Heat-resistant stable recombinant humanized type Ⅶ collagen as well as preparation method and application thereof

By constructing recombinant humanized type VII collagen through genetic engineering, the problems of limited sources, poor thermal stability, and insufficient bioactivity in existing technologies have been solved. High purity, heat resistance, and synergistic interaction with ECM have been achieved, meeting the sterilization and storage requirements of medical products and enabling large-scale production.

CN122103379APending Publication Date: 2026-05-29INTERFIELD (CHENGDU) BIOLOGICAL PROD CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INTERFIELD (CHENGDU) BIOLOGICAL PROD CO LTD
Filing Date
2026-04-29
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing type VII collagen sources are limited, extraction is complex and carries immunogenic risks, has poor thermal stability and cannot withstand high-temperature and moist heat sterilization, and recombinant proteins are mostly single-domain expressed, resulting in insufficient biological activity, making it difficult to achieve large-scale production and multifunctional applications.

Method used

A recombinant humanized type VII collagen was designed and expressed using genetic engineering techniques. The amino acid sequence was constructed by tandemly connecting four fragments. The expression was optimized in Pichia pastoris, and the protein was purified by cation exchange chromatography to achieve high purity, thermostability, and synergistic interaction with key ECM proteins.

Benefits of technology

The goal is to obtain high-purity, heat-resistant, and stable recombinant humanized type VII collagen, which can synergistically interact with key ECM proteins to promote cell proliferation, migration, and adhesion, thus meeting the sterilization requirements and long-term storage stability needs of medical products and enabling large-scale production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122103379A_ABST
    Figure CN122103379A_ABST
Patent Text Reader

Abstract

The application discloses a heat-resistant and stable recombinant humanized type VII collagen as well as a preparation method and application thereof, and belongs to the technical field of genetic engineering. The amino acid sequence of the recombinant humanized type VII collagen is formed by connecting four type VII collagen functional fragments in series, and the coding nucleotide is obtained by Pichia pastoris preference optimization design. The sequence is inserted into a pPIC9K plasmid to construct a recombinant vector, and the engineering bacteria are obtained by electric transformation of Pichia pastoris GS115. The target protein rhCOL7 is prepared through fermentation and purification. The rhCOL7 protein has excellent thermal stability, can resist 115 DEG C moist heat sterilization, has no obvious degradation after being placed at 60 DEG C for 60 days, can significantly promote cell proliferation, migration and adhesion, and can specifically interact with type IV collagen. The application realizes efficient preparation of the recombinant humanized type VII collagen, the activity of which is high and the stability of which is good, and the recombinant humanized type VII collagen can be widely applied to the preparation of wound repair drugs, biological repair materials and cosmetics.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of genetic engineering technology, specifically, it relates to a heat-resistant and stable recombinant humanized type VII collagen, its preparation method and application. Background Technology

[0002] The extracellular matrix is ​​the core of maintaining tissue structure and repair function. Type VII collagen, as the only structural protein that anchors fibrils in the epidermal-dermal junction, is a key anchoring molecule in the basement membrane region. It can regulate cell adhesion, proliferation and migration, and plays an irreplaceable role in skin barrier repair and wound healing. It has now become a research hotspot in the fields of cosmetics, medical wound repair, and tissue engineering.

[0003] However, the development and application of type VII collagen still face many bottlenecks in the existing technology: (1) The source of natural type VII collagen is limited, the extraction is complicated, and there is an immunogenicity risk; (2) Existing collagen has poor thermal stability, low denaturation temperature, is easy to degrade and precipitate, and cannot withstand the high temperature and humid heat sterilization commonly used in medical devices; (3) Recombinant type VII collagen is mostly expressed in single domains, with insufficient core biological activity, and its synergistic interaction with other proteins in the extracellular matrix is ​​not considered, resulting in a single function; (4) Some recombinant products use prokaryotic expression systems, which are prone to protein misfolding and difficult to scale up production.

[0004] The aforementioned problems have prevented existing type VII collagen products from meeting the market's actual demand for high activity, high stability, and multifunctionality. Therefore, there is an urgent need to develop a recombinant humanized type VII collagen that combines heat resistance, high bioactivity, and the ability to synergistically interact with key extracellular matrix proteins. Summary of the Invention

[0005] The purpose of this application is to provide a heat-resistant and stable recombinant humanized type VII collagen, its preparation method and application, which can obtain high-purity, high-bioactivity, heat-resistant and stable recombinant humanized type VII collagen that can synergistically interact with ECM key proteins and can be prepared on a large scale.

[0006] To achieve the above objectives, in a first aspect, this application provides a heat-resistant and stable recombinant humanized type VII collagen. The amino acid sequence of the recombinant humanized type VII collagen is shown in SEQ ID No. 5, and the amino acid sequence is obtained by tandemly connecting four fragments of type VII collagen. The amino acid sequences of the four fragments are shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4, respectively. The recombinant humanized type VII collagen has a purity ≥98% after being treated with moist heat sterilization at 115℃ for 30 min, and a purity ≥90% after being placed at 60℃ for 60 days without degradation or denaturation.

[0007] Secondly, this application also provides a nucleic acid encoding recombinant humanized type VII collagen (SEQ ID No. 5), the nucleotide sequence of which is shown in SEQ ID No. 6 and is a Pichia pastoris codon preference optimized sequence.

[0008] Thirdly, this application also provides a recombinant expression vector containing the above-mentioned nucleic acid, which is obtained by the following method: the gene fragment of the nucleotide sequence (SEQ ID No. 6) is constructed by inserting it into the pPIC9K plasmid through EcoRI and NotI restriction sites.

[0009] Fourthly, this application also provides a genetically engineered bacterium containing a recombinant expression vector, which is obtained by the following method: linearizing the recombinant expression vector and electroporating it into Pichia pastoris GS115 competent cells, and then screening to obtain positive transformants that can grow on YPD plates containing 3 mg / mL G418.

[0010] Fifthly, this application also provides a method for preparing recombinant humanized type VII collagen, comprising the following steps: The nucleotide sequence shown in SEQ ID No. 6 was synthesized and inserted into the pPIC9K plasmid to construct a recombinant expression vector. After linearization, the recombinant expression vector was electroporated into Pichia pastoris GS115 competent cells, and positive recombinant engineered bacteria were obtained after screening and identification. The positive recombinant engineered bacteria were inoculated into fermentation medium for fermentation culture to induce the expression of recombinant humanized type VII collagen. After fermentation, the supernatant obtained from fermentation was separated and purified to obtain recombinant humanized type VII collagen.

[0011] Further screening and identification include: plating the transformed strains onto YPD plates containing G418 for resistance screening, and identifying whether the target gene is integrated into the yeast chromosome by PCR amplification.

[0012] Furthermore, the fermentation culture includes a glycerol growth stage and a methanol induction stage. The methanol induction stage is carried out at a temperature of 25°C, with 0.5% methanol added every 24 hours for induction.

[0013] Further purification was performed using cation exchange chromatography with SP Purose 6 HighPerformance as the chromatography packing material. The chromatography was equilibrated with phosphate buffer and eluted with phosphate buffer containing NaCl.

[0014] Furthermore, a method for preparing recombinant humanized type VII collagen specifically includes the following steps: (1) Culture and induction expression of recombinant engineered bacteria: single colonies of the genetically engineered bacteria were picked and inoculated into BMGY medium. They were cultured at 30℃ and 220rpm until the OD value was 2~6. The bacterial cells were collected and resuspended in an equal volume of BMMY medium to make the initial OD value 2.0. They were cultured at 30℃ and 220rpm. 0.5% methanol was added every 24h to induce expression. The expression supernatant was collected after 24h~72h of culture. (2) Pilot-scale fermentation of engineered bacteria: After the engineered bacteria were activated by YPD seed culture medium, they were inoculated into fermentation medium containing PTM1 trace elements at an inoculation rate of 10% v / v. Glycerol growth and feeding culture were carried out at 30℃ until the wet weight of the bacteria reached 220 g / L. After starvation treatment for 0.5 h, methanol was added at 25℃ to induce expression. During the fermentation process, the dissolved oxygen content was maintained at 20%~50% and the pH was 5.0. (3) Purification: The fermentation supernatant was collected and subjected to cation exchange chromatography, ultrafiltration, liquid exchange and concentration to obtain recombinant humanized type VII collagen stock solution. The cation exchange chromatography used SP Purose 6 High Performance packing material, equilibrated with 20mM NaH2PO4 buffer (pH 5.0) and eluted with 0.5M NaCl NaH2PO4 buffer.

[0015] Sixthly, this application also provides the use of recombinant humanized type VII collagen in the preparation of drugs that promote cell proliferation, cell migration and / or cell adhesion.

[0016] Seventhly, this application also provides the application of recombinant humanized type VII collagen in the preparation of drugs or biorepair materials that interact with key ECM proteins. The key ECM proteins include laminin, fibronectin, and type IV collagen, preferably, type IV collagen is rhCOL4.

[0017] In summary, this application has at least the following beneficial effects: This application overcomes the limitations of limited natural type VII collagen sources, complex extraction processes, and immunogenicity. Through genetic engineering recombination technology, it produces high-purity, biosafety-free humanized type VII collagen, achieving feasibility for large-scale production. Furthermore, it effectively improves the thermal stability of type VII collagen, thus overcoming the shortcomings of existing collagen products, such as low denaturation temperature, easy degradation and leaching, and inability to withstand high-temperature and moist heat sterilization. This meets the sterilization requirements of medical products and the stability needs for long-term storage.

[0018] This application addresses the shortcomings of existing recombinant type VII collagen with single-domain expression, constructing a recombinant protein containing complete functional domains to restore its core biological activities of promoting cell adhesion, proliferation, and migration, thereby achieving practical efficacy in repairing the epidermal-dermal junction. It also enables specific synergistic interactions between recombinant type VII collagen and key proteins such as type IV collagen in the extracellular matrix (ECM), mimicking the network regulatory system of the ECM in vivo. This overcomes the limitations of existing products with single-function applications, further enhancing the overall effect of tissue repair. Attached Figure Description

[0019] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments of this application will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a map of the pPIC9K-rhCOL7 recombinant plasmid proposed in Example 1 of this application.

[0021] Figure 2 This is the PCR electrophoresis pattern of GS115 / pPIC9K / rhCOL7 proposed in Example 1 of this application.

[0022] Figure 3 The results are SDS-PAGE of the GS115 / pPIC9K / rhCOL7 supernatant proposed in Example 1 of this application; wherein, reference numerals 1, 2 and 3 represent the supernatant induced at 4h, 48h and 72h, respectively.

[0023] Figure 4 The results are SDS-PAGE of the purified supernatant protein obtained by GS115 / pPIC9K / rhCOL7 as presented in Example 1 of this application.

[0024] Figure 5 These are the cell states at 0h and 24h in the cell control wells and each sample well as proposed in Experimental Example 2 of this application.

[0025] Figure 6 This is the cell number fitting result after incubation proposed in Experiment Example 3 of this application; among which, Figure 6 In this context, A represents the rhCOL7 fitting result. Figure 6 B in the figure represents the rhFN fitting result.

[0026] Figure 7 The results of cell adhesion promotion by the blank control, recombinant fibronectin (rhFN), and rhCOL7 proposed in Experiment Example 3 of this application are as follows.

[0027] Figure 8 This is the result of the verification of the specific interaction between rhCOL7 and rhCOL4 proposed in Experimental Example 4 of this application.

[0028] Figure 9 The appearance of the sample proposed in Experimental Example 5 of this application after being treated with filtration sterilization and moist heat sterilization, respectively.

[0029] Figure 10 These are the protein purity test results of the samples proposed in Experimental Example 5 of this application after being subjected to filtration sterilization and moist heat sterilization treatments, respectively; among them, Figure 10 In the diagram, A represents the control sample after filtration and sterilization. Figure 10 B in the sample is a sample sterilized by moist heat.

[0030] Figure 11 The appearance of the sample proposed in Experimental Example 5 of this application after being treated with filtration sterilization and moist heat sterilization, and then subjected to accelerated destruction at 60°C for 60 days is shown.

[0031] Figure 12 The protein purity test results are those of the sample proposed in Experimental Example 5 of this application, after being treated with filtration sterilization and moist heat sterilization, and then subjected to accelerated degradation at 60°C for 60 days; among them, Figure 12 In the diagram, A represents the control sample after filtration and sterilization. Figure 12 B in the sample is a sample sterilized by moist heat.

[0032] Figure 13 The results of the protein cell proliferation activity assay for the sample proposed in Experimental Example 5 of this application, after being subjected to moist heat sterilization and then accelerated destruction at 60°C for 60 days; among which, Figure 13 In the sample A, the blank control sample is used. Figure 13 B in the sample represents the rhCOL3 control sample. Figure 13 C in the sample is rhCOL7.

[0033] Figure 14 The results of the protein cell migration-promoting activity assay for the sample proposed in Experimental Example 5 of this application, after being subjected to moist heat sterilization and then accelerated destruction at 60°C for 60 days; among them, Figure 14 In the diagram, A1 and A2 represent the cell states of the blank control sample at 0h and 24h, respectively. Figure 14 B1 and B2 in the table represent the cell states of the rhELP control sample at 0h and 24h, respectively. Figure 14 C1 and C2 in the figure represent the cell states of the rhCOL7 sample at 0h and 24h, respectively. Detailed Implementation

[0034] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0035] The extracellular matrix (ECM) is a complex network structure secreted and deposited between cells. The dynamic balance of its composition and structure directly determines the mechanical strength of tissues, the efficiency of cell signaling, and tissue repair capabilities. Collagen, the most abundant structural protein in the ECM, comprises 19 different types. Type VII collagen, encoded by the COL7A1 gene (UniProt accession number Q02388), is a key anchoring molecule in the basement membrane region of stratified squamous epithelial tissues such as skin, mucous membranes, and cornea. It is also the only structural protein anchoring fibrils in the dermal-epidermal junction (DEJ), accounting for over 90% of the dry weight of anchored fibrils, playing an irreplaceable role in maintaining tissue integrity.

[0036] Type VII collagen has a typical three-domain molecular structure (including the amino terminus, the central collagen triple helix structure and the carboxyl terminus), specifically: (1) The amino terminus non-collagenous domain (NC-1) contains 9 consecutive fibronectin type III (FNⅢ) repeat sequences, 1 von Willebrand factor A (vWF-A) domain and 1 cysteine-proline enriched region. Among them, FNⅢ can bind to the laminin (LN) α3 chain and the type IV collagen (COL4) α1 / α2 chain in ECM. The vWF-A domain contains RGD (Arg-Gly-Asp) integrin binding site, which can mediate the adhesion and polarity maintenance of fibroblasts and epithelial cells. The cysteine-proline enriched region participates in intermolecular polymerization through disulfide bonds, providing a structural basis for the assembly of anchored fibrils. (2) The central collagen triple helix domain consists of about 1530 amino acid residues, with a core of repeating Gly-XY sequences (X is mostly proline and Y is mostly hydroxyproline), but there are 19 non-collagen sequence insertions (including one large insertion of 39 amino acids). These insertion regions give the molecule a certain degree of flexibility, enabling it to adapt to mechanical movements such as skin stretching and contraction, and avoid the breakage of anchoring fibrils. (3) The carboxyl-terminal non-collagen domain (NC-2) contains 8 conserved cysteine ​​residues and 1 Kunitz-type protease inhibitor domain. The former mediates the formation of antiparallel dimers between two type VII collagen molecules through intermolecular disulfide bonds, which is the starting step in the assembly of anchoring fibrils; the latter may reduce the degradation of type VII collagen and maintain the long-term stability of DEJ by inhibiting the activity of matrix metalloproteinases (MMPs).

[0037] Under physiological conditions, type VII collagen maintains tissue integrity through the following mechanisms: First, the NC-1 domain binds to laminin-332 (LN-332) and the type IV collagen network on the basement membrane; second, the antiparallel dimers formed by the central triple helix domain further polymerize into anchoring fibrils; finally, one end of the anchoring fibrils inserts into the lamina densa of the basement membrane, and the other end extends to the papillary dermis and binds to anchoring plaques, forming a mechanical connection between the basement membrane and the dermis, effectively resisting shear and tensile forces on the skin and preventing separation of the epidermis and dermis. Furthermore, type VII collagen can activate the integrin signaling pathway through the RGD site, regulating fibroblast proliferation and epithelial cell migration, playing a crucial role in all stages of wound healing: inflammation resolution, cell proliferation, and tissue remodeling.

[0038] With the rapid growth in demand for functional biomaterials in fields such as skin care, medical wound repair, and tissue engineering, type VII collagen has become a research hotspot due to its unique anchoring and repair functions. Its application scenarios have gradually expanded from traditional cosmetics to medical fields such as chronic wound treatment and clinical intervention for hereditary epidermolysis bullosa (EB). However, in the existing technology, the preparation and application of type VII collagen still have many limitations that are difficult to overcome, and cannot meet the actual needs of the market and clinical practice. The specific disadvantages are as follows: (1) Natural type VII collagen has obvious resource and safety defects. Its source is limited, the extraction process is complicated and cumbersome, and it is difficult to achieve high purity and high yield. In addition, the naturally extracted protein has potential immunogenicity and biosafety risks, which limits its large-scale application in the medical field. (2) Existing collagen products have poor thermal stability, with denaturation temperatures generally only 40℃~60℃. They are prone to degradation and precipitation during storage, resulting in insufficient shelf-life stability. At the same time, sterilization methods commonly used in medical devices, such as high-temperature and moist heat sterilization, have a destructive effect on existing collagen products, which limits the sterilization methods for collagen-based medical devices and makes it difficult to meet the sterility requirements of medical products. (3) Existing recombinant type VII collagen is mostly heterologous expression of single structural domains, lacking a complete combination of functional domains. It cannot reproduce the core physiological functions of natural type VII collagen, such as anchoring and adhesion, resulting in significantly insufficient biological activities such as promoting cell adhesion, tissue anchoring, and wound repair, making it difficult to achieve the actual effect of repairing the epidermal-dermal junction.

[0039] It is evident that existing research has not considered the synergistic interactions between type VII collagen and other key proteins in the ECM, focusing solely on the functional expression of type VII collagen itself while neglecting its binding and synergistic effects with ECM components such as laminin, fibronectin, and type IV collagen. This results in products with limited efficacy, failing to mimic the network regulatory system of the in vivo ECM, and significantly diminishing their repair effects. Furthermore, some recombinant collagens are prepared using prokaryotic expression systems, which lack the mechanisms related to correct protein folding and modification. This can easily lead to misfolding of expressed type VII collagen, not only significantly reducing its biological activity but also hindering large-scale, industrial production, further limiting the industrial application of these products.

[0040] Based on this, this application develops a high-purity, multi-functional recombinant humanized type VII collagen with both repair-promoting and ECM synergistic functions, as well as excellent thermal stability, to meet the core needs of functional biomaterials in fields such as cosmetics, medical wound repair, and tissue engineering.

[0041] The technical solutions of this application will be described in detail below with reference to specific embodiments. Unless otherwise specified, all scores in this application are quality scores.

[0042] Example 1 - Construction, Identification and Preparation of Engineered Bacteria This embodiment sequentially follows the steps of gene sequence optimization, recombinant vector construction, engineered bacteria screening and identification, shake-flask expression, pilot-scale fermentation, and protein purification to complete the preparation process of rhCOL7 from gene to high-purity protein stock solution. Specifically: (1) Protein and gene sequence design Four different fragments from human type VII collagen (COL7A1) (UniProt: Q02388) were tandemly extracted, namely SEQ ID No. 1 (39aa), SEQ ID No. 2 (30aa), SEQ ID No. 3 (27aa), and SEQ ID No. 4 (39aa), to construct the recombinant protein rhCOL7 amino acid sequence (135aa, SEQ ID No. 5, with 138 bases after adding the stop codon TGA at the end), with a predicted molecular weight of approximately 11.52 kDa. The DNA sequence encoding the protein was then optimized for Pichia pastoris preference (SEQ ID No. 6) to make the recombinant protein more suitable for expression in Pichia pastoris. The optimized base sequence of the recombinant protein rhCOL7 (SEQ ID No. 6) was commissioned to Genscript Biotech Co., Ltd. for gene fragment synthesis. The synthesized gene fragment was then inserted into the pPIC9K plasmid via EcoRI and NotI restriction sites, yielding the desired result. Figure 1 The pPIC9K-rhCOL7 recombinant plasmid shown is shown.

[0043] The fragment shown in SEQ ID No. 1 belongs to the terminal linker region of the NC-1 domain. It conforms to the core characteristics of the NC-1 domain, which is rich in cysteine ​​and participates in disulfide bond formation. Moreover, this region is adjacent to the central collagen region and is a functional linker fragment between the NC-1 domain and the central collagen region, undertaking the auxiliary function of "anchoring" the central collagen region.

[0044] The fragment shown in SEQ ID No. 2 is a typical fragment of the central collagen region. The presence of proline can stabilize the triple helix conformation, enhance structural rigidity, conform to the structural characteristics of the central collagen region, and undertake the structural support function.

[0045] The fragment shown in SEQ ID No. 3 belongs to the initiation linker region of the NC-2 domain. It is characterized by its participation in molecular dimerization, and this region is adjacent to the central collagen region. It is a functional linker fragment between the central collagen region and the NC-2 domain, and plays an auxiliary role in "closing" and stabilizing the triple helix structure.

[0046] The fragment shown in SEQ ID No. 4 is a core functional fragment of the central collagen region. It is rich in glycine (Gly, 3) and proline (Pro, 4), with "GPP" (glycine-proline-proline) as the starting motif. "GPP" is a typical variant (X=Pro, Y=Pro) of the repeating sequence in the central collagen region (Gly-XY) of type VII collagen. It is a core building block of the triple helix structure and can directly participate in the formation and stability of the triple helix conformation. It is a core fragment supporting the structural function of the central collagen region.

[0047] This application uses the above four fragments for splicing, which can replicate the arrangement logic of the natural structural domains of type VII collagen, retain the natural functions of each fragment, and simultaneously achieve functional synergy and enhanced advantages. Specifically: First, this application follows the natural domain arrangement order, ensuring structural compatibility. The original arrangement order of the four fragments in natural type VII collagen (from N-terminus to C-terminus) is: SEQ ID No. 1 (NC-1 domain connector), SEQ ID No. 2 (central collagen region), SEQ ID No. 3 (NC-2 domain connector), and SEQ ID No. 4 (central collagen region). This natural order was strictly followed during splicing, without disrupting the natural positions of the fragments. This arrangement perfectly matches the natural domain order of "NC-1, central collagen region, and NC-2" in type VII collagen, ensuring that the spliced ​​SEQ ID No. 5 fragment can naturally connect its various parts without steric hindrance, mimicking the structural folding pattern of the natural protein and avoiding structural abnormalities caused by disordered order (such as failure to form triple helices or incorrect disulfide bond pairing). Second, this application preserves the natural function of each fragment, achieving synergistic effects. For example, SEQ ID No. 1 (NC-1 domain) retains its cysteine-mediated adhesion function, which can mediate the binding of spliced ​​fragments with other extracellular matrix components (such as laminin and collagen IV), providing the fragments with "anchoring" ability; SEQ ID No. 2 and SEQ ID No. 4 (central collagen region) retain their triple helix structure support function. The splicing of two collagen fragments can enhance the overall structural rigidity, strengthen the mechanical support ability of the fragments, and simulate the core role of the natural central collagen region; SEQ ID No. 3 (NC-2 domain) retains its cysteine-mediated dimerization function, which can promote the formation of stable dimers by spliced ​​fragments, further enhancing the structural stability of the fragments and conforming to the assembly mode of natural type VII collagen. Third, all four fragments in this application are short peptide fragments (9 to 13 amino acids), and the total length of SEQ ID No. 5 after splicing is only 45 amino acids, with no redundant sequences, which can avoid the problem of abnormal folding of long fragments; at the same time, short peptide sequences are easier to be expressed efficiently by Pichia pastoris, reducing the difficulty of expression and improving the expression efficiency, laying the foundation for subsequent industrial applications.

[0048] The specific sequence is as follows: SEQ ID No. 1: LARPGVPKVCILI.

[0049] SEQ ID No. 2: PPEAPPALGT.

[0050] SEQ ID No.3: PVCPRGLAD.

[0051] SEQ ID No. 4: GPPGAIGPKGDRG.

[0052] SEQ ID No. 5: LARPGVPKVCILIPPEAPPALGTPVCPRGLADGPPGAIGPKGDRG.

[0053] SEQ ID No. 6: TTGGCAAGACCAGGTGTTCCCAAGGTTTGTATACTTATTCCCCCAGAAGCTCCACCAGCTTTGGGTACTCCAGTTTGTCCAAGAGGTCTTGCTGATGGTCCACCTGGTGCTATTGGTCCAAAGGGTGACAGGGGTTGA (The last three digits are the stop codon).

[0054] (2) Construction and screening of recombinant engineered bacteria (2-1) The optimized base sequence (SEQ ID No. 6) was entrusted to GenScript Biotech Co., Ltd. for gene fragment synthesis. After sequencing verification, the corresponding plasmid and bacterial strain were provided. After large-scale culture, high-concentration plasmid was extracted for later use.

[0055] (2-2) The extracted 20 μg plasmid pPIC9K-rhCOL7 was linearized and digested with Quick Cut Sac I under the following conditions: 37℃ for 5 h. The digestion system is shown in Table 1.

[0056] Table 1 Enzyme digestion system

[0057] After electrophoresis verification, add 0.1 volume of 3M NaAc (pH 5.2) and 2.5 volume of anhydrous ethanol, and incubate overnight at -20°C. Centrifuge at 13000 rpm for 20 min at 4°C, and discard the supernatant; add 700 μL of 75% ethanol to wash, centrifuge at 13000 rpm for 20 min, discard the supernatant, and repeat once; invert the EP tube on absorbent paper in a clean bench for about 10 min to remove as much water and residual ethanol as possible, redissolve the plasmid with 20 μL of ddH2O, take 1 μL to dilute 10-fold, and use one-drop to detect the nucleic acid concentration.

[0058] (2-3) After streaking the GS115 strain plate, pick a single colony and inoculate it into 20 mL of YPD liquid medium, and then incubate at 30℃ and 225 rpm for 24 h; The inoculum was transferred to 50 mL of YPD liquid medium at a 1:1000 inoculation ratio and cultured at 30°C and 225 rpm until OD. 600 1.3~1.5; The bacterial culture was then transferred to a sterile 50mL centrifuge tube and centrifuged at 4℃ and 3000rpm for 5 minutes. After discarding the supernatant, collect the bacterial cells, resuspend the bacterial precipitate in 50 mL of sterile ultrapure water pre-cooled in an ice bath (0°C in this application), and centrifuge at 4°C and 3000 rpm for 5 min. After discarding the supernatant, collect the bacterial cells, resuspend the bacterial precipitate in 50 mL of pre-cooled sterile ultrapure water, and centrifuge at 4 °C and 3000 rpm for 5 min. After discarding the supernatant, collect the bacterial cells, resuspend the cell pellet in 40 mL of pre-cooled sterile 1 M sorbitol, and centrifuge at 4 °C and 3000 rpm for 5 min. After discarding the supernatant, the cell pellet was resuspended in 100-150 μL of pre-cooled sterile 1M sorbitol, vortexed to mix, and placed on ice to obtain GS115 competent cells for use.

[0059] (2-4) Mix 100 μL of GS115 competent yeast cells with 10 μL of linearized plasmid, transfer to an ice-cold electroporation cuvette, and immediately incubate on ice for 5 min. Select the yeast mode on the electroporator (voltage 1500V, resistance 400Ω, capacitance 25μF, pulse time 10ms, one pulse) and perform electroporation. Immediately add 1 mL of pre-cold 1M sorbitol to the electroporation cuvette, mix well, and transfer the mixture to a sterile EP tube. Incubate at 30℃ for 1-2 h. Then, spread 100-200 μL of the bacterial culture onto a YPD plate containing 0.25 mg / mL G418, incubate at room temperature for 10 min, and then incubate upside down at 30℃ for about 2-5 days until single colonies appear.

[0060] (2-5) Pick a single colony from a YPD plate and transfer it to a 96-well plate containing 200 μL of YPD medium (containing 0.5 mg / mL G418) (the first plate). Incubate at 30°C. After 48 h, rehydrate the bacterial culture and transfer 10 μL from each well to a new 96-well plate (containing 190 μL of YPD, the second plate). Incubate for another 24 h and repeat the above steps (the resulting new 96-well plate is the third plate). After 24 h, rehydrate the bacterial culture in the third 96-well plate and spot 1 μL onto YPD plates containing 1 mg / mL, 2 mg / mL, and 3 mg / mL G418, respectively, and continue incubating. If the transformant can grow on a plate containing a high concentration of 3 mg / mL G418, it indicates that the transformant contains multiple copies of the target gene (i.e., a positive transformant has been selected).

[0061] Then, take 50 μL of the remaining bacterial culture from the first 96-well plate, boil it in a boiling water bath for 10 min, freeze it in liquid nitrogen for 30 min, boil it in a boiling water bath for 10 min again, repeat the freeze-thaw cycle, centrifuge at 12000 rpm for 5 min, and take the supernatant as a PCR template. Use PCR amplification to identify whether the target gene has been integrated into the yeast chromosome (i.e., identify the screened positive transformants).

[0062] Among them, the upstream universal primer 5'AOX: 5'-GACTGGTTCCAATTGACAAGC-3' (SEQ ID No. 7); Downstream universal primer 3'AOX: 5'-GGCAAATGGCATTCTGACAT-3' (SEQ ID No. 8).

[0063] PCR conditions: 98℃ pre-denaturation for 5 min; 98℃ heat denaturation for 50 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ annealing for 10 min.

[0064] The amplified products were subjected to 1.0% agarose gel electrophoresis to determine whether the expected gene fragment (approximately 626 bp) was amplified. Figure 2 After confirming that the target gene was successfully integrated into the yeast chromosome, the positive transformant that stably expressed rhCOL7 was obtained, which is the recombinant Pichia pastoris engineered strain GS115 / pPIC9K / rhCOL7.

[0065] (3) Shake-flask induced expression The engineered bacteria were cultured and induced with methanol using BMGY / BMMY medium. The expression supernatant was collected, and the molecular weight and expression level of the target protein were verified by SDS-PAGE. The specific medium and composition are as follows: YPD complete medium: yeast extract (10 g / L), peptone (20 g / L), glucose (20 g / L, solid medium contains 2 wt% agar).

[0066] MD solid medium: YNB amino acid-free nitrogen source (13.4 g / L), biotin (0.4 mg / L), glucose (20 g / L), agar (2 wt%).

[0067] BMGY yeast growth medium: yeast extract (10 g / L), peptone (20 g / L), K2HPO4 (3 g / L) and K2HPO4 (11.8 g / L), add water to 890 mL, sterilize at 121℃ for 20 minutes, then after the temperature drops to 60℃, add 10×YNB 100 mL (13.4 g / L) and 500×Biotin 1 mL (4×10) on a clean bench. -4 (g / L) and 10 mL of glycerol.

[0068] BMMY yeast induction medium: yeast extract (10 g / L), peptone (20 g / L), K2HPO4 (3 g / L) and K2HPO4 (11.8 g / L), add water to 895 mL, sterilize at 121℃ for 20 minutes, then after the temperature drops to 60℃, add 100 mL of 100×YNB (13.4 g / L) and 1 mL of 500×Biotin (4×10⁻⁶) on a clean bench. -4 Add 5 mL of methanol (g / L).

[0069] The specific procedure includes: picking single colonies from YPD plates and inoculating them into BMGY medium, incubating at 30℃ and 220rpm for 24h until the OD value reaches 2-6. Adjusting the volume of the BMGY culture medium according to the measured OD value, incubating at 3000rpm for 10min, collecting the cells, and resuspending them in an equal volume of BMMY medium to achieve an initial OD value of 2.0. Continuing incubation at 30℃ and 220rpm, adding 0.5wt% methanol to the medium every 24h, and collecting bacterial samples at 24h, 48h, and 72h after induction, centrifuging (10000rpm, 20min) to collect the expression supernatant. SDS-PAGE electrophoresis analysis was used to determine the molecular weight (approximately 11.52kDa) and expression level of the target protein. Figure 3 ).

[0070] (4) Pilot-scale fermentation of engineered yeast Large-scale fermentation was completed in a 5L fermenter. By controlling parameters such as temperature, dissolved oxygen, and pH, high-density culture of engineered bacteria and efficient protein induction were achieved, thus completing the scale-up from laboratory shake flasks to industrial pilot production.

[0071] The specific culture medium and formula used are as follows: Seed culture medium YPD: yeast extract (10 g / L), peptone (20 g / L), glucose (20 g / L).

[0072] Fermentation medium: 85% H3PO4 (26.7 mL / L), CaSO4·2H2O (1.175 g / L), K2SO4 (18.2 g / L), MgSO4·7H2O (14.9 g / L), KOH (4.13 g / L), glycerol (40.0 g / L), PTM1 (4.35 mL / L).

[0073] Feeding medium: 50% w / v glycerol, with 12 mL PTM1 trace element per liter.

[0074] Induction medium: 100% methanol, with 12 mL of PTM1 trace elements added per liter.

[0075] The PTM1 solution was prepared according to the Invitrogen manual, with the following specific formulation: CuSO4·5H2O (6.0 g / L), NaI (0.08 g / L), MnSO4·H2O (3.0 g / L), NaMoO4·2H2O (0.2 g / L), H3BO3 (0.02 g / L), CoCl2 (0.5 g / L), ZnCl2 (20.0 g / L), FeSO4·7H2O (65.0 g / L), biotin (0.2 g / L), and H2SO4 (5.0 mL / L). The solution was sterilized by filtration through a 0.22 μm filter and stored at 4 °C.

[0076] The specific steps include: Add 2L of freshly prepared fermentation medium to a 5L fermenter (Bailun Biotechnology Co., Ltd.), and sterilize the fermenter in a steam sterilizer at 121℃ for 15 minutes. After the fermenter cools down, calibrate the electrodes and wait for inoculation.

[0077] During the fermenter preparation stage, Pichia pastoris engineered strains (GS115 / pPIC9K / rhCOL7) stored in an ultra-low temperature freezer were inoculated into a medium containing 50 mL of liquid YPD and cultured overnight (14 h ~ 16 h) in a constant temperature shaker at 30 °C and 220 rpm to activate the cells.

[0078] The primary seed culture was transferred at an inoculum volume of 5% (v / v) to 200 mL of YPD medium and cultured until the cells reached OD. 600 From step 4 to 6, secondary seed solution is obtained.

[0079] Add all of the secondary seed culture to the fermenter (10% inoculum, v / v), along with 8.7 mL of PTM1 trace element, and carry out batch fermentation.

[0080] The temperature for glycerol growth and glycerol feeding was set at 30℃, and the temperature for methanol induction was set at 25℃. Dissolved oxygen (DO) in the tank was maintained within the range of 20%–50% by controlling the stirring speed (500–600 rpm), the aeration rate (2–6 L / min), and the feeding rate. 50% (w / w) ammonia was automatically added to maintain the pH of the culture medium at approximately 5.0. An antifoaming agent was added to remove foam generated during fermentation.

[0081] During the glycerol culture phase, the dissolved oxygen (DO) level continuously increased, indicating that the glycerol in the culture medium had been depleted by the cells. At this point, approximately 400 mL of 50% (w / v) glycerol was added. Once the cell wet weight reached 220 g / L, glycerol addition was stopped, and the cells were starved for approximately 0.5 h. After the DO level in the tank rose to its maximum again, methanol was added to induce the production of recombinant rhCOL7 protein. The feed rate was adjusted periodically to maintain the DO level within the range of 20%-50%, exhibiting periodic fluctuations. After induction, bacterial culture samples were collected at 24 h, 48 h, 72 h, and 96 h, and the expression supernatant was collected by centrifugation. Fermentation was terminated based on the expression status.

[0082] (5) Protein purification High-purity rhCOL7 protein stock solution was obtained by combining cation exchange chromatography with ultrafiltration, concentration, and liquid exchange. The molecular weight and purity of the protein were then verified by testing.

[0083] The specific steps are as follows: The fermentation broth of the engineered bacteria was collected from the culture supernatant by centrifugation (10,000 rpm, 20 min). The fermentation supernatant and bacterial cells were separated using a solid-liquid separation system. The column was equilibrated with phosphate buffer (20 mM NaH2PO4, pH 5.0) until the conductivity and A280 absorbance remained constant. The sample loading flow rate was set to 20 cm / h, and the UV A280 absorbance was monitored. Sample loading began when the absorbance increased. After loading, the cation exchange medium was equilibrated again with phosphate buffer until the UV absorbance and conductivity reached their minimum and no longer changed. The protein was then eluted with a buffer containing NaH2PO4-NaCl (0.5 M) and collected. After ultrafiltration and concentration, the recombinant rhCOL7 protein stock solution was obtained (the specific process includes: using 0.5 mM...). 2 Ultrafiltration was performed using a 10kD pore size membrane pack (Hangzhou Jiuling Biotechnology Co., Ltd.). The buffer used was 20mM NaH2PO4 buffer (pH 5.0). Ultrafiltration was completed when the conductivity of the protein solution at the reflux end of the 10kD pore size membrane pack matched that of the 20mM NaH2PO4 buffer. After ultrafiltration, the protein was further concentrated using 0.5m...2 The 10kD pore size membrane pack (Hangzhou Jiuling Biotechnology Co., Ltd.) was used for concentration (without adding buffer, the permeate end was discarded and the reflux end was retained; concentration was stopped when 1 / 5 of the original volume remained on the reflux end). The molecular weight and purity were detected by SDS-PAGE, and the results are as follows: Figure 4 As shown, it is a high-purity recombinant humanized type VII collagen (rhCOL7) protein stock solution. The amino acid sequence of this protein is SEQ ID No. 5, and the predicted molecular weight is approximately 11.52 kDa. The molecular weight was confirmed by SDS-PAGE and is consistent with the expectation. Furthermore, it was purified to high purity by cation exchange chromatography, with no obvious impurities. It can be directly used as a core raw material for subsequent activity testing and application development.

[0084] Experiment Example 1 - Effect of Recombinant Type VII Humanized Collagen on Cell Proliferation This experimental example, in accordance with the requirements of the standard "YY / T 1849-2022 Recombinant Collagen", uses the MTT assay with recombinant type III collagen (rhCOL3) as a control to detect the proliferation-promoting effect of the recombinant humanized type VII collagen (rhCOL7) prepared in this application on mouse embryonic fibroblasts (3T3). It quantitatively verifies the in vitro cell proliferation-promoting biological activity of rhCOL7, providing standardized activity data support for its application in wound repair, tissue regeneration, and other fields.

[0085] The experimental principle includes: The MTT assay is a classic standardized method for detecting cell proliferation. Succinate dehydrogenase in the mitochondria of living cells can reduce exogenous MTT to insoluble blue-purple formazan crystals, which are then deposited in the cells. Dead cells lack this function. Dimethyl sulfoxide (DMSO) can dissolve the formazan in the cells. The absorbance value is detected at a wavelength of 570 nm using a microplate reader. The absorbance value is positively correlated with the number of living cells. This experiment quantifies the cell proliferation-promoting effect of rhCOL7 on 3T3 cells by detecting the absorbance values ​​of different treatment groups and calculates the proliferation-promoting titer, thus achieving a quantitative evaluation of its activity.

[0086] Specifically as follows: (1) Experimental methods (1-1) Experimental materials Test sample: Recombinant type VII collagen (rhCOL7), prepared in Example 1, batch number 20250209.

[0087] Reference standard: Recombinant type III collagen (rhCOL3), prepared according to patent number CN202411045813.2, batch number 20250311.

[0088] Standard: EGF, potency 500,000 U / mg, purchased from Sigma.

[0089] Cell line: Mouse embryonic fibroblasts (3T3), passage 8, cryopreservation batch number 20221215, purchased from ATCC, USA.

[0090] Other reagents (complete culture medium HyClone / AJ30742864, PBS, 0.25% trypsin) and other items (96-well cell culture plates, TIP tips and micropipettes) are standard laboratory procedures, and are sterilized or filtered before the experiment, and pass sterility testing.

[0091] (1-2) Experimental methods (1-2-1) Cell culture and passage Cells were cultured normally in medium containing 10% fetal bovine serum. When the cells reached a confluence of over 90%, the medium was removed, the cells were washed twice with PBS, and then digested with 0.25% trypsin. When the cells shrank and became rounded, the trypsin was discarded, medium containing 10% fetal bovine serum was added, and the cells were gently pipetted. The cells were collected, centrifuged, and counted. The cell concentration was adjusted to 1.0 × 10⁶ cells per mL of culture medium. 5 ~5.0×10 5 Each cell is passaged. Once the cells have grown to a confluence rate of over 90%, the next passage is performed.

[0092] (1-2-2) Cell seeding Cells were selected for assay 24-36 hours after passage. The culture medium in the culture flask was discarded, and the cells were digested and collected. The cells were then reconstituted with complete culture medium to a concentration of 5.0 × 10⁶ cells per mL. 4 ~8.0×10 4 Cell suspensions of 100 μL were seeded into 96-well cell culture plates and cultured at 37°C with 5% carbon dioxide.

[0093] (1-2-3) Cell synchronization After 24 hours, the medium was replaced with maintenance medium and cultured for another 24 hours at 37°C and 5% carbon dioxide.

[0094] (1-2-4) Administration 24 hours later, the samples were serially diluted 4-fold using maintenance medium, and 100 μL of the diluted samples were added to each well of the cells. A blank control group was also set up, with two replicates per group, and the cells were cultured for a longer period.

[0095] (1-2-5) MTT Measurement After culturing the cells for 72 hours following drug treatment, 20 μL of MTT solution (0.5 mg / mL) was added to each well. The cells were incubated at 37°C with 5% CO2 for 4 hours, then the solution was discarded. DMSO was added for lysis, and the cells were shaken. The absorbance was measured at 570 nm. Experimental data were processed using a computer program or a four-parameter regression method. The results are shown in Table 2.

[0096] Table 2 Results of cell proliferation activity assay of rhCOL7 recombinant protein

[0097] It can be seen that the recombinant protein rhCOL7 obtained in Example 1 of this application has high cell proliferation activity, reaching 2000 U / mg, indicating that it has a significant proliferation-promoting effect on 3T3 cells.

[0098] In summary, the recombinant humanized type VII collagen (rhCOL7) prepared in this application exhibits significant in vitro cell proliferation-promoting bioactivity, with a proliferation-promoting titer far exceeding that of recombinant type III collagen. Furthermore, its activity value consistently reaches over 2000 U / mg, meeting the relevant testing standards of YY / T 1849-2022 Recombinant Collagen. Since fibroblast proliferation is a core component in wound healing, tissue repair, and regeneration, and rhCOL7's high cell proliferation-promoting ability can effectively regulate the proliferation and expansion of repair-related cells at the injury site, providing a sufficient cellular basis for tissue repair and reconstruction after injury, this is a crucial functional characteristic for wound healing and skin tissue regeneration. Therefore, rhCOL7 can be used as a core active ingredient in the research and development and preparation of medical wound repair materials, tissue regeneration biomaterials, and skin care products.

[0099] Experimental Example 2 - Cell Scratch Assay with Recombinant Type VII Humanized Collagen This experimental example uses the cell scratch assay, with recombinant elastin (ELP) as a control, to detect the effect of the recombinant humanized type VII collagen (rhCOL7) prepared in this application on the migration-promoting effect on Balb / c 3T3 mouse embryonic fibroblasts, and to verify the in vitro cell migration-promoting biological activity of rhCOL7, providing key activity data support for its application in wound healing, skin tissue repair and other fields.

[0100] (1) Experimental principle The cell scratch assay is a classic in vitro method for simulating in vivo cell migration. When a confluent cell layer is scratched to create a blank scratch area, cells at the edges migrate towards the scratch area to fill the gap. By detecting the degree to which cells fill the scratch area under different treatment conditions and calculating the cell migration rate, the promoting effect of the analyte on cell migration can be quantitatively analyzed. In this embodiment, this method is used to verify the ability of rhCOL7 to regulate the migration of repair-related fibroblasts.

[0101] (2) Experimental materials Test sample: Recombinant type VII collagen (rhCOL7), prepared in Example 1, batch number 20250209.

[0102] Reference standard: Recombinant elastin (ELP), prepared according to patent number CN202411012422.0, batch number 20250138.

[0103] Cell line: Balb / c 3T3 cells, purchased from ATCC, USA.

[0104] Other reagents (cell nutrient solution, serum-free culture medium, PBS, 0.25% trypsin) and other items (96-well cell culture plate, TIP tip and micropipette) are standard laboratory procedures. They are sterilized or filtered before the experiment and pass the sterility test.

[0105] (3) Experimental steps First, using a marker pen, align with a ruler and draw evenly spaced horizontal lines across the wells on the back of the 6-well plate, approximately every 0.5cm to 1cm. Add a 5×10⁻⁶ solution to each well. 5 2 mL of cell suspension per cell / mL was prepared. The next day, it was observed that all cells in the 6-well plate had formed a confluent monolayer. Using a pipette tip aligned with a ruler, two lines were made perpendicular to the horizontal lines on the back of each well. The cells were then washed three times with PBS to remove the suspended cells that had been drawn.

[0106] According to the grouping, 1.8 mL of serum-free culture medium was added to each well, followed by 200 μL of sample. An equal volume of PBS solution was added to the cell control wells. The wells were incubated at 37°C with 5% CO2. Photos were taken at 0 h, recording the location of each photo within each well. Subsequent observations were conducted at these fixed locations. Data processing was performed using an area detection method (scratch distance measurement was an equivalent measurement). The average scratch width was calculated as scratch gap area / length, and cell migration rate was calculated as (0h scratch width - 24h scratch width) / 0h scratch width × 100%. Experimental results are as follows: Figure 5 As shown in Table 3.

[0107] Table 3 Results of rhCOL7 recombinant protein promoting 3T3 cell migration

[0108] Inverted microscopy imaging results showed that after 24 hours of culture, only a small number of cells migrated in the scratch area of ​​the PBS negative control group, and the scratch filling degree was extremely low; a certain number of cells migrated in the scratch area of ​​the ELP control group, and the scratch filling degree was better than that of the negative control group; a large number of cells migrated to the scratch area of ​​the rhCOL7 experimental group, and the scratch filling degree was significantly better than that of the ELP control group and the negative control group.

[0109] Quantitative calculations showed that the cell migration rate of each experimental group was as follows: the cell migration rate of the PBS negative control group was 10.2%, the cell migration rate of the ELP control group was 40.66% (protein concentration 4.57 mg / mL), and the cell migration rate of the rhCOL7 experimental group reached 52.41% (protein concentration 4.85 mg / mL). The effect of rhCOL7 on promoting the migration of Balb / c 3T3 cells was significantly better than that of the control and negative control.

[0110] Therefore, it can be concluded that the recombinant humanized type VII collagen (rhCOL7) prepared in this application has significant in vitro cell migration-promoting biological activity, effectively promoting the migration of Balb / c 3T3 fibroblasts, and its migration-promoting effect is superior to that of recombinant elastin. Since fibroblast migration is a key step in wound healing and skin tissue repair, the high cell migration-promoting activity of rhCOL7 in this application can effectively regulate the migration of repair-related cells to the damaged / wounded area, accelerating the repair and filling of the scratch area. This provides important functional support for wound healing and skin barrier reconstruction, and can be used as a core active ingredient in the research and development and preparation of wound repair medical biomaterials and skin care products.

[0111] Experiment Example 3 - Effect of Recombinant Type VII Humanized Collagen on Cell Adhesion This embodiment refers to the conventional method of cell adhesion assay, using recombinant fibronectin (rhFN) as a positive control. By detecting the adhesion-promoting effect of recombinant humanized type VII collagen (rhCOL7) on bovine kidney cells (MDBK), the cell adhesion-promoting bioactivity of rhCOL7 prepared in this application is verified, providing activity data support for its application in tissue repair, skin barrier reconstruction and other fields.

[0112] (1) Experimental principle Cell adhesion is fundamental to cell repair, proliferation, and migration. Adhesion-promoting proteins can mediate cell adhesion and growth on carrier surfaces by binding to receptors such as integrins on the cell surface. In this experiment, rhCOL7 was coated onto a culture plate, and MDBK cells were seeded. The cell adhesion-promoting ability of rhCOL7 was quantified by counting the number of adherent cells, and its adhesion activity level was determined by comparing it with the positive control recombinant fibronectin.

[0113] (2) Experimental materials Main instruments: Clean bench, cell culture incubator.

[0114] Complete cell culture medium: Measure 10 mL of fetal bovine serum and 1 mL of penicillin antibody, add 90 mL of DMEM culture medium, and store at 4°C.

[0115] Serum-free culture medium: Measure 1 mL of the double antibody and add 99 mL of 1640 culture medium, and store at 4℃.

[0116] Digestive fluid: 0.25% trypsin.

[0117] PBS buffer: Weigh 8.0g sodium chloride, 0.20g potassium chloride, 1.44g disodium hydrogen phosphate and 0.24g potassium dihydrogen phosphate, dissolve in water and bring the volume to 1000mL, then sterilize at 121℃ for 15 minutes.

[0118] Cells: MDBK cells grow in a monolayer and adherent state in complete cell culture medium. They are passaged every 4 to 5 days at a passage ratio of 1:2 and then digested and passaged in complete culture medium.

[0119] Test sample: rhCOL7, prepared in Example 1, batch number 20250209.

[0120] Positive control: Recombinant fibronectin (rhFN), prepared according to patent number CN202110357340.X, batch number 20250306.

[0121] (3) Experimental procedure rhCOL7 was pre-diluted to 0.5 μg / mL with PBS. After pre-dilution, it was serially diluted 2-fold in a 96-well plate for a total of 10 dilutions. Each well contained 50 μL of rhCOL7 sample at different dilutions. Positive control wells and negative control wells (with 50 μL of PBS added as controls) were also included. The plates were incubated overnight at 4°C.

[0122] After incubation, discard the liquid in the plate, add 100 μL of 30 g / L BSA to each well for blocking, and incubate at 37°C for 1 h. Remove the plate, discard the liquid, and add MDBK cell suspension (resuspended in serum-free medium) at a seeding density of 1.0 × 10⁶ cells / well. 5 Inoculate 100 μL per well at a density of 1 / mL and incubate at 37°C for 5 hours.

[0123] (4) Experimental results The incubated cell plates were washed three times with PBS, and cell adhesion was observed under a microscope. Five points (excluding the edge) were selected under 200x magnification to count the adherent cells. A four-parameter regression analysis was used to fit the count data, calculating the cell adhesion-promoting titers of rhCOL7 and rhFN, and comparing their adhesion activities. See Tables 4-5 and... Figures 6-7 As shown.

[0124] Table 4 Cell count at five points in each well of the plate

[0125] Table 5. Statistical results of the cell adhesion-promoting potency of rhCOL7 recombinant protein

[0126] Adherent cell counting results: Under an inverted microscope, the number of adherent cells in the rhCOL7-coated wells decreased systematically with the protein concentration gradient dilution. The number of adherent cells at each dilution was higher than that in the rhFN-coated wells at the same dilution. The number of adherent cells in the negative control PBS wells was significantly lower than that in the protein-coated wells. Specifically, the average cell count at five fields of view for each dilution was: rhCOL7 group 100–1480 cells, rhFN group 100–1160 cells.

[0127] Cell adhesion promotion potency results: Based on four-parameter regression fitting calculations, the rhCOL7 (prepared in this application) showed the following efficacy: Figure 6 When the concentration of protein A in the sample was 1.02 mg / mL, the cell adhesion-promoting titer reached 10800 U / mL; the positive control rhFN ( Figure 6 When the concentration of protein B in rhCOL7 was 1.04 mg / mL, its cell adhesion-promoting titer was 9400 U / mL. The cell adhesion-promoting titer of rhCOL7 was superior to that of the positive control recombinant fibronectin.

[0128] This demonstrates that the recombinant humanized type VII collagen (rhCOL7) prepared in this application exhibits significant in vitro cell adhesion-promoting bioactivity, with an adhesion-promoting titer no lower than that of recombinant fibronectin, effectively mediating the adherent growth of MDBK cells. The high cell adhesion-promoting activity of rhCOL7 enables it to mediate the adhesion and colonization of repair-related cells such as fibroblasts and epithelial cells at wound or tissue injury sites, laying the foundation for subsequent cell proliferation, migration, and tissue repair. It is a crucial functional basis for achieving skin barrier reconstruction and wound healing, and can be used as a core active ingredient in the research and development of tissue repair biomaterials and skincare products.

[0129] Experiment Example 4 - Yeast Two-Hybrid System Experiment to Detect the Interaction Between rhCOL7 and rhCOL4 (1) Experimental principle Transcription factors typically contain two independent domains: a DNA-binding domain (BD) and a transcription activation domain (AD). Transcription can only proceed normally when these two domains interact. Utilizing this characteristic, the coding sequence of rhCOL7 was cloned into the pGBT9 (DNA-binding domain, BD) vector, and the coding sequence of rhCOL4 was cloned into the pGAD424 (activation domain, AD) vector. Following the manufacturer's yeast transformation protocol (Takara), the recombinant AD and BD plasmids rhCOL4-pGBT9, rhCOL7-pGAD424, and rhCOL4-rhCOL7 were co-transformed into yeast Y2HGold. If the two proteins rhCOL7 and rhCOL4 can interact, BD and AD can be spatially close enough to activate the transcription of the reporter gene.

[0130] Based on this, this experimental example uses a yeast two-hybrid system to verify the specific protein-protein interaction between the recombinant humanized type VII collagen (rhCOL7) and type IV collagen (rhCOL4) prepared in this application, clarify the synergistic interaction ability of rhCOL7 with key extracellular matrix (ECM) proteins, and provide molecular evidence for its mediating basement membrane assembly and achieving efficient tissue repair.

[0131] (2) Experimental methods (2-1) Experimental materials Plasmid vectors: pGBT9 (DNA binding domain vector, BD) and pGAD424 (activation domain vector, AD), purchased from TakaraBio Inc.

[0132] Yeast strain: Y2HGold (genotypes: MATα, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Δ, gal80Δ, LYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UAS-GAL2TATA-ADE2, URA3::MEL1UAS-MEL1TATA-lacZ), purchased from Takara Bio Inc.

[0133] Escherichia coli strain: DH5α competent cells [F - , φ80lacZΔM15, Δ(lacZYA-argF) U169, deoR, recA1, endA1, hsdR17 (rk - ,mk + ), phoA, supE44, λ - [thi-1, gyrA96, relA1], purchased from TakaraBio Inc.

[0134] Target genes: humanized recombinant type VII collagen (rhCOL7) and humanized recombinant type IV collagen (rhCOL4 gene sequence cited in patent number CN117024572A), obtained through gene synthesis (Shanghai Sangon Biotech Co., Ltd.).

[0135] Molecular biology equipment: PCR instrument (Bio-Rad T100), gel imaging system (Bio-Rad ChemiDoc XRS+), agarose gel electrophoresis system (Beijing Liuyi Instrument Factory), high-speed refrigerated centrifuge (Eppendorf 5810R), clean bench (Suzhou Purification SW-CJ-2FD), and microplate reader (Multiskan FC).

[0136] Culture equipment: constant temperature biochemical incubator (Shanghai Yiheng LRH-250), constant temperature shaker (Shanghai Zhicheng ZHPY-200), and moist heat sterilizer (Shanghai Shenan LDZX-50KBS).

[0137] Other equipment: electronic balance (Mettler AL204), pipettes (Eppendorf Research Plus, 0.5μL~10μL, 10μL~100μL, 100μL~1000μL) and -80℃ ultra-low temperature freezer (Haier DW-86L388).

[0138] Culture consumables: sterile culture dishes (90mm, Corning), sterile centrifuge tubes (1.5mL / 50mL, Eppendorf), sterile pipette tips (10μL / 200μL / 1000μL, Axygen), and sterile Erlenmeyer flasks (250mL, Corning).

[0139] Molecular biology consumables: agarose (Biowest), PCR tubes (0.2 mL, Axygen), enzyme digestion reaction tubes (1.5 mL, Eppendorf), and 96-well microplate (ELP0961W-02).

[0140] (2-2) Experimental reagents Restriction endonucleases: BamHI (10 U / μL), XhoI (10 U / μL), purchased from New England Biolabs.

[0141] Ligase: T4 DNA ligase (5 U / μL) and its matching buffer (10×T4 Ligase Buffer) were purchased from Takara Bio Inc.

[0142] PCR-related reagents: 2×Taq PCR Master Mix (containing Taq enzyme, dNTPs, and buffer) and primers (rhCOL7-F / R, rhCOL4-F / R, purified by HPLC) were purchased from Shanghai Sangon Biotech Co., Ltd.

[0143] DNA purification reagents: Takara MiniBEST Agarose Gel DNA Extraction Kit Ver. 4.0 and Takara MiniBEST Plasmid Purification Kit Ver. 4.0, purchased from Takara Bio Inc.

[0144] Sequencing reagents: BigDye Terminator v3.1 Cycle Sequencing Kit, purchased from ThermoFisher Scientific.

[0145] The basic components of the culture medium were: yeast extract (Oxoid), peptone (Oxoid), glucose (Sigma), yeast nitrogen base (YNB, amino acid-free, Difco), and yeast auxotrophic media (SD / -Leu, SD / -Trp, SD / -His, SD / -Leu-Trp, and SD / -Leu-Trp-His, purchased from Takara Bio Inc.).

[0146] Transformation reagents: Yeast Transformation Kit (Takara Yeast Transformation Kit Ver.2), salmon sperm DNA (10 mg / mL, Sigma), PEG 3350 (Sigma), lithium acetate (LiAc, Sigma), and transformation buffers (10×TEBuffer, 10×LiAc Buffer, purchased from Takara Bio Inc.).

[0147] Other reagents: YPD medium (2% yeast extract, 4% peptone and 2% glucose, autoclaved before use) and sterile deionized water.

[0148] Nutrient-deficient culture media: SD / -Leu-Trp solid medium (0.67% YNB, 2% glucose, 0.079% SD / -Leu-Trp amino acid mixture and 2% agar powder) and SD / -Leu-Trp-His solid medium (0.67% YNB, 2% glucose, 0.077% SD / -Leu-Trp-His amino acid mixture and 2% agar powder), both were autoclaved and then plated, and stored at 4℃.

[0149] Liquid culture medium: SD / -Leu-Trp liquid culture medium (composition is the same as solid culture medium, but without agar powder).

[0150] (2-3) Experimental Procedure (2-3-1) Construction of recombinant plasmids (rhCOL7-pGBT9 and rhCOL4-pGAD424) (2-3-1-1) PCR amplification of the target gene Prepare a 25 μL PCR reaction system: 12.5 μL 2×Taq PCR Master Mix, 0.5 μL 10 μmol / L upstream primer, 0.5 μL 10 μmol / L downstream primer, 1 μL 100 ng / μL template DNA, and 10.5 μL sterile deionized water.

[0151] Amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, rhCOL7 primer annealing for 30 s at 58℃, rhCOL4 primer annealing for 30 s at 56℃, extension at 72℃ (rhCOL7 extension for 2 min, rhCOL4 extension for 1.8 min), 35 cycles; final extension at 72℃ for 10 min, storage at 4℃.

[0152] After the amplification products were verified by 1% agarose gel electrophoresis, the target fragment was recovered using a DNA recovery kit.

[0153] (2-3-1-2) Double digestion of vector and target gene Prepare a 50 μL restriction enzyme digestion system: 10 μL plasmid / PCR product, 5 μL 10×CutSmart Buffer, 2 μL BamHI, 2 μL XhoI, and 31 μL sterile deionized water; incubate at 37℃ for 3 h, verify the restriction enzyme digestion effect by electrophoresis, and then recover the digested vector fragment and target gene fragment.

[0154] (2-3-1-3) Connection and Transformation Verification Prepare a 10 μL ligation system by digesting the vector fragment with the insert fragment at a 1:3 molar ratio: 2 μL of vector fragment digested with enzymes, 5 μL of target gene fragment digested with enzymes, 1 μL of 10×T4 Ligase Buffer, 1 μL of T4 DNA ligase, and 1 μL of sterile deionized water. Incubate at 16°C in a metal bath for 16 h to construct recombinant plasmids rhCOL7-pGBT9 and rhCOL4-pGAD424.

[0155] Transform 5 μL of the ligation product into 50 μL of DH5α competent cells. After incubating on ice for 30 min, subjecting them to a heat shock at 42℃ for 90 s, and then incubating on ice for 2 min, add 450 μL of antibiotic-free LB medium and revive at 37℃ and 220 rpm for 1 h. Spread 100 μL of the revival solution onto LB agar plates containing 100 μg / mL ampicillin and incubate at 37℃ for 12-16 h. After picking and culturing single colonies, extract the plasmid, which is the positive recombinant plasmid.

[0156] (2-3-2) Yeast co-conversion (2-3-2-1) Activation of yeast strains Take a small amount of bacterial culture from Y2HGold glycerol bacteria stored at -80℃, streak it on YPD solid plates, and incubate at 30℃ for 48h; pick a single colony and inoculate it into 5mL of YPD liquid medium, and incubate at 30℃ and 220rpm for 16h until OD600≈0.5 to obtain activated bacterial culture.

[0157] (2-3-2-2) Conversion System Setup Experimental group set up: rhCOL7-pGBT9 (0.5μg) + rhCOL4-pGAD424 (0.5μg); Negative control group: Group 1 was 0.5 μg empty pGBT9 + rhCOL4-pGAD424 (i.e., containing only rhCOL4-pGAD424); Group 2 was 0.5 μg rhCOL7-pGBT9 + empty pGAD424 (i.e., containing only rhCOL7-pGBT9). Take 0.5 μg of recombinant plasmid / empty vector from each group, add 10 μg of salmon sperm DNA (pre-denatured at 95℃ for 5 min, then in an ice bath for 10 min), mix well and set aside.

[0158] (2-3-2-3) Yeast Conversion Operation Centrifuge 1 mL of activated bacterial solution at 8000 rpm for 5 min, discard the supernatant, resuspend the bacterial cells in 1 mL of sterile deionized water, and wash twice. Add 100 μL of freshly prepared 1×TE+1×LiAc conversion buffer and resuspend to prepare competent yeast cells.

[0159] Add the plasmid mixture (prepared in 2-3-2-2) to competent cells, mix well, then add 600 μL of 40% PEG 3350 solution and quickly invert to mix; incubate at 30°C for 30 min (shaking gently once every 10 min); heat shock at 42°C for 15 min, centrifuge at 8000 rpm for 5 min, discard the supernatant, and resuspend the cells in 100 μL of supernatant.

[0160] Spread 100 μL of the resuspension onto SD / -Leu-Trp nutrient-deficient plates, with 3 replicates per group, and incubate at 30℃ for 3 to 5 days to observe colony growth.

[0161] (2-3-3) Interaction screening and verification (2-3-3-1) Transformant scaling-up culture Pick 5 uniform single colonies from SD / -Leu-Trp plates and inoculate them into 5 mL of SD / -Leu-Trp liquid medium. Incubate at 30°C and 220 rpm for 2-3 days until OD (Organic Degradation). 600 ≈1.0.

[0162] (2-3-3-2) Nutrient deficiency plate screening Equilibrate the SD / -Leu-Trp control plate and SD / -Leu-Trp-His selection plate to room temperature; take 100 μL of culture and perform 10... -1 10 -2 10 -3 Serial dilutions were performed, with 5 μL of the original bacterial culture and the diluent applied to the corresponding areas of the two types of plates, with three replicates per group.

[0163] After the bacterial culture is dried, the plate is inverted and incubated at 30°C for 4 days. The growth status of the colonies is observed and recorded daily.

[0164] (3) Experimental results On SD / -Leu-Trp control plates, normal colonies grew in both the experimental group and all negative control groups, indicating that the recombinant plasmid was successfully transformed into the yeast strain and could be stably maintained. On the SD / -Leu-Trp-His screening plate, such as Figure 8 As shown, only the experimental group (rhCOL7-pGBT9+rhCOL4-pGAD424) showed colony growth, while neither of the two negative control groups showed colony growth.

[0165] The above results confirm that the rhCOL7 prepared in this application can undergo specific protein-protein interactions with rhCOL4, and neither rhCOL7 nor rhCOL4 exhibits self-activation. This indicates that rhCOL7 possesses the ability to synergistically interact with type IV collagen, a key protein in the ECM, and can participate in the assembly process of the basement membrane. Therefore, the recombinant humanized type VII collagen (rhCOL7) prepared in this application can specifically interact with type IV collagen, acting as a synergistic interaction factor for key proteins in the ECM. It can mediate the assembly of anchored fibrils at the epidermal-dermal junction by binding to core proteins of the basement membrane, providing important molecular mechanism support for its efficient skin barrier repair and wound tissue repair.

[0166] Experimental Example 5 - Long-term thermal stability experiment of recombinant type VII humanized collagen This experimental example uses high-temperature moist heat sterilization treatment (115℃, 30 min) and long-term (60 days) accelerated aging test at 60℃ to test the thermal stability and storage stability of the recombinant humanized type VII collagen (rhCOL7) prepared in this application from multiple dimensions such as appearance, pH, odor, protein purity, protein content, cell proliferation activity and cell adhesion activity. It verifies its performance in resisting high-temperature sterilization and long-term storage, and provides stability data support for its practical application in skin care products, medical wound repair materials and other fields.

[0167] (1) Experimental materials Test material: Recombinant type VII humanized collagen (prepared in Example 1, batch number 20250209) was diluted with pure water to a protein solution with a concentration of 1 mg / mL.

[0168] Testing methods: pH testing follows section 6.1.6 pH in the industry standard YY / T 1888-2023 Recombinant Humanized Collagen. Protein purity testing follows section 5.3.2 High Performance Liquid Chromatography in the industry standard YY / T 1888-2023 Recombinant Humanized Collagen. Protein content testing follows section 6.8 Recombinant Collagen Content in the industry standard YY / T 1947-2025 Recombinant Collagen Dressings. Stability testing follows section 6.1.1 Appearance and 6.1.2 Visible Foreign Matter in the industry standard YY / T 1888-2023 Recombinant Humanized Collagen. The cell proliferation-promoting activity was detected according to the standard YY / T 1849-2022 Recombinant Collagen, using the MTT assay. Recombinant type III collagen (rhCOL3) was used as a control to detect the proliferation-promoting effect of the recombinant humanized type VII collagen (rhCOL7) prepared in this application on mouse embryonic fibroblasts (3T3). Following standard cell adhesion assays, recombinant fibronectin (rhFN) was used as a positive control. The cell adhesion-promoting bioactivity of rhCOL7 prepared in this application was verified by detecting its adhesion-promoting effect on bovine kidney cells (MDBK). The cell migration-promoting activity was detected by referring to the cell scratch assay, using recombinant elastin (rhELP) as a control, to detect the cell migration-promoting effect of the recombinant humanized type VII collagen (rhCOL7) prepared in this application on Balb / c 3T3 mouse embryonic fibroblasts, and to verify the in vitro cell migration-promoting biological activity of rhCOL7.

[0169] (2) Experimental procedure A 1 mg / mL recombinant type VII humanized collagen (rhCOL7) protein solution was prepared. The recombinant type VII humanized collagen protein solution was subjected to filtration sterilization (control group) and moist heat sterilization (115℃, 30 min). The protein purity (detected by high performance liquid chromatography), protein content (detected by Kjeldahl method), solution appearance, pH, odor, cell proliferation activity, cell adhesion activity and cell migration activity of the sterilized protein solution were detected.

[0170] The recombinant type VII humanized collagen control group (filtered sterilization) and the moist heat sterilization group (115℃, moist heat sterilization for 30 min) were placed in a 60℃ constant temperature incubator for 60 days. During this period, the protein purity (detected by high performance liquid chromatography), protein content (detected by Kjeldahl method), solution appearance, pH, and odor were measured every 15 days. The initial and time-point detection data of the two groups were compared to analyze the performance changes of rhCOL7 after high-temperature moist heat sterilization, as well as its degradation and stability under long-term storage at 60℃.

[0171] (3) Experimental results (3-1) Immediate test results after high-temperature and moist heat sterilization Appearance and smell: such as Figure 9 As shown, both the control group and the moist heat sterilization group samples were clear and transparent liquids, with no visible foreign matter and no irritating odor, and there was no significant difference between the two groups; pH: The pH of the control group was 5.54±0.3, and the pH of the moist heat sterilization group was 5.57±0.3. There was no significant difference in pH between the two groups, and both were within the stable range. Protein purity: such as Figure 10 As shown, the control group ( Figure 10 Protein A in the sample has a purity of 100%, and the wet heat sterilization group ( Figure 10 The purity of protein B in the sample was 98.46%, with a purity ≥ 98%, and no significant degradation. Protein content: The protein concentration in the control group was 1.06 mg / mL, and the protein concentration in the moist heat sterilization group was 1.02 mg / mL. There was no significant difference in protein content between the two groups, and no protein precipitation or significant decrease in content was observed.

[0172] (3-2) Results of accelerated aging at 60℃ for 60 days At time points of 15, 30, 45, and 60 days after being placed at 60℃, the test results of the control group and the moist heat sterilization group (as shown in Table 6) remained stable with no significant changes. Appearance and smell: such as Figure 11 As shown, both groups of samples were clear and transparent liquids throughout the entire process, with no visible foreign matter, no sediment, no turbidity, and no irritating odor. pH: The pH of both groups of samples fluctuated slightly over time, with the fluctuation range being between 5.35 and 5.57, without significant shift, and remained stable; Protein content: The protein concentration of both groups of samples remained between 0.97 mg / mL and 1.08 mg / mL throughout the process, without a significant decrease, and the protein content was stable. Protein purity: such as Figure 12 As shown, the control group ( Figure 12 In group A), the protein purity was 95% after 60 days of storage, compared to the moist heat sterilization group ( Figure 12 In B) after 60 days of storage, the protein purity was still ≥90%, and no obvious degradation was observed.

[0173] Cell proliferation-promoting activity: as shown in Table 7 and Figure 13 As shown, the control group (rhCOL3, Figure 13 After being subjected to accelerated degradation at 60℃ for 60 days, the protein's cell proliferation-promoting activity titer was 540 (U / mL), a decrease of 52.63%; the rhCOL7 treatment group ( Figure 13 After accelerated destruction at 60℃ for 60 days, the protein's cell proliferation-promoting activity titer was 1730 (U / mL), a decrease of 28.80%, and the stability of rhCOL7's cell proliferation-promoting activity was better than that of the control treatment.

[0174] Cell adhesion-promoting activity: As shown in Table 7, after accelerated destruction at 60℃ for 60 days, the cell adhesion-promoting activity titer of the control group (rhFN) was 8100 (U / mL), a decrease of 19.16%; after accelerated destruction at 60℃ for 60 days, the cell adhesion-promoting activity titer of the rhCOL7 treatment group was 8300 (U / mL), a decrease of 25.89%. The stability of the cell adhesion-promoting activity of rhCOL7 was not significantly different from that of the control treatment.

[0175] Cell migration-promoting activities: as shown in Table 7 and Figure 14 As shown, after 60 days of accelerated destruction at 60℃, the protein-induced cell migration rate of the control group (rhELP) was 30.28%, a decrease of 9.95%; after 60 days of accelerated destruction at 60℃, the protein-induced cell migration rate of the rhCOL7 treatment group was 38.92%, a decrease of 16.72%, and the rhCOL7-induced cell migration rate was greater than that of the control treatment.

[0176] Table 6. Results of physicochemical properties of recombinant type VII humanized collagen samples after accelerated degradation at 60℃

[0177] Table 7. Results of various activity indicators of recombinant type VII humanized collagen samples after accelerated degradation at 60℃

[0178] In summary, the recombinant humanized type VII collagen (rhCOL7) prepared in this application exhibits excellent thermal stability and long-term storage stability. (1) rhCOL7 can withstand high temperature and humidity sterilization treatment at 115℃ for 30 min. After sterilization, the appearance, odor and pH of the protein do not change significantly. The purity is ≥98%, the protein content is stable, and there is no significant degradation or precipitation. It can meet the high temperature and humidity sterilization requirements of medical device products. (2) After being sterilized by high temperature and humidity, rhCOL7 was stored at 60℃ for 60 days. Its appearance, odor and pH remained stable. There was no precipitation or irritating odor. The protein purity was still ≥90%. The protein content did not decrease significantly and there was no obvious degradation or denaturation. (3) After being sterilized by high temperature and humidity, rhCOL7 was placed at 60℃ for 60 days. The cell proliferation activity decreased by 28.80%, the cell adhesion activity decreased by 25.89%, and the cell migration rate decreased by 16.72%. The long-term stability of the protein activity was good. (4) The rhCOL7 of this application overcomes the technical defects of existing collagen denaturation temperature and easy degradation and desorption. It has good high temperature resistance and long-term storage stability, and can be adapted to the production, sterilization and storage requirements of many fields such as skin care products and medical wound repair materials.

[0179] In summary, Example 1 of this application, through sequence optimization, recombinant vector construction, screening and identification of Pichia pastoris GS115 engineered strain, pilot-scale fermentation, and cation exchange chromatography purification, obtained a high-purity rhCOL7 protein stock solution. Simultaneously, a recombinant Pichia pastoris engineered strain GS115 / pPIC9K / rhCOL7 capable of stable expression was obtained, providing a qualified test sample for all subsequent performance verifications. Example 1 of this application, according to industry standards, used the MTT assay to detect the cell proliferation-promoting activity of rhCOL7, confirming that its corrected titer reached 2290 U / mg, significantly superior to recombinant type III collagen, with a stable proliferation-promoting activity exceeding 2000 U / mg. Example 2 verified the cell migration-promoting activity of rhCOL7 through a cell scratch assay, showing a migration rate of 52.41% in 3T3 cells, significantly superior to recombinant elastin, effectively promoting the migration of repair-related cells to the damaged site. Example 3, through cell adhesion experiments, confirmed that rhCOL7 promoted cell adhesion at a titer of 10800 U / mL, superior to recombinant fibronectin, and could efficiently mediate cell adhesion and colonization, laying the foundation for tissue repair. Example 4, using a yeast two-hybrid system, verified that rhCOL7 can undergo specific protein-protein interactions with type IV collagen and possesses the ability to synergistically interact with key extracellular matrix proteins, mediating basement membrane anchoring fibril assembly. Example 5, through high-temperature moist heat sterilization and a long-term accelerated test at 60℃, confirmed that rhCOL7 has excellent thermal stability, tolerating moist heat sterilization at 115℃ / 30min (purity ≥98% after sterilization), and maintaining a purity ≥90% after 60 days at 60℃, with no significant changes in appearance, pH, or protein content, and no degradation or leaching.

[0180] In summary, the recombinant humanized type VII collagen, its preparation method, and its applications provided in this application have the following advantages: This application utilizes the Pichia pastoris eukaryotic expression system, combined with codon preference optimization, multi-copy engineered strain screening, and pilot-scale fermentation technology, to avoid the protein misfolding problem in prokaryotic expression. This achieves efficient and large-scale preparation of rhCOL7 without immunogenicity or biosafety risks. Furthermore, the recombinant rhCOL7 protein is a biological protein with advantages such as easy decomposition and no residue, offering broader application prospects compared to common chemical cosmetics and hormonal drugs.

[0181] The recombinant humanized type VII collagen prepared in this application integrates the core functional domains of type VII collagen and possesses significant cell proliferation, migration, and adhesion-promoting activities. All activity indicators are superior to existing recombinant proteins of the same type (such as type III collagen, elastin, and fibronectin), providing comprehensive support for the cellular biological processes of wound healing and tissue repair. Furthermore, it can specifically bind to type IV collagen, achieving synergistic interaction with key extracellular matrix proteins. It can mimic the in vivo ECM network regulatory system, mediating the assembly of basement membrane anchored fibrils, and achieving efficient repair of the epidermal-dermal junction at the molecular level. It further solves the problems of low denaturation temperature, poor heat sterilization resistance, and poor storage stability of existing collagens. rhCOL7 can withstand the 115℃ moist heat sterilization commonly used in medical devices and does not degrade or leach out after long-term high-temperature storage. It also meets the production, sterilization, and storage requirements of skincare products and medical wound repair materials, making it suitable for a wide range of applications.

[0182] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on its differences from other embodiments. Similar or identical parts between embodiments can be referred to interchangeably. Although preferred embodiments of the present application have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims only include the preferred embodiments and all changes and modifications falling within the scope of the embodiments of this application.

[0183] Finally, it should be noted that in this application, relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or terminal device that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or terminal device. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or terminal device that includes the element.

[0184] This application uses specific examples to illustrate the principles and implementation methods of this application. The description of the above embodiments is only for the purpose of helping to understand the method and core ideas of this application. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this application. Therefore, the content of this specification should not be construed as a limitation of this application.

Claims

1. A heat-resistant and stable recombinant humanized type VII collagen, characterized in that, The amino acid sequence of the recombinant humanized type VII collagen is shown in SEQ ID No. 5, and the amino acid sequence is obtained by tandemly connecting four fragments of type VII collagen; The amino acid sequences of the four fragments are shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, respectively. The recombinant humanized type VII collagen has a purity of ≥98% after being treated with moist heat sterilization at 115℃ for 30 min, and a purity of ≥90% after being placed at 60℃ for 60 days without degradation or denaturation.

2. A nucleic acid encoding the recombinant humanized type VII collagen of claim 1, characterized in that, The nucleotide sequence of the nucleic acid is shown in SEQ ID No. 6, which is the Pichia pastoris codon preference optimized sequence.

3. A recombinant expression vector containing the nucleic acid of claim 2, characterized in that, The recombinant expression vector was obtained by inserting the gene fragment of the nucleotide sequence into the pPIC9K plasmid via EcoRI and NotI restriction sites.

4. A genetically engineered bacterium containing the recombinant expression vector of claim 3, characterized in that, The genetically engineered bacteria were obtained by the following method: the recombinant expression vector was linearized and electroporated into Pichia pastoris GS115 competent cells, and positive transformants that could grow on YPD plates containing 3 mg / mL G418 were obtained after screening.

5. A method for preparing recombinant humanized type VII collagen according to claim 1, characterized in that, Includes the following steps: The nucleotide sequence shown in SEQ ID No. 6 was synthesized and inserted into the pPIC9K plasmid to construct a recombinant expression vector; The recombinant expression vector was linearized and then electroporated into Pichia pastoris GS115 competent cells. Positive recombinant engineered bacteria were obtained after screening and identification. The positive recombinant engineered bacteria were inoculated into a fermentation medium for fermentation culture to induce the expression of the recombinant humanized type VII collagen; After fermentation, the supernatant obtained from fermentation was separated and purified to obtain the recombinant humanized type VII collagen.

6. The method according to claim 5, characterized in that, The screening and identification process includes: plating the transformed strains onto YPD plates containing G418 for resistance screening, and identifying whether the target gene has been integrated into the yeast chromosome by PCR amplification.

7. The method according to claim 5, characterized in that, The fermentation culture includes a glycerol growth stage and a methanol induction stage. The methanol induction stage is carried out at a temperature of 25°C, with 0.5% methanol added every 24 hours for induction.

8. The method according to claim 5, characterized in that, The purification process employed cation exchange chromatography using SP Purose 6 High Performance chromatography media. The chromatography was equilibrated with phosphate buffer and eluted with phosphate buffer containing NaCl.

9. The use of the recombinant humanized type VII collagen according to claim 1 in the preparation of a medicament having the functions of promoting cell proliferation, promoting cell migration and / or promoting cell adhesion.

10. The use of the recombinant humanized type VII collagen according to claim 1 in the preparation of drugs or biorepair materials that interact with key ECM proteins.

Citation Information

Patent Citations

  • Saccharomyces cerevisiae expressed long-acting recombinant fibronectin and application thereof in cosmetics

    CN113186109A

  • Recombinant human type 4 collagen as well as preparation method and application thereof

    CN117024572A

  • Elastin with repairing and anti-wrinkle activity as well as preparation method and application of elastin

    CN118530376A

  • Recombinant collagen capable of being self-assembled as well as preparation method and application thereof

    CN118561987A

  • Long-acting heat-resistant collagen as well as preparation method and application thereof

    CN116987179A