM;
[0020] The quantum dots include InP / ZnS or CdSe / ZnS.
[0021] Optionally, the concentration of the protein-tagged antibody in the quantum dot-labeled protein-tagged antibody solution is 10 mM.
[0022] Optionally, the reaction molar ratio of the quantum dot-labeled protein-tagged antibody solution to the tagged androgen nuclear receptor protein solution is 1:1;
[0023] The concentration of the labeled androgen nuclear receptor protein in the labeled androgen nuclear receptor protein solution is 10 mM.
[0024] Optionally, the endocrine disruptor includes androgen disruptors, estrogen disruptors, or thyroid hormone disruptors;
[0025] The label includes the His label or the GST label.
[0026] The present invention provides the application of the above-described fluorescence sensor in the preparation of products for detecting the activity of endocrine disruptors in wastewater or in the detection of endocrine disruptor activity.
[0027] Optionally, the product includes a reagent kit.
[0028] Optionally, the endocrine disruptor includes androgen disruptors, estrogen disruptors, or thyroid hormone disruptors.
[0029] The present invention provides a product for detecting the activity of endocrine disruptors in wastewater, the product comprising the aforementioned fluorescence sensor.
[0030] Optionally, the endocrine disruptor includes androgen disruptors.
[0031] This invention provides a biosensing method for detecting the activity of endocrine disruptors in wastewater. The method includes the steps of mixing the above-mentioned quantum dot-nuclear receptor fluorescent probe with the wastewater to be tested, and using the above-mentioned ligand-peptide-dye conjugate-functionalized biosensor chip for detection.
[0032] Optionally, the endocrine disruptor includes androgen disruptors, estrogen disruptors, or thyroid hormone disruptors.
[0033] The present invention discloses the following technical effects:
[0034] This invention creatively designs a Y-shaped polypeptide containing an anchoring region, a hinge region, and an antifouling region as a structural framework. The main chain and branch ends are directionally modified to prepare a multifunctional ligand-peptide-dye conjugate. A highly reactive, strongly antifouling, and stably regenerable optical biosensor chip—a ligand-peptide-dye conjugate functionalized biosensor chip—is constructed using covalent coupling. Subsequently, a highly sensitive quantum dot-nuclear acceptor fluorescent probe with tunable emission spectra is constructed. A ratiometric fluorescence biosensing principle based on fluorescence resonance energy transfer is proposed to achieve rapid quantitative detection of endocrine disruptors in wastewater, enabling it to have broad-spectrum specificity for certain types of endocrine disruptors.
[0035] Furthermore, the present invention also has the following advantages:
[0036] 1. A method for preparing spectrally tunable quantum dot-nuclear receptor fluorescent probes based on indirect beacon technology allows for the replacement of corresponding antibodies (e.g., His-tagged, GST-tagged, etc.) according to different nuclear receptor tags (e.g., His-tagged, GST-tagged, etc.). Furthermore, different types of quantum dots (e.g., InP / ZnS or CdSe / ZnS) can have their excitation and emission wavelengths adjusted through size effects to match their corresponding fluorescent dyes (e.g., Cy3, Cy5, or Cy5.5), facilitating fluorescence resonance energy transfer.
[0037] 2. The ratio fluorescence biosensing analysis method based on the principle of fluorescence resonance energy transfer has the properties of high sensitivity and anti-pollution, and can be used for rapid quantitative detection of endocrine interference activity in wastewater.
[0038] 3. This biosensor analysis method is versatile and can detect the activity of different types of endocrine disruptors (such as estrogen disruptors, thyroid hormone disruptors, etc.) by changing different types of nuclear receptors (such as estrogen nuclear receptors, thyroid hormone nuclear receptors). Attached Figure Description
[0039] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0040] Figure 1 Structure and function of Y-type polypeptides;
[0041] Figure 2 A biosensor chip functionalized with ligand-peptide-dye conjugates;
[0042] Figure 3 This is a schematic diagram of the synthesis of a quantum dot-nuclear acceptor fluorescent probe based on indirect beacon technology;
[0043] Figure 4 A diagram illustrating the mechanism of detecting endocrine disruption activity using a ratiometric fluorescence biosensing method based on fluorescence resonance energy transfer;
[0044] Figure 5 A standard curve for detecting androgen interference activity using a ratio fluorescence biosensing assay;
[0045] Figure 6 Evaluation of the anti-fouling performance of peptide-conjugated sensor interfaces;
[0046] Figure 7 The results are from the estrogen interference activity assay.
[0047] Figure 8 The results are from the thyroid hormone interference activity assay.
[0048] Figure 9 For practical application testing results;
[0049] Figure 10 This is a comparison chart of the detection results of the biosensor and the yeast two-hybrid method. Detailed Implementation
[0050] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0051] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0052] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0053] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0054] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0055] The design principle and preparation process of the fluorescence sensor and the biosensing analysis method for detecting endocrine disruption activity in wastewater based on the biosensor provided by this invention are as follows:
[0056] (1) Design and fabrication of multifunctional ligand-peptide-dye conjugates and their functionalized sensing chips
[0057] ① Construction of Y-type polypeptide structures: such as Figure 1 As shown, a multifunctional ligand-peptide-dye conjugate was constructed using a Y-type polypeptide as the structural backbone. The Y-type polypeptide structure mainly consists of three parts: (I) Anchoring region: mainly composed of neutral hydrophilic amino acids such as serine (S) or threonine (T), which can improve the hydrophilicity of the polypeptide conjugate, and the terminal modified with a silane group (-Silane) for covalent coupling with silicon-based sensing chips. (II) Hinge region: glycine (G) is used to increase the flexibility of the polypeptide backbone, and the property that proline (P) cannot form an α-helix helps to generate "nodules" to connect the two branches. (III) Antifouling region: the two branches of the polypeptide are composed of lysine (K) and glutamic acid (E) with alternating positive and negative charges, and the terminals are modified with maleimide groups (-MAL) and amino groups (-NH2), respectively, for coupling ligands and labeling dyes. The Y-type polypeptide provided by this invention is synthesized by solid-phase peptide synthesis method, and the molecular weight of the polypeptide is identified by LC-MS after HPLC purification.
[0058] ② Ligand derivative molecular design: Taking the detection of androgen interfering substances as an example, dihydrotestosterone (DHT), the most active endogenous androgen, was selected as the ligand small molecule and modified at the end of the Y-type polypeptide branch chain for binding to the androgen nuclear receptor. Since the length of the linker arm between the ligand small molecule and the polypeptide, as well as the derivatization site, greatly affect the binding performance with the nuclear receptor, further optimization is required. Simultaneously, a carboxyl group (-COOH) needs to be introduced at the end of the ligand derivative, which can be covalently coupled with the bifunctional reagent amino-polyethylene glycol-thiol (NH2-PEG-SH) to couple with the maleimide group (-MAL) at the end of the polypeptide branch chain.
[0059] ③ Preparation of peptide conjugates and functionalization of sensor chips: Fluorescent dyes with N-hydroxysuccinimide (NHS) ester groups were selected as reference signal molecules (such as Cy3, Cy5, or Cy5.5, etc.) and covalently coupled with Y-type peptides and ligand derivatives to prepare ligand-peptide-dye conjugates with multiple functions such as high-affinity receptor recognition, anti-biocontamination, and reference fluorescence signal. Subsequently, a covalently coupled interface modification method was used to prepare a biosensor chip functionalized with the ligand-peptide-dye conjugates. Figure 2 ).
[0060] (2) Preparation of spectrally tunable quantum dot-nuclear acceptor fluorescent probes
[0061] Water-soluble core-shell quantum dots (such as InP / ZnS or CdSe / ZnS) with good stability and high fluorescence efficiency are prepared by hydrothermal synthesis. These quantum dots are commercially available and can be prepared in-house using existing methods. In in-house preparation, reaction time, temperature, and pH can be optimized, and the core particle size, shell coating time, and number of coating cycles can be adjusted. The absorption and emission wavelengths can be controlled according to the size, allowing for further excitation by the emission wavelength of fluorescent dyes (such as Cy3, Cy5, or Cy5.5) for subsequent construction of a fluorescence resonance energy transfer (FRET) detection system. To avoid the steric hindrance of the ligand binding pocket of nuclear receptor proteins being affected by the quantum dots, this invention introduces a GST-tagged antibody using indirect beacon technology. Figure 3 As shown, quantum dots containing carboxyl groups are first conjugated to GST-tagged antibodies, and then subjected to an immunoreaction with a GST-tagged nuclear receptor to prepare a quantum dot-nuclear receptor fluorescent probe. Figure 3 ).
[0062] (3) Detection of endocrine disruptors in wastewater
[0063] Based on the principle of fluorescence resonance energy transfer, using ligand-peptide-dye conjugates as energy donors and quantum dot-nuclear acceptor fluorescent probes as energy acceptors, a rapid quantitative detection ratio fluorescence biosensing technique for androgen interference activity has been developed. Figure 4 The principle is as follows: A quantum dot-nuclear receptor fluorescent probe is incubated with an aqueous sample containing endocrine disruptors, resulting in a receptor-ligand affinity reaction. This is then introduced into a solid-phase sensing interface. A ligand-peptide-dye conjugate modified on the sensing interface indirectly competes with the endocrine disruptors for binding to the quantum dot-nuclear receptor fluorescent probe. At this point, the quantum dot-nuclear receptor fluorescent probe bound to the sensing interface and the ligand-peptide-dye conjugate constitute a fluorescence resonance energy transfer system. Under incident light excitation, the dye, acting as an energy donor, emits fluorescence F... d This can further excite quantum dots to produce fluorescent F r The ratio of the two fluorescence signals (F) r / F d The activity of the quantum dot-nuclear acceptor fluorescent probe is inversely proportional to that of endocrine disruptors, thus enabling quantitative analysis of endocrine disruptors in water samples. Furthermore, an eluent containing surfactant is used to clean the quantum dot-nuclear acceptor fluorescent probe at the sensing interface without damaging the ligand-peptide-dye conjugate modified on the sensing chip, before proceeding to the next round of testing.
[0064] Unless otherwise specified, all materials used in this invention are commonly purchased by those skilled in the art, and all methods used in this invention are well known to those skilled in the art.
[0065] Example 1: Fabrication of a fluorescence sensor and a biosensing method for detecting endocrine disruptors in wastewater.
[0066] (1) Preparation of ligand-peptide-dye conjugates and their functionalized sensing chips
[0067] Based on the Y-type polypeptide structure design scheme, a custom-designed polypeptide was commissioned to Shanghai Bioengineering Co., Ltd. The polypeptide sequence is STSTGGPP-(EKEKEKEK)2 (SEQ ID NO.1), with maleimide (-MAL) and amino (-NH2) groups modified at the ends of the two branches, respectively. Taking the detection of androgen interferon as an example, a DHT carboxyl derivative (C...) was selected. 23 H 34 O5, with the chemical structure shown in Formula I, was purchased from Wuhan AmyJet Technology Co., Ltd., brand: Steraloids, catalog number: A2587-000, https: / / www.steraloids.com / 5androstan / 5-androstan-17-ol-3-one-hemisuccinate-2687.html) as the ligand molecule. The fluorescent dye Cy3 (CAS No.: 1393363-07-9) with N-hydroxysuccinimide (NHS) ester groups was selected as the reference signal molecule. The preparation method is as follows:
[0068] Formula I.
[0069] (a) The solid powder of DHT carboxyl derivative was dissolved in 1 mL of N,N-dimethylformamide (DMF) and slowly added to a certain volume of PBS buffer (pH 7.0) to make its concentration 1 mg / mL. Then, it was covalently coupled with 5 mg / mL of the bifunctional reagent amino-polyethylene glycol-thiol (NH2-PEG-SH, purchased from Xi'an Qiyue Biotechnology Co., Ltd., CAS: 347750-20-2) to obtain DHT-PEG-SH conjugate. After dilution (the diluent was PBS buffer (pH 7.0)), the final concentration was made up to 10 mM.
[0070] (b) The obtained DHT-PEG-SH conjugate solution was incubated with the Y-type peptide at a molar ratio of 10:1 at room temperature for 2 h to promote the formation of ligand derivative-peptide conjugate. To further purify the ligand derivative-peptide conjugate, the above solution was dialyzed against 0.1 M Na2CO3-NaHCO3 buffer (pH 9.0-9.3) at 4 °C for 12 h, filtered, and the ligand derivative-peptide conjugate solution was obtained and stored in the dark.
[0071] (c) Next, under gentle stirring, the fluorescent dye Cy3 with N-hydroxysuccinimide (NHS) ester groups was added dropwise to the above ligand derivative-peptide conjugate solution at a molar ratio of 30:1, and the coupling reaction was carried out at room temperature in the dark for 1 h. Subsequently, excess fluorescent dye Cy3 with N-hydroxysuccinimide (NHS) ester groups was removed using a desalting column, and the 0.1 M Na2CO3-NaHCO3 buffer was replaced with PBS buffer (pH 7.0).
[0072] (d) The labeling ratio of the fluorescent dye Cy3 with N-hydroxysuccinimide (NHS) ester group to the ligand derivative-peptide conjugate was measured to be in the range of 2 to 5 by ultraviolet spectroscopy. The obtained multifunctional ligand-peptide-dye conjugate was aliquoted and stored in a -20°C freezer.
[0073] (e) The silicon-based sensor chip (BK7 glass, refractive index 1.516, purchased from Huaying Optical Glass Processing Co., Ltd.) was cleaned with anhydrous ethanol and deionized water, dried with nitrogen, and then placed in a plasma cleaner for surface treatment for 90 s to enrich its surface with hydroxyl functional groups. Subsequently, 20 μL of 1 mg / L ligand-peptide-dye conjugate was directly dropped onto the surface of the sensor chip, and incubated at room temperature for 1 h to complete the functionalization of the sensor chip, thus obtaining a ligand-peptide-dye conjugate-functionalized biosensor chip.
[0074] (2) Preparation of spectrally tunable quantum dot-nuclear acceptor fluorescent probes
[0075] Based on the quantum dot size effect, corresponding "dye-quantum dot" donor-acceptor pairs can be designed for subsequent construction of fluorescence resonance energy transfer detection systems. Furthermore, to avoid the influence of quantum dot steric hindrance on the ligand binding pocket of androgen nuclear receptors, this invention employs indirect beacon technology to prepare spectrally tunable quantum dot-nuclear receptor fluorescent probes. The preparation method is as follows:
[0076] (a) Select water-soluble InP / ZnS core-shell quantum dots (manufacturer: Suzhou Xingshuo Nanotechnology Co., Ltd., catalog number: InP / ZnS-625-25) that can be matched with the fluorescent dye Cy3 with N-hydroxysuccinimide (NHS) ester group, centrifuge at 3000 rpm for 5 min, and dilute with deionized water to obtain quantum dot solution.
[0077] (b) Add 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS) solid powder to the solution obtained in step (a), and stir gently to dissolve them so that the final concentration of EDC is 20 mM and the final concentration of NHS is 30 mM.
[0078] (c) Prepare a GST protein tag antibody (manufacturer: Beijing Bio-Tech Biotechnology Co., Ltd., catalog number: BTA-056) solution, add it to the mixed solution obtained in step (b), and incubate at room temperature for 1 h to obtain a quantum dot labeled protein tag antibody solution.
[0079] (d) Subsequently, the quantum dot-labeled protein-tagged antibody and the GST-tagged androgen nuclear receptor protein (manufacturer: Beijing Kangboci Technology Co., Ltd., catalog number: BJKBCNR3C4) solution were incubated at a reaction molar ratio of 1:1 at room temperature for 5 min to induce an antibody-antigen immunobinding reaction, yielding a quantum dot-nuclear receptor fluorescent probe. The probe was then aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C for long-term preservation.
[0080] (3) Fluorescent sensors: biosensor chips functionalized with ligand-peptide-dye conjugates and quantum dot-nuclear acceptor fluorescent probes.
[0081] (4) Detection of endocrine disruptors in wastewater
[0082] This embodiment uses the fluorescence sensor independently developed by the present invention for signal detection. The specific detection steps are as follows:
[0083] (a) Prepare DHT standard solution (10 μL) using PBS buffer (pH 7.0). -3 10 -2 10 -1 10 0 10 1 10 2 10 3 10 4 10 5 (nM) is available for use.
[0084] (b) Add 200 μL of DHT standard solution to 200 μL of 5 nM quantum dot-nuclear acceptor fluorescent probe solution and incubate at room temperature for 10 min.
[0085] (c) The above mixed solution was passed through the surface of a ligand-peptide-dye conjugate-functionalized biosensor chip and kept for 5 min to carry out an indirect competitive reaction. Under the conditions of excitation wavelength of 520 nm and emission wavelength of 650 / 594 nm, the signal was detected and the signal of the quantum dots was recorded (the quantum dots were excited to produce fluorescence F). r The signals of ) and Cy3 (fluorescence F emitted by the energy donor) d ), calculate ratio fluorescence signal (F r / F d ).
[0086] (d) Subsequently, the sensor interface was regenerated by rinsing with 0.5% SDS (pH 1.9) eluent for 2 min, and steps (a)-(c) were repeated for the next set of tests. After all DHT standard solutions were tested, a standard curve could be established to calculate the androgen interference activity in the water sample. The results showed that the detection limit of the method provided by this invention for androgen interference activity was 1.9 pM DHT binding activity equivalent, and the linear range was 7.4~770.8 pM DHT binding activity equivalent (… Figure 5 ).
[0087] (e) Finally, water samples from a municipal wastewater treatment plant were selected for testing, and the pollution prevention performance of this method against common pollutants in wastewater was evaluated.
[0088] Example 2: Pollution Prevention Effect Test
[0089] BSA inert protein, estradiol, DNA fragments, and polystyrene nanospheres are all commercially available products.
[0090] The androgen nuclear receptor protein with a GST tag (manufacturer: Beijing Kangboci Technology Co., Ltd., catalog number: BJKBCNR3C4), BSA inert protein (manufacturer: Sigma, catalog number: V900933), estradiol (manufacturer: Sigma, catalog number: E8875), DNA fragment (manufacturer: Shanghai Bioengineering Co., Ltd., base sequence: GTCGTAAGCAACATTAGGCATTCTG, SEQ ID NO.2), and polystyrene nanospheres (manufacturer: Beijing Bio-Tech Biotechnology Co., Ltd., catalog number: ABT-8-0002) were introduced into the sensing interface to test the anti-fouling performance of the fluorescent sensor. The results showed that the non-specific adsorption signal of the ligand-peptide-dye conjugate for common pollutants in urban wastewater, such as proteins, organic matter, nucleic acids, and solid particles, was less than 10% of that of the androgen nuclear receptor signal. Figure 6 This demonstrates that the biosensing analysis method has a good pollution prevention effect in wastewater detection.
[0091] Example 3 Generality
[0092] Since all nuclear receptors possess conserved domains and similar activation processes, based on the aforementioned fluorescent sensor, the activity of various types of endocrine disruptors can be detected and analyzed by replacing the corresponding nuclear receptors and ligands in the multifunctional conjugates. Taking the detection of estrogen disruptors and thyroid hormone disruptors as an example, the preparation method of this biosensor is the same as in Example 1, except that the ligand small molecule is a carboxyl derivative of estradiol (E2)—β-estradiol-6-one-6-(O-carboxymethyl oxime) (C 19 H 24O5 (CAS: 35048-47-6) or triiodothyronine (T3) whose structure itself contains a carboxyl functional group (C 15 H 12 I3NO4, CAS: 6893-02-3); GST protein-tagged antibody was replaced with His protein-tagged antibody, and the GST-tagged androgen nuclear receptor protein was replaced with the His-tagged estrogen nuclear receptor (manufacturer: Beijing Kangboci Technology Co., Ltd., catalog number: BJKBCNR3A2) or the GST-tagged thyroid hormone nuclear receptor (manufacturer: Beijing Kangboci Technology Co., Ltd., catalog number: BJKBCNR1A1); all showed good detection performance, with a detection limit of 4.3 pM E2 binding activity equivalents for estrogen interference activity and a linear range of 10.5~1227.8 pM E2 binding activity equivalents. Figure 7 The detection limit for thyroid hormone interference activity was 8.5 pM T3-binding activity equivalents, and the linear range was 16.4–1206.1 pM T3-binding activity equivalents. Figure 8 Therefore, it can be shown that the fluorescent biosensor proposed in this invention has good versatility for various types of endocrine disruptors and has broad application prospects in the group screening of endocrine disruptors in environmental water.
[0093] Example 4: Determination of spiked recovery rate
[0094] To further investigate the detection performance of the fluorescent biosensors obtained in Examples 1 and 3 for androgen interference, estrogen interference, and thyroid hormone interference, respectively, multiple groups of different concentrations of DHT, estrogen (E2), and thyroid hormone (T3) were spiked onto the three environmental water samples to test the recovery rate. The results are shown in Table 1.
[0095] Table 1. DHT, E2, and T3 mixed spiking tests in three different environmental water samples.
[0096] ;
[0097] Note: " / " indicates that it was not detected or there was no relevant data.
[0098] As shown in Table 1, the average recovery rates of DHT, E2, and T3 are 89-117%, and the RSD is less than 13.4% (n=3), proving that the biosensor provided by this invention has good accuracy in detecting the activity of the three endocrine disruptors and can be used in practical applications for environmental water samples such as tap water, lake water, and river water.
[0099] Example 5 Practical Application
[0100] A wastewater treatment plant in Shenzhen was selected as the research object. It mainly treats some industrial wastewater and domestic sewage from surrounding residents. The treatment process includes filters, hair filters, membrane bioreactors, and reverse osmosis. Wastewater samples collected include: influent (IS), secondary effluent (SE) after membrane bioreactor treatment, and tertiary effluent (TS) after reverse osmosis treatment. Each sampling type was sampled continuously for one week and numbered 1-7 respectively. The fluorescence sensor obtained in Example 1 was used to detect the changes in the activity of androgen interfering substances in different process stages. At the same time, the yeast two-hybrid method was used for testing (the specific steps are referred to in the literature "Androgen Receptor Interference Effect of Source Water and its Changes in Water Treatment Process" (Jiang Weiwei, Yan Ye, Li Na, et al. Androgen Receptor Interference Effect of Source Water and its Changes in Water Treatment Process [J]. Journal of Ecotoxicology, 2016, 11(2):405-412)) to analyze the correlation between the two results.
[0101] The results showed that ( Figure 9 In the IS samples, androgen-binding activity ranged from 0.8 to 2.7 nM DHT binding activity equivalents, while in the SE samples, androgen-binding activity decreased significantly, remaining in the range of 0.07 to 0.15 nM DHT binding activity equivalents. This indicates that although the membrane bioreactor could not completely remove androgen interfering substances, it still had a high removal efficiency. Androgen interfering substances were not detected in the TS samples, indicating that reverse osmosis could remove them more thoroughly. Furthermore, the detection results of this biosensor were compared with those of the yeast two-hybrid assay. Figure 10 The correlation was good (Y=0.95*X-5.02, r). 2 =0.98, p<0.0001), indicating that the biosensor has good accuracy in testing the binding activity of androgen disruptors in wastewater.
[0102] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A fluorescent sensor for detecting the activity of endocrine disruptors in wastewater, characterized in that, Including ligand-peptide-dye conjugate-functionalized biosensor chips and quantum dot-nuclear acceptor fluorescent probes; The preparation method of the ligand-peptide-dye conjugate-functionalized biosensor chip includes the following steps: After incubating a solution of a small ligand molecule and a Y-type polypeptide with an amino acid sequence as shown in SEQ ID NO.1, the polypeptide is then mixed with a fluorescent dye and coupled to obtain a multifunctional ligand-peptide-dye conjugate. The multifunctional ligand-peptide-dye conjugate was dropped onto a silicon-based sensing chip to obtain a biosensing chip functionalized with the ligand-peptide-dye conjugate. The preparation method of the quantum dot-nuclear acceptor fluorescent probe includes the following steps: The quantum dot solution was mixed with EDC and NHS, and then mixed with the protein-tagged antibody solution to obtain a quantum dot-labeled protein-tagged antibody solution. The quantum dot-labeled protein-tagged antibody solution and the tagged androgen nuclear receptor protein solution were mixed and incubated to obtain the quantum dot-nuclear receptor fluorescent probe. The ligand small molecule needs to have a carboxyl group introduced at its end, which is then coupled to the maleimide group at the end of the polypeptide branch chain via covalent coupling of a bifunctional reagent.
2. The fluorescence sensor according to claim 1, characterized in that, The molar ratio of the ligand small molecule solution to the Y-type polypeptide with the amino acid sequence shown in SEQ ID NO.1 is 10:1; The concentration of the ligand small molecule in the ligand small molecule solution is 10 mM; The ligand small molecules include dihydrotestosterone derivatives, estradiol derivatives, or triiodothyronine.
3. The fluorescence sensor according to claim 1, characterized in that, The molar ratio of the solution obtained after incubating the ligand small molecule solution and the Y-type polypeptide with the amino acid sequence shown in SEQ ID NO.1 to the fluorescent dye is 1:
30. The fluorescent dyes include Cy3, Cy5, or Cy5.
5.
4. The fluorescence sensor according to claim 1, characterized in that, The concentration of EDC in the mixture obtained by mixing the quantum dot solution with EDC and NHS is 20 mM, and the concentration of NHS is 30 mM. The concentration of quantum dots in the quantum dot solution is 1 mM; The quantum dots include InP / ZnS or CdSe / ZnS.
5. The fluorescence sensor according to claim 1, characterized in that, The reaction molar ratio of the quantum dot-labeled protein-tagged antibody solution to the tagged androgen nuclear receptor protein solution is 1:
1.
6. The fluorescence sensor according to claim 1, characterized in that, The endocrine disruptors include androgen disruptors, estrogen disruptors, or thyroid hormone disruptors; The label includes the His label or the GST label.
7. The use of the fluorescence sensor according to any one of claims 1-6 in the preparation of a product for detecting the activity of endocrine disruptors in wastewater or in the detection of endocrine disruptor activity.
8. A product for detecting the activity of endocrine disruptors in wastewater, characterized in that, The product includes the fluorescence sensor according to any one of claims 1-6.
9. A biosensing method for detecting the activity of endocrine disruptors in wastewater, characterized in that, The method includes the steps of mixing the quantum dot-nuclear acceptor fluorescent probe as described in any one of claims 1-6 with the wastewater to be tested, and then detecting it using a biosensor chip functionalized with a ligand-peptide-dye conjugate as described in any one of claims 1-6.
Citation Information
Patent Citations
CN116699150A
CN117147663A