Recombinant vectors for high gene expression

By designing DNA constructs containing 5' and 3' homologous arms in Schizochytrium microorganisms and using homologous recombination technology to insert the target gene into the high-expression region, the problem of unstable target gene expression in Schizochytrium microorganisms was solved, and efficient and stable gene expression and phenotypic identification were achieved.

CN122095099APending Publication Date: 2026-05-26CJ CHEILJEDANG CORP
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CJ CHEILJEDANG CORP
Filing Date
2024-06-20
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Efficient and stable expression of target genes is difficult to achieve in Schizochytrium microorganisms, resulting in unclear gene phenotypic changes, and the expression levels of gene insertion sites vary greatly in existing technologies.

Method used

The design incorporates a DNA construct with 5' and 3' homologous arms. The target gene is inserted into a highly expressed region of the Schizochytrium genus genome using homologous recombination technology, ensuring efficient expression of the target gene at a specific site.

Benefits of technology

High expression of target genes in *Schizochytrium* microorganisms was achieved, reducing the variability in gene expression and ensuring the stability and accuracy of gene phenotypes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122095099A_ABST
    Figure CN122095099A_ABST
Patent Text Reader

Abstract

This application relates to a DNA construct for overexpressing a target gene in *Schizochytrium* microorganisms, and a method for expressing the target gene in *Schizochytrium* microorganisms using the construct. The DNA construct includes a 5' homologous arm and a 3' homologous arm capable of hybridizing to a high-expression site in the *Schizochytrium* microorganism genome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross-references to related applications

[0002] This application claims priority to Korean Patent Application No. 10-2023-0079290, filed on June 20, 2023, the entire disclosure of which is incorporated herein by reference.

[0003] This application relates to a DNA construct for high expression of a target gene in Schizochytrium microorganisms, and a method for expressing the target gene in Schizochytrium microorganisms using the construct. Background Technology

[0004] Recent advances in synthetic biology and metabolic engineering have rapidly accelerated the development and optimization of microbial cell factories through the utilization of increasingly sophisticated gene-editing technologies. While these gene-editing technologies are being rapidly applied to various microbial cell factories, the development of highly efficient strains based on these technologies has so far been primarily limited to model organisms such as *Escherichia coli*, *Corynebacterium* species, and yeast. Apart from a few model microalgal species, strain development technologies for microalgae are lacking. Specifically, in the case of strain development of *Schizochytridaceae* microalgae, some results regarding gene transformation have been reported, but there are no reports of breakthrough-level high expression of introduced genes.

[0005] If the expression level of the introduced gene cannot be ensured, it may be difficult to clearly identify phenotypic changes due to insufficient gene expression. Furthermore, in microalgae of the Schizochytriaceae family, gene introduction is performed through random insertion into any site throughout the genome; therefore, the expression level of the introduced gene will vary among different transformants depending on the insertion site. Differences in gene expression levels dependent on chromosomal integration sites have been studied in various microorganisms, including *Escherichia coli*, yeast, and microalgae such as *Nannochloropsis*. Based on these studies, strategies involving "transgene-specific insertion into loci characterized by high expression" have been developed and successfully applied to achieve high levels of transgene expression (Bioresource Technology 340 (2021) 125676).

[0006] In the development of Schizochytrium strains, "high gene expression" is necessary to ensure sufficient gene expression and minimize differences in gene expression among transformants, thereby achieving more stable transgene expression and accurate identification of the resulting phenotypic changes. The inventors introduced the green fluorescent protein (GFP) gene into Schizochytrium microalgae and subsequently identified the GFP gene insertion site in those transformants exhibiting high GFP expression through genomic analysis. Furthermore, the inventors selected the identified gene insertion site as a "high gene expression site" and developed a vector composition based on homologous recombination technology that can specifically insert the gene into this site. Finally, based on this vector composition, new microalgae with characteristics different from the parent strain were developed by high expression of various microalgal genes. Existing technology

[0007] (Non-patent document 1) Ae Jin Ryu, Byeong-ryool Jeong, Nam Kyu Kang, SeungjibJeon, Min Gi Sohn, Hyo Jin Yun, Jong Min Lim, Seok Won Jeong, Youn-Il Park, Won Joong Jeong, Sunghoon Park, Yong Keun Chang, Ki Jun Jeong, Safe-Harboring based novel genetic toolkit for Nannochloropsis salina CCMP1776: Efficientoverexpression of transgene via CRISPR / Cas9-Mediated Knock-in at thetranscriptional hotspot, Bioresource Technology, Volume 340, 2021, 125676,ISSN 0960-8524 Summary of the Invention

[0008] [Technical Issues]

[0009] One implementation provides a DNA construct for high expression of a target gene in Schizochytrium microorganisms.

[0010] The construct is used to insert a target gene into a target region within the genome of a genus *Schizochytrium*, where the target region may be a region highly expressed within the genome of a genus *Schizochytrium*.

[0011] More specifically, the DNA construct comprises a 5' homologous arm, a target gene, and a 3' homologous arm, and each of the 5' and 3' homologous arms can hybridize with the 5' and 3' regions of the target region (highly expressed region), respectively.

[0012] In one embodiment, the target region is a region corresponding to the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 in the genome of a genus *Schizochytrium*, or a region having 95% or higher homology with those nucleic acid sequences.

[0013] The 5' homologous arm can hybridize with a region within 20,000 bp upstream of the target gene insertion site within the target region, and / or

[0014] The 3' homologous arm can hybridize with regions located within 20,000 bp downstream of the target gene insertion site within the target region.

[0015] Another implementation provides a Schizochytrium microorganism comprising the DNA construct.

[0016] Other embodiments provide compositions for expressing a target gene in a Schizochytrium microorganism and / or compositions for producing a target product, comprising the DNA construct, a Schizochytrium microorganism comprising the DNA construct, or a combination thereof.

[0017] Other embodiments provide the use of the DNA construct, the Schizochytrium microorganism containing the DNA construct, or a combination thereof, for expressing the target gene and / or producing the target product in the Schizochytrium microorganism.

[0018] Other embodiments provide methods for producing Schizochytrium microorganisms for expressing target genes and / or producing target proteins, which include the step of introducing the DNA construct into Schizochytrium microorganisms.

[0019] Other embodiments provide methods for expressing target genes and / or producing target proteins in Schizochytrium microorganisms, which include the step of culturing Schizochytrium microorganisms containing the DNA construct.

[0020] [Technical Solution]

[0021] This application provides techniques for high expression of target genes in *Schizochytrium* microorganisms and / or for the production of target proteins in *Schizochytrium* microorganisms by identifying highly expressed regions in the genome of *Schizochytrium* microorganisms and designing DNA constructs capable of introducing target genes into the highly expressed regions.

[0022] Terminology Definition

[0023] In this application, the phrase "corresponding to" can refer to the amino acid sequence or nucleic acid sequence of the corresponding region identified by comparing the amino acid sequence or nucleic acid sequence of any polypeptide or polynucleotide with the specific amino acid sequence or nucleic acid sequence provided in this application. Such sequence alignment can be performed using conventional sequence alignment methods, such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), but not limited to these, as well as any sequence alignment program, pairwise sequence comparison algorithm, etc. known in the art, can be appropriately utilized.

[0024] In this application, the phrase "a polynucleotide or polypeptide contains a specific nucleic acid sequence (base sequence) or amino acid sequence, or is composed of a specific nucleic acid sequence (base sequence) or amino acid sequence" can mean that the polynucleotide or polypeptide substantially contains a specific nucleic acid sequence (base sequence) or amino acid sequence, and can be interpreted as including (or not excluding) "substantially equivalent sequences" in which mutations (deletions, substitutions, modifications and / or additions) are added to the specific nucleic acid sequence (base sequence) or amino acid sequence to the extent that the original function and / or desired function of the polynucleotide or polypeptide is maintained. In one embodiment, the statement that a polynucleotide or polypeptide “comprising, or consisting of, a specific nucleic acid sequence (base sequence) or amino acid sequence” can mean that the polynucleotide or polypeptide (i) substantially comprises a specific nucleic acid sequence (base sequence) or amino acid sequence, or (ii) substantially comprises a sequence having a content of at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 98% of the specific nucleic acid sequence (base sequence) or amino acid sequence. The nucleic acid or amino acid sequence having at least 99%, at least 99.5%, or at least 99.9% homology or identity with a specific nucleic acid sequence (base sequence) or amino acid sequence and retaining its original or desired function, or consisting of a nucleic acid or amino acid sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology or identity with the specific nucleic acid sequence (base sequence) or amino acid sequence and retaining its original or desired function. In one embodiment, the desired function may refer to the high expression function of the gene in Schizochytrium microorganisms.

[0025] In this application, "homology" refers to the percentage of identity between two polynucleotide or polypeptide motifs. Sequence homology between one motif and another can be determined using known techniques. For example, homology can be determined by directly aligning sequence information and comparing parameters such as score, identity, and similarity between two polynucleotide or polypeptide molecules using readily available computer programs. Computer programs may include BLAST (NCBI), CLC MainWorkbench (CLC bio), MegAlign™ (DNASTAR Inc), etc. Furthermore, homology between polynucleotides can be determined by hybridizing polynucleotides under conditions that form stable duplexes between homologous regions, then digesting them with a single-strand-specific nuclease and determining the size of the digested fragment.

[0026] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, and can be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.

[0027] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms and can be combined with default gap penalties established by the program used. In practice, homologous or identical sequences can often hybridize with all or part of the sequence under moderately or highly stringent conditions. It should be understood that hybridization also includes hybridization with polynucleotides containing a common codon or codons that take codon degeneracy into account.

[0028] Whether any two polynucleotide or polypeptide sequences are homologous, similar, or identical can be determined using known computer algorithms, such as the “FASTA” program with default parameters, as in Pearson et al. (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) implemented in the Needleman program (version 5.0.0 or later) of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) can be used with the GCG package (Devereux, J. et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.][F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994 and [CARILLO ETA / .](1988) SIAMJ Applied Math 48: 1073) to determine. For example, BLAST or ClustalW from the National Biotechnology Information Database Center can be used to determine homology, similarity, or identity.

[0029] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using GAP computer programs, such as those of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In short, the GAP procedure can be defined as the total number of symbols in the shorter sequence of two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters of the GAP program include (1) a binary comparison matrix (containing a value of 1 for identity and a value of 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, or a weighted comparison matrix (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix) as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745); (2) a penalty of 3.0 for each vacancy and an additional penalty of 0.10 for each symbol in each vacancy (or a penalty of 10 for vacancy opening and 0.5 for vacancy extension); and (3) no penalty for terminal vacancy.

[0030] In this application, "polynucleotide" refers to a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA chain of a certain length or longer, and more specifically, a polynucleotide fragment encoding a variant.

[0031] In this application, the term "homologous arm" refers to a nucleic acid sequence used for gene insertion into a target region, and may refer, for example, a nucleic acid sequence used for gene insertion via homologous recombination (HR). More specifically, a homologous arm may refer to a sequence capable of hybridizing with the 5' end (or left or upstream) region of the target nucleic acid sequence site (5' homologous arm, left arm, or upstream arm) and / or a sequence capable of hybridizing with the 3' end (or right or downstream) region (3' homologous arm, right arm, or downstream arm). The 5'-end (or left or upstream) region and the 3'-end (or right or downstream) region may refer to, but are not limited to, the region located within approximately 100 kbp to the 5' end (or left or upstream) and the region located within approximately 100 kbp to the 3' end (or right or downstream) of the target region. The 5'-terminal (or left or upstream) arm and the 3'-terminal (or right or downstream) arm may each have a length of approximately 10 bp to approximately 5,000 bp, but are not limited thereto.

[0032] In this application, the term "capable of hybridizing or hybridizable" for a given nucleic acid sequence region can refer to a state in which the nucleic acid sequence can form a double strand with the nucleic acid sequence by including a sequence that is fully or partially complementary to the nucleic acid sequence region.

[0033] In this application, when the term “hybridization” is used for homologous arms, it can be interpreted as having the same meaning as “homological recombination”, and the two terms can be used interchangeably.

[0034] In this application, the term "about" described before a numerical value can be used to refer holistically to a numerical value within a range equivalent to or similar to the numerical value described thereafter. In one embodiment, an equivalent or similar range may refer to, but is not limited to, a range of ±20%, ±15%, ±10%, ±5%, ±3%, ±2%, or ±1% of the stated value.

[0035] The invention will be described in more detail below.

[0036] One implementation provides a DNA construct for inserting a target gene into a target region (highly expressed region) within the genome of a Schizochytrium microorganism.

[0037] More specifically, the DNA construct may include a 5' homologous arm, a target gene, and a 3' homologous arm.

[0038] In other words, the DNA construct can have the following structure:

[0039] 5'-[X]-[Y]-[Z]-3' (Equation 1)

[0040] In this formula, X represents the 5' homologous arm, Y represents the target gene, and Z represents the 3' homologous arm.

[0041] The DNA construct can be used to insert the target gene into a target region within the genome of a Schizochytrium microorganism.

[0042] The target region can be a region of high gene expression within the genome of a genus of Schizochytrium.

[0043] In one embodiment, the target region may be a region corresponding to SEQ ID NO: 1 (Contig 3, 2001468 (HindIII), SCH_00001433), SEQ ID NO: 2 (Contig 3, 1116023 (HindIII), SCH_00001298), or a nucleic acid sequence in the genome of a genus Schizochytrium that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% homology with it.

[0044] The sequence of the target regions in this application is shown in Table 1 below.

[0045] [Table 1]

[0046]

[0047]

[0048] The 5' homologous arm can be located approximately 100,000 bp upstream or in the 5' direction of the target region (a region of high gene expression, more specifically, based on the target gene insertion site within the target region). This is e.g., approximately 1 bp to approximately 100,000 bp, approximately 1 bp to approximately 50,000 bp, approximately 1 bp to approximately 10,000 bp, approximately 1 bp to approximately 7,500 bp, approximately 1 bp to approximately 5,000 bp, approximately 1 bp to approximately 2,500 bp, approximately 1 bp to approximately 2,000 bp, approximately 1 bp to approximately 1,500 bp, approximately 1 bp to approximately 1,400 bp, approximately 1 bp to approximately 1,300 bp, approximately 1 bp to approximately 1,200 bp, approximately 1 bp to approximately 1,100 bp, approximately 1 bp to approximately 1,000 bp, approximately 1 bp to approximately 750 bp, or approximately 1 bp to approximately 500 bp. All or part of a region within a bp (e.g., a region whose length corresponds to the length of a homologous arm and is capable of hybridization with a homologous arm (homologous recombination)) hybridizes (homologous recombination). The 5' homologous arm may have lengths ranging from approximately 10 bp to approximately 5,000 bp, approximately 10 bp to approximately 4,000 bp, approximately 10 bp to approximately 3,000 bp, approximately 10 bp to approximately 2,000 bp, approximately 10 bp to approximately 1,500 bp, approximately 10 bp to approximately 1,400 bp, approximately 10 bp to approximately 1,300 bp, approximately 10 bp to approximately 1,200 bp, approximately 10 bp to approximately 1,100 bp, approximately 10 bp to approximately 1,000 bp, approximately 20 bp to approximately 5,000 bp, approximately 20 bp to approximately 4,000 bp, approximately 20 bp to approximately 3,000 bp, approximately 20 bp to approximately 2,000 bp, approximately 20 bp to approximately 1,500 bp, approximately 20 bp to approximately 1,400 bp, and approximately 20 bp to approximately 1,300 bp. bp, approximately 20 bp to approximately 1,200 bp, approximately 20 bp to approximately 1,100 bp, approximately 20 bp to approximately 1,000 bp, approximately 23 bp to approximately 5,000 bp, approximately 23 bp to approximately 4,000 bp, approximately 23 bp to approximately 3,000 bp, approximately 23 bp to approximately 2,000 bp, approximately 23 bp to approximately 1,500 bp, approximately 23 bp to approximately 1,400 bp, approximately 23 bp to approximately 1,300 bp, approximately 23 bp to approximately 1,200 bp, approximately 23 bp to approximately 1,100 bp, approximately 23 bp to approximately 1,000 bp, approximately 100 bp to approximately 5,000 bp, approximately 100 bp to approximately 4,000 bp, approximately 100 bp to approximately 3,000 bp, approximately 100 bp to approximately 2,000 bp, approximately 100 bp From approximately 1,500 bp to approximately 1,400 bp, from approximately 100 bp to approximately 1,300 bp, approximately 100 bp to approximately 1,200 bp, approximately 100 bp to approximately 1,100 bp, approximately 100 bp to approximately 1,000 bp, approximately 250 bp to approximately 5,000 bp, approximately 250 bp to approximately 4,000 bp, approximately 250 bp to approximately 3,000 bp, approximately 250 bp to approximately 2,000 bp, approximately 250 bp to approximately 1,500 bp, approximately 250 bp to approximately 1,400 bp, approximately 250 bp to approximately 1,300 bp, approximately 250 bp to approximately 1,200 bp, approximately 250 bp to approximately 1,100 bp, approximately 250 bp to approximately 1,000 bp, approximately 500 bp to approximately 5,000 bp, approximately 500 bp to approximately 4,000 bp, approximately 500 bp to approximately 3,000 bp. bp, approximately 500 bp to approximately 2,000 bp, approximately 500 bp to approximately 1,500 bp, approximately 500 bp to approximately 1,400 bp, approximately 500 bp to approximately 1,300 bp, approximately 500 bp to approximately 1,200 bp, approximately 500 bp to approximately 1,100 bp, approximately 500 bp to approximately 1,000 bp, approximately 750 bp to approximately 5,000 bp, approximately 750 bp to approximately 4,000 bp, approximately 750 bp to approximately 3,000 bp, approximately 750 bp to approximately 2,000 bp, approximately 750 bp to approximately 1,500 bp, approximately 750 bp to approximately 1,400 bp, approximately 750 bp to approximately 1,300 bp, approximately 750 bp to approximately 1,200 bp, approximately 750 bp to approximately 1,100 bp, approximately 750 bp Lengths ranging from approximately 900 bp to approximately 1,000 bp, approximately 900 bp to approximately 5,000 bp, approximately 900 bp to approximately 4,000 bp, approximately 900 bp to approximately 3,000 bp, approximately 900 bp to approximately 2,000 bp, approximately 900 bp to approximately 1,500 bp, approximately 900 bp to approximately 1,400 bp, approximately 900 bp to approximately 1,300 bp, approximately 900 bp to approximately 1,200 bp, approximately 900 bp to approximately 1,100 bp, or approximately 900 bp to approximately 1,000 bp, but not limited to these.

[0049] Furthermore, the 3' homologous arm can be located approximately 100,000 bp downstream of the target region (a region of high gene expression, more specifically, based on the target gene insertion site within the target region) in the 3' direction or downstream (e.g., approximately 1 bp to approximately 100,000 bp, approximately 1 bp to approximately 50,000 bp, approximately 1 bp to approximately 10,000 bp, approximately 1 bp to approximately 7,500 bp, approximately 1 bp to approximately 5,000 bp, approximately 1 bp to approximately 2,500 bp, approximately 1 bp to approximately 2,000 bp, approximately 1 bp to approximately 1,500 bp, approximately 1 bp to approximately 1,400 bp, approximately 1 bp to approximately 1,300 bp, approximately 1 bp to approximately 1,200 bp, approximately 1 bp to approximately 1,100 bp, approximately 1 bp to approximately 1,000 bp, approximately 1 bp to approximately 750 bp, or approximately 1... All or part of a region within a range of approximately 500 bp (e.g., a region whose length corresponds to the length of a homologous arm and is capable of hybridization with a homologous arm (homologous recombination)) hybridizes (homologous recombination). The 3' homologous arm may have lengths ranging from approximately 10 bp to approximately 5,000 bp, approximately 10 bp to approximately 4,000 bp, approximately 10 bp to approximately 3,000 bp, approximately 10 bp to approximately 2,000 bp, approximately 10 bp to approximately 1,500 bp, approximately 10 bp to approximately 1,400 bp, approximately 10 bp to approximately 1,300 bp, approximately 10 bp to approximately 1,200 bp, approximately 10 bp to approximately 1,100 bp, approximately 10 bp to approximately 1,000 bp, approximately 20 bp to approximately 5,000 bp, approximately 20 bp to approximately 4,000 bp, approximately 20 bp to approximately 3,000 bp, approximately 20 bp to approximately 2,000 bp, approximately 20 bp to approximately 1,500 bp, approximately 20 bp to approximately 1,400 bp, and approximately 20 bp to approximately 1,300 bp. bp, approximately 20 bp to approximately 1,200 bp, approximately 20 bp to approximately 1,100 bp, approximately 20 bp to approximately 1,000 bp, approximately 23 bp to approximately 5,000 bp, approximately 23 bp to approximately 4,000 bp, approximately 23 bp to approximately 3,000 bp, approximately 23 bp to approximately 2,000 bp, approximately 23 bp to approximately 1,500 bp, approximately 23 bp to approximately 1,400 bp, approximately 23 bp to approximately 1,300 bp, approximately 23 bp to approximately 1,200 bp, approximately 23 bp to approximately 1,100 bp, approximately 23 bp to approximately 1,000 bp, approximately 100 bp to approximately 5,000 bp, approximately 100 bp to approximately 4,000 bp, approximately 100 bp to approximately 3,000 bp, approximately 100 bp to approximately 2,000 bp, approximately 100 bp From approximately 1,500 bp to approximately 1,000 bp, and from approximately 100 bp to approximately 1,400 bp, approximately 100 bp to approximately 1,300 bp, approximately 100 bp to approximately 1,200 bp, approximately 100 bp to approximately 1,100 bp, approximately 100 bp to approximately 1,000 bp, approximately 250 bp to approximately 5,000 bp, approximately 250 bp to approximately 4,000 bp, approximately 250 bp to approximately 3,000 bp, approximately 250 bp to approximately 2,000 bp, approximately 250 bp to approximately 1,500 bp, approximately 250 bp to approximately 1,400 bp, approximately 250 bp to approximately 1,300 bp, approximately 250 bp to approximately 1,200 bp, approximately 250 bp to approximately 1,100 bp, approximately 250 bp to approximately 1,000 bp, approximately 500 bp to approximately 5,000 bp, approximately 500 bp bp to approximately 4,000 bp, approximately 500 bp to approximately 3,000 bp, approximately 500 bp to approximately 2,000 bp, approximately 500 bp to approximately 1,500 bp, approximately 500 bp to approximately 1,400 bp, approximately 500 bp to approximately 1,300 bp, approximately 500 bp to approximately 1,200 bp, approximately 500 bp to approximately 1,100 bp, approximately 500 bp to approximately 1,000 bp, approximately 750 bp to approximately 5,000 bp, approximately 750 bp to approximately 4,000 bp, approximately 750 bp to approximately 3,000 bp, approximately 750 bp to approximately 2,000 bp, approximately 750 bp to approximately 1,500 bp, approximately 750 bp to approximately 1,400 bp, approximately 750 bp to approximately 1,300 bp, approximately 750 bp to approximately 1,200 bp. The lengths are approximately 750 bp to approximately 1,100 bp, approximately 750 bp to approximately 1,000 bp, approximately 900 bp to approximately 5,000 bp, approximately 900 bp to approximately 4,000 bp, approximately 900 bp to approximately 3,000 bp, approximately 900 bp to approximately 2,000 bp, approximately 900 bp to approximately 1,500 bp, approximately 900 bp to approximately 1,400 bp, approximately 900 bp to approximately 1,300 bp, approximately 900 bp to approximately 1,200 bp, approximately 900 bp to approximately 1,100 bp, or approximately 900 bp to approximately 1,000 bp, but are not limited to these.

[0050] The insertion site of the target gene within the target region (the region of high gene expression) can be any site included in the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 described herein. Those skilled in the art can appropriately set the insertion site of the target gene considering the purpose, conditions, and desired effects. For example, the gene insertion site belonging to the middle site of the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 can be arbitrarily determined (e.g., within 800 bp to 1200 bp from the 5' end to the 3' end), and vectors including upstream sequences (5' homologous arms) and downstream sequences (3' homologous arms) based on this site can be generated and used, but are not limited thereto.

[0051] The target gene refers to the gene to be inserted into the genome of a Schizochytrium microorganism, and may be a gene to be expressed in the Schizochytrium microorganism and / or a gene encoding a protein (target protein) to be produced in the Schizochytrium microorganism. In the DNA construct provided in this application, there may be one or two or more target genes (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10).

[0052] In one implementation, the target gene may be a coding gene of the target protein, a non-coding sequence such as a regulatory sequence (e.g., a transcription factor), or a combination thereof.

[0053] In one embodiment, the target protein can refer to any protein that can be used in various industrial fields (such as pharmaceuticals, drugs, food, cosmetics, agriculture, feed, and fertilizers). In one embodiment, the target protein can be at least one selected from the group consisting of: antibodies (e.g., mammalian (e.g., human) immunoglobulins (IgG (e.g., IgG1, IgG2, IgG3, IgG4, etc.), IgA, IgD, IgM, IgE, etc.), portions of antibodies (e.g., heavy chain variable regions and / or light chain variable regions, heavy chains and / or light chains, Fc, CH3, CH2-CH3, hinges, etc.), antibody fragments (e.g., Fab fragments, F(ab)2 fragments, Fv, scFv, scFv-Fc, etc.), antibody analogs (e.g., multi-antibodies containing multiple antigen-binding domains (e.g., biantibodies, triantibodies, tetraantibodies, etc.), single-domain antibodies, affinity molecules, etc.), receptors, growth factors, enzymes, hormones, transport (or efflux) proteins, fluorescent proteins, etc., but not limited thereto.

[0054] Considering the genome size of the host cell (a *Schizochytrium* microorganism), the target gene can have a total length of approximately 30 to 100,000 bp, 30 to 75,000 bp, 30 to 5,000 bp, 30 to 25,000 bp, 30 to 20,000 bp, 30 to 15,000 bp, 30 to 10,000 bp, 30 to 7,500 bp, 30 to 5,000 bp, 30 to 2,500 bp, 30 to 1,000 bp, 100 to 100,000 bp, 100 to 75,000 bp, 100 to 5,000 bp, 100 to 25,000 bp, 100 to 20,000 bp, 100 to 15,000 bp, 100 to 10,000 bp. The range is bp, 100 to 7,500 bp, 100 to 5,000 bp, 100 to 2,500 bp or 100 to 1,000 bp, but is not limited to these.

[0055] In one embodiment, the DNA construct may be an expression vector for expressing a target gene in a Schizochytrium microorganism.

[0056] In one embodiment, when the target gene is a protein-coding sequence, the DNA construct may further include one or more expression regulatory sequences (transcriptional and / or translational regulatory elements), such as origin of replication, promoter, enhancer, polyadenylation signal, terminator, protein transport and / or degradation signal, etc. In this case, the regulatory element can be operatively linked to the target gene. In another embodiment, the DNA construct may further include one or more elements selected from the group consisting of selection markers, reporter genes, etc., to examine genome integration.

[0057] Selection markers are used to check whether a DNA construct has been inserted into the genome of a *Schizochytrium* microorganism, or to select *Schizochytrium* strains that have had a DNA construct inserted, and can be appropriately selected and used from all selection markers available for selecting *Schizochytrium* strains. For example, markers conferring selectable phenotypes (such as antimicrobial (antibiotic) resistance, nutritional requirements (metabolic enzymes), cytotoxic agent resistance, or expression of surface variant proteins) can be used, but are not limited thereto. For example, selection markers can be selected from at least one of the following groups: ampicillin resistance genes, tetracycline resistance genes, kanamycin resistance genes, chloramphenicol resistance genes, streptomycin resistance genes, neomycin resistance genes, blastomycin resistance genes, bleomycin resistance genes, hygromycin resistance genes, puromycin resistance genes, paromomycin resistance genes, thymidine kinase (TK) genes, dihydrofolate reductase (DHFR) genes, glutamine synthase (GS) genes, etc., but are not limited thereto. Examples of reporter genes include, but are not limited to, one or more selected from the group consisting of fluorescent proteins such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), and luciferase.

[0058] Inserting DNA constructs into the genome of Schizochytrium microorganisms can be achieved by selecting one or more of the following groups: homologous recombination (e.g., homologous directed repair (HDR)), non-homologous end joining (NHEJ), etc., but is not limited to these.

[0059] The DNA construct can be used to deliver and / or insert the target gene into the genome of Schizochytrium microorganisms (e.g., insert into a highly expressed region), and / or to express the target gene in Schizochytrium microorganisms.

[0060] Furthermore, as described above, the DNA construct can insert the target gene into a highly expressed region in the genome of a Schizochytrium microorganism, and thus can have the function of expressing (e.g., highly expressing) the target gene or producing (e.g., producing at high levels) "metabolites (intermediates and / or final products) of the target protein encoded by the target gene and / or the metabolic pathways in which the target protein is involved" (hereinafter referred to as "target products") in Schizochytrium microorganisms.

[0061] Therefore, the DNA construct can have the following functions:

[0062] Delivering and / or inserting the target gene into the genome of a genus Schizochytrium (e.g., within the target region (highly expressed region));

[0063] Expressing the target gene in *Schizochytrium* microorganisms;

[0064] Production of target products in *Schizochytrium* microorganisms;

[0065] Or a combination of two or more of the above.

[0066] Therefore, another embodiment provides a composition for inserting and / or delivering a target gene into the genome of a Schizochytrium microorganism (e.g., within a target region (high expression region)), and / or a composition for expressing the target gene in a Schizochytrium microorganism, comprising the aforementioned DNA construct.

[0067] Another implementation provides the use of DNA constructs for inserting and / or delivering a target gene into the genome of a genus Schizochytrium (e.g., within a target region (highly expressed region)) and / or for expressing the target gene in a genus Schizochytrium.

[0068] Other embodiments provide methods for inserting and / or delivering a target gene into the genome of a Schizochytrium microorganism (e.g., into a target region (highly expressed region)), methods for expressing a target gene in a Schizochytrium microorganism, and / or methods for producing a Schizochytrium microorganism for producing a target product, said methods including the step of introducing a DNA construct into a Schizochytrium microorganism.

[0069] Another implementation provides a Schizochytrium microorganism containing the aforementioned DNA construct.

[0070] In this application, the *Schizochytrium* microorganism may be at least one selected from the group consisting of *Schizochytrium limacinum*, *Schizochytrium mangrovei*, *Schizochytrium aggregatum*, and *Schizochytrium minutum*, but is not limited thereto. More specifically, the *Schizochytrium* microorganism may be at least one selected from the following strains, but is not limited thereto:

[0071] Schizochytrium CD01-5000 (KCTC 14344BP),

[0072] Schizochytrium CD01-5004 (KCTC 14345BP),

[0073] Schizochytrium CD01-1821 (KCTC 14660BP),

[0074] Schizochytrium CD01-2147 (KCTC 14661BP),

[0075] Schizochytrium CD01-1003 (KCTC 15201BP),

[0076] Schizochytrium CD02-8025 (KCTC 15246BP), and

[0077] Schizochytrium CD03-7004 (KCTC 15006BP).

[0078] A *Schizochytridica* microorganism containing the DNA construct provided in this application, compared to a *Schizochytridica* microorganism not containing the DNA construct (e.g., a wild-type *Schizochytridica* microorganism and / or a *Schizochytridica* microorganism containing the DNA construct in a region outside the target region), may have increased expression of the target gene contained in the DNA construct, and / or increased production of the target product associated with the target gene (the target protein encoded by the target gene and / or metabolites (intermediates and / or final products) of the metabolic pathway in which the target protein participates).

[0079] Another embodiment provides a composition for producing a target product, comprising the above-described DNA construct, a Schizochytrium microorganism comprising the DNA construct, or a combination thereof.

[0080] Another embodiment provides the use of the DNA construct, a Schizochytrium microorganism comprising the DNA construct, or a combination thereof, for the production of the target product.

[0081] Another embodiment provides a method for producing a target product from a *Schizochytrium* microorganism, comprising the step of culturing a *Schizochytrium* microorganism containing the DNA construct. The method may further include a step of preparing the *Schizochytrium* microorganism containing the DNA construct prior to the culturing step.

[0082] The preparation steps may include the steps of producing or obtaining *Schizochytrium* microorganisms containing the DNA construct. In one embodiment, the step of preparing *Schizochytrium* microorganisms containing the DNA construct may include the step of introducing the DNA construct into *Schizochytrium* microorganisms. In one embodiment, when the DNA construct is introduced into *Schizochytrium* microorganisms via a target region-specific endonuclease system, the step of introducing the DNA construct into *Schizochytrium* microorganisms may further include the step of introducing a target region-specific endonuclease system into *Schizochytrium* microorganisms.

[0083] The cultivation process can be carried out under typical conditions suitable for culturing *Schizochytrium* microorganisms and / or gene expression in *Schizochytrium* microorganisms. Cultivation refers to the growth of *Schizochytrium* microorganisms under appropriately controlled environmental conditions. Cultivation can be carried out according to suitable culture media and cultivation conditions known in the art for *Schizochytrium* microorganisms, and can be appropriately modified by those skilled in the art. Cultivation methods may include, but are not limited to, batch culture, continuous culture, fed-batch culture, or combinations thereof. Culture medium refers to material containing nutrients required for culturing the *Schizochytrium* microorganisms of this application as a major component, and can be used to provide nutrients and growth factors, including water necessary for survival and growth. Specifically, culture media and other cultivation conditions can be used without any particular limitations, as long as they are culture media and cultivation conditions commonly used for culturing *Schizochytrium* microorganisms; however, in one embodiment, cultivation can be carried out in a common culture medium containing carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins suitable for culturing *Schizochytrium* microorganisms, while controlling temperature, pH, humidity, atmospheric conditions, etc.

[0084] The method for producing the target product may further include steps of isolating, recovering, and / or purifying the target product after the cultivation step. Isolation, recovery, and / or purification can be carried out under typical conditions for Schizochytrium microorganisms.

[0085] [Beneficial Effects]

[0086] The novel vector composition of this invention comprises a sequence homologous to a gene overexpression site identified in *Schizochytrium* strains within a range of +20 kbp to -20 kbp. The gene overexpression vector has a left-hand homologous sequence and a right-hand homologous sequence to the gene overexpression site, and between these two sequences are a promoter, a target gene, and a terminator for gene overexpression. Gene overexpression vectors utilizing gene overexpression sites will contribute to expanding gene expression technologies based on the *Schizochytrium* genus and accelerating strain development. Attached Figure Description

[0087] Figure 1 This is a graph showing the fluorescence analysis results of Schizochytrium transformants, including green fluorescent protein.

[0088] Figure 2 These are gel electrophoresis images showing the results of PCR analysis to determine whether homologous recombination occurs at each site used for gene overexpression.

[0089] Figure 3 This is a graph comparing the fluorescence intensity of the transformants in which the green fluorescent protein gene was inserted into a highly expressed gene site (site 1) based on homologous recombination.

[0090] Figure 4This is a graph comparing the fluorescence intensity of the transformants in which the green fluorescent protein gene was inserted into a highly expressed gene site (site 2) based on homologous recombination.

[0091] Figure 5 This is the cleavage pattern of pUC19-sfGFP-Zeo.

[0092] Figure 6 This is the cleavage pattern of pUC19-HR(site 1)-GsfGFPZeoG-HR(site 1). Detailed Implementation

[0093] [Patterns of Invention]

[0094] The present application will be described in more detail below through embodiments and experimental examples. However, these embodiments and experimental examples are intended to illustrate the present application, and the scope of the present application is not limited to these embodiments and experimental examples.

[0095] Example 1: Identification of gene overexpression sites in the microalgae Schizochytrium

[0096] To identify high-expression sites of genes in the microalgae *Schizochytrium*, the gene encoding green fluorescent protein was inserted into pUC19 (plasmid #50005, Addgene) to produce a vector composition expressing green fluorescent protein (pUC19-sfGFP-Zeo) (see [link to original text]). Figure 5 Then, it is transferred into microalgae.

[0097] The nucleic acid sequence (SEQ ID NO: 3) of the gene encoding green fluorescent protein (GFP) is as follows:

[0098] cgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggac

[0099] A 250 mL flask was filled with 50 mL of GYPS medium (20 g / L glucose, 6 g / L peptone, 2 g / L yeast extract, 12.5 g / L sea salt, 17.1 g / L sucrose), inoculated with *Schizochytrium* CD01-2147 (KCTC 14661BP), and cultured for 48 hours. The cultured microalgae were transferred to two EP tubes (1 mL each) and centrifuged for 1 minute. After removing the supernatant from the centrifuged microalgae culture, the separated microalgae precipitate was dissolved in 1X BSS solution (10 mM KCl, 10 mM NaCl, and 3 mM CaCl2) and centrifuged. After removing the supernatant from the centrifuged sample, the microalgae precipitate was dissolved in 50 mM sucrose and centrifuged. This process was repeated three times. After removing the supernatant, 0.1 mL of 50 mM sucrose was added to the microalgae precipitate to dissolve it.

[0100] Using an expression vector for green fluorescent protein obtained by electroporation ( Figure 5 The microalgae prepared by transformation yielded a total of 105 Schizochytrium transformants carrying the green fluorescent protein gene. These transformants (in which the green fluorescent protein gene was inserted into any locus) could exhibit different levels of fluorescence expression.

[0101] To analyze the GFP expression levels of 105 test transformants, the fluorescence intensity of each transformant was measured and compared. More specifically, flow cytometry was used to detect fluorescence at a wavelength of 509 nm, which is the fluorescence emission wavelength of green fluorescent protein. The fluorescence intensity emitted by each transformant near this wavelength was measured, and the results are as follows: Figure 1 As shown.

[0102] Based on fluorescence intensity measurements, the top six transformants exhibiting the highest fluorescence intensity were selected.

[0103] By analyzing the gene insertion sites of the first six transformants with high fluorescence expression levels, the high gene expression sites were finally identified.

[0104] Therefore, through genetic analysis of the six selected transformants, it was confirmed that the exogenous gene (green fluorescent protein gene) was inserted into the same site in five of the six transformants: Contig 3, 2001468 (SEQ ID NO:1) (HindIII, SCH_00001433, similar to AIH: guanidine deaminase (Arabidopsis thaliana)) (hereinafter, the corresponding high-expression site is designated as site 1), and inserted into Contig 3, 1116023 (SEQ ID NO: 2) (HindIII, SCH_00001298, similar to cyc: cytochrome C (Lamprey)) (hereinafter, the corresponding high-expression site is designated as site 2).

[0105] Example 2: High expression of exogenous genes in Schizochytrium microalgae by entering high expression sites through homologous recombination.

[0106] The feasibility of using the gene overexpression sites identified in Example 1 to overexpress the gene was demonstrated through homologous recombination-based transformation. The green fluorescent protein gene was inserted into sites 1 (SEQ ID NO: 1) and 2 (SEQ ID NO: 2) identified in Example 1 using homologous recombination or random insertion.

[0107] The vector design for homologous recombination is as follows: based on the insertion site within the gene high expression site (site 1 or site 2), amplify sequences of 800-1,500 bp in length on both sides to ensure the arm sequence for homologous recombination.

[0108] Table 2 lists the representative arm sequences used in this embodiment:

[0109] [Table 2]

[0110]

[0111]

[0112] In addition, the gene encoding green fluorescent protein, the antibiotic resistance gene expression site, and the backbone were obtained from the vector (pUC19-sfGFP-Zeo) used for random insertion in Example 1. Figure 5 The sequences were amplified using Gibson Assembly® (NEB) and arm sequences amplified from sites 1 and 2 for homologous recombination, respectively, to generate homologous recombination vectors targeting sites 1 and 2. To illustrate the structure of the homologous recombination vectors, Figure 6 The document describes the homologous recombination vector targeting site 1 (pUC19-HR(site 1)-GsfGFPZeoG-HR(site 1)).

[0113] The primer sequences used to construct homologous recombination vectors are described below:

[0114] (Primers used to amplify the gene encoding green fluorescent protein into an antibiotic resistance gene)

[0115] Forward primer: CCTCCTCTTCTGTTCGTGCAAGCATATGACGGTACCCTTGATCTTGTG (SEQ ID NO:8)

[0116] Reverse primer: AGGGGCCATGTGGAGTTTCAGAATATTGGCATGCCTTGAAGC (SEQ ID NO: 9)

[0117] (skeleton)

[0118] Forward primer: ATCATCATTGACACATCTAATGTTGTTAAGCTTGGCGTAATCATG (SEQ ID NO:10)

[0119] Reverse primer: CCGGTTATGAGATCGGGCCTCGTGCACTGAGCTCGAATTCACTGG (SEQ ID NO:11)

[0120] To construct a vector for random insertion, the sequence from promoter to terminator was amplified by PCR from the vector (pUC1 9-sfGFP-Zeo) constructed in Example 1.

[0121] Transformation of *Schizochytrium* microalgae was performed using electroporation with the prepared vector and amplified PCR products. Transformants were obtained by screening on a medium containing antibiotics (zeocin).

[0122] Genotypic and phenotypic analyses were performed on homologous recombination transformants transformed with vectors prepared for homologous recombination and random insertion transformants transformed with vectors prepared for random insertion. Expression levels (fluorescence intensity) were measured and compared based on the presence of gene insertion at high expression sites (see Example 1).

[0123] Transformants were obtained by inserting green fluorescent protein (GFP) into a high-expression site of the gene via homologous recombination. Thirty transformants were obtained from each site. Genotyping was performed on a total of 60 transformants using polymerase chain reaction (PCR). Two oligomers were designed for PCR: one selectively binding to the high-expression site of the gene expression site, and the other selectively binding to the inserted GFP gene. PCR was performed using this oligomer pair.

[0124] The primer sequences used for site 1 transformation verification are as follows:

[0125] Forward primer: TTCCTTCTGAAGAAGGGTCGTTGGTCT (SEQ ID NO: 12)

[0126] Reverse primer: CCAGGAAAGGACTTGAGATG (SEQ ID NO: 13)

[0127] The primer sequences used for site 2 transformation verification are as follows:

[0128] Forward primer: GAAAAAGGACTTGTGCCTC (SEQ ID NO: 14)

[0129] Reverse primer: CCAGGAAAGGACTTGAGATG (SEQ ID NO: 15)

[0130] The PCR reaction conditions are as follows:

[0131] Tm: 53℃, Cycles: 35, Taq polymerase

[0132] This PCR method yields approximately 1500 bp DNA fragments when the green fluorescent protein gene is inserted into each gene's high-expression site (site 1 and site 2) via homologous recombination.

[0133] PCR results as follows Figure 2 As shown. Figure 2 As shown, when attempting green fluorescent protein transformation based on homologous recombination at site 1, gene insertion at site 1 was confirmed in 2 out of a total of 30 transformants (1 and 7). Furthermore, for site 2, gene insertion based on homologous recombination was confirmed in 11 out of a total of 30 transformants (2, 5, 6, 8, 13, 14, 16, 18, 19, 20, and 29).

[0134] As described above, the expression levels of green fluorescent protein (GFP) in 30 transformants (60 in total) obtained through homologous recombination at each gene hyperexpression site were measured and compared. GFP expression levels were measured by inoculating each *Schizochytrium* transformant into a 250 mL flask containing 50 mL of GYPS medium, culturing for 48 hours, and observing fluorescence intensity. For comparison, wild-type (WT) strains without GFP gene insertion were used as controls.

[0135] The results are shown in Figure 3 (Fluorescence intensity of transformants at the high expression site (site 1) of the GFP gene insertion site) and Figure 4 (Fluorescence intensity of the transformant at the high expression site (site 2) of the GFP gene insertion gene).

[0136] like Figure 3 As shown, the mean fluorescence expression level (AU) of homologous recombination transformants 1 and 7 based on site 1 (the site of high gene expression) was 714.61, and this expression level was confirmed to be higher than the mean fluorescence expression level (499.51) of 28 transformants in which the gene was randomly inserted into other genomic sites.

[0137] In addition, such as Figure 4As shown, the mean fluorescence expression level (AU) of the 11 homologous recombination transformants based on site 2 (the site of high gene expression) was 841.54, and this expression level was confirmed to be higher than the mean fluorescence expression level (657.05) of the 19 transformants in which the gene was randomly inserted into other genomic sites.

[0138] Furthermore, when the transformants were sorted in descending order according to their fluorescence expression levels, it was confirmed that the transformants with the green fluorescent protein gene specifically inserted into the high expression sites (site 1, site 2) through homologous recombination had higher overall fluorescence expression levels.

[0139] [Login ID]

[0140] Preservation Institution: Korea Institute of Biotechnology, Bioresource Center (KCTC)

[0141] Login ID: KCTC14344BP

[0142] Deposit date: 20201026

[0143] Preservation Institution: Korea Institute of Biotechnology, Bioresource Center (KCTC)

[0144] Login ID: KCTC14345BP

[0145] Deposit date: 20201026

[0146] Preservation Institution: Korea Institute of Biotechnology, Bioresource Center (KCTC)

[0147] Login ID: KCTC14660BP

[0148] Deposit date: 20210823

[0149] Preservation Institution: Korea Institute of Biotechnology, Bioresource Center (KCTC)

[0150] Login ID: KCTC14661BP

[0151] Deposit date: 20210823

[0152] Preservation Institution: Korea Institute of Biotechnology, Bioresource Center (KCTC)

[0153] Login ID: KCTC15201BP

[0154] Preservation date: 20221121

[0155] Preservation Institution: Korea Institute of Biotechnology, Bioresource Center (KCTC)

[0156] Login ID: KCTC15246BP

[0157] Deposit date: 20221215

[0158] Preservation Institution: Korea Institute of Biotechnology, Bioresource Center (KCTC)

[0159] Login ID: KCTC15006BP

[0160] Preservation date: 20220620

[0161] (Translation)

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

Claims

1. A DNA construct comprising a 5' homologous arm, a target gene, and a 3' homologous arm. The DNA construct described herein is used to insert the target gene into a target region within the genome of a Schizochytrium microorganism. The target region corresponds to the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 in the genome of *Schizochytrium* microorganisms, or a nucleic acid sequence with at least 95% homology to it. The 5' homologous arm is capable of hybridizing with a region located within 100,000 bp upstream of the target gene insertion site within the target region. Furthermore, the 3' homologous arm is capable of hybridizing with a region located within 100,000 bp downstream of the target gene insertion site within the target region.

2. The DNA construct according to claim 1, wherein the 5' homologous arm and the 3' homologous arm each independently have a size of 20 to 5,000 bp.

3. The DNA construct according to claim 1, wherein the 5' homologous arm and the 3' homologous arm each independently have a size of 500 to 2,000 bp.

4. The DNA construct according to claim 1, wherein the target gene has a size of 30 to 100,000 bp.

5. The DNA construct according to claim 1, further comprising at least one selected from the group consisting of expression regulatory sequences, selection markers, and reporter genes.

6. The DNA construct of claim 1, wherein the insertion is achieved by at least one selected from the group consisting of homologous recombination (e.g., homologous directed repair (HDR)) and non-homologous end joining (NHEJ).

7. The DNA construct according to any one of claims 1 to 6, wherein the genus *Schizochytrium* is selected from at least one of the group consisting of *Schizochytrium lipophilum*, *Schizochytrium mangroveense*, *Schizochytrium aggregates*, and *Schizochytrium microsporum*.

8. The DNA construct according to any one of claims 1 to 6, wherein the DNA construct is used to deliver the target gene into the genome of a Schizochytrium microorganism, to express the target gene in a Schizochytrium microorganism, or for both purposes.

9. A composition for expressing a target gene in a genus of Schizochytrium microorganisms, comprising a DNA construct according to any one of claims 1 to 6.

10. A Schizochytrium microorganism comprising a DNA construct according to any one of claims 1 to 6.

11. The Schizochytrium microorganism according to claim 10, wherein the Schizochytrium microorganism is selected from at least one of the group consisting of *Schizochytrium lipophilum*, *Schizochytrium mangroveum*, *Schizochytrium aggregateum*, and *Schizochytrium microsporum*.

12. A composition for producing a target product, comprising a DNA construct according to any one of claims 1 to 6, a Schizochytrium microorganism comprising the DNA construct, or a combination thereof.

13. A method for producing Schizochytrium microorganisms for producing a target product, comprising the step of introducing a DNA construct according to any one of claims 1 to 6 into the Schizochytrium microorganisms.

14. The method for producing Schizochytrium microorganisms for producing the target product according to claim 13, wherein the Schizochytrium microorganisms are at least one species selected from the group consisting of *Schizochytrium lipophilum*, *Schizochytrium mangroveum*, *Schizochytrium aggregateum*, and *Schizochytrium microsporum*.

15. A method for producing a target product from a Schizochytrium microorganism, comprising the step of culturing a Schizochytrium microorganism containing a DNA construct according to any one of claims 1 to 6.

16. The method for producing a target product from a Schizochytrium microorganism according to claim 15, further comprising the step of preparing a Schizochytrium microorganism containing the DNA construct prior to the culture step.

17. The method for producing a target product from a Schizochytrium microorganism according to claim 16, wherein the step of preparing the Schizochytrium microorganism comprising the DNA construct includes the step of introducing the DNA construct into the Schizochytrium microorganism.

18. The method for producing a target product from a Schizochytrium microorganism according to claim 15, wherein the Schizochytrium microorganism is at least one selected from the group consisting of *Schizochytrium lipophilum*, *Schizochytrium mangroveum*, *Schizochytrium aggregateum*, and *Schizochytrium microsporum*.

Citation Information

Patent Citations

  • Foreign body detection method for screw connection surface and screw fastening device

    CN113495302B

  • Method and device for detecting phishing behavior

    CN115599749A

  • User-based big data classification and information provision systems, methods, servers, and recording med

    KR1020230079290A