Industrial hemp endophytic fungus hddmz04 producing xanthotoxin and apigenin and application thereof

The fermentation method using the endophytic fungus HDDMZ04 in industrial hemp to produce apigenin and apigenin solves the problems of low content in plants and the environmental unfriendliness of chemical synthesis, achieving efficient and low-cost compound production with good bioactivity.

CN122104441APending Publication Date: 2026-05-29HEILONGJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HEILONGJIANG UNIV
Filing Date
2026-04-08
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

The content of apigenin and senna is low in plants, and chemical synthesis is costly and environmentally unfriendly. Chemically synthesized drugs also have toxicity issues.

Method used

The endophytic fungus HDDMZ04 from industrial hemp was used for microbial fermentation to produce apigenin and apigenin, and these compounds were synthesized using secondary metabolites of the fungus HDDMZ04.

Benefits of technology

It has achieved efficient and environmentally friendly production of apigenin and senna extract, with high yield, few by-products, and low cost, making it suitable for industrial production, and possessing good antioxidant and antibacterial activity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104441A_ABST
    Figure CN122104441A_ABST
Patent Text Reader

Abstract

A hemp endophyte HDDMZ04 producing chrysoeridol and apigenin and application thereof relates to the field of microorganisms, and aims to solve the problems of high cost and environmental unfriendliness of the existing preparation method of chrysoeridol and apigenin. The hemp endophyte is fusarium HDDMZ04, which has been preserved in China typical culture collection center, the preservation address is Wuhan University in Wuhan, the preservation date is December 25, 2025, and the preservation number is CCTCC NO: M 20253016. The hemp endophyte can ferment to produce chrysoeridol and apigenin, has in-vitro antioxidant effect, and has inhibitory effect on bacillus subtilis, bacillus pumilus and pseudomonas aeruginosa. The present application is used for bacteriostasis, production of chrysoeridol and apigenin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbiology, specifically to an industrial hemp endophytic fungus HDDMZ04 that produces apigenin and sennain, and its applications. Background Technology

[0002] Jin Sheng Cao Fan Zi has bioactive effects such as anti-tumor, anti-allergy, and anti-inflammatory properties. However, its content in plants is very low, making it difficult and costly to obtain from plant raw materials. Chemical synthesis has advantages such as readily available raw materials, simple operation, and suitability for large-scale production; however, chemical synthesis often produces byproducts and is not environmentally friendly.

[0003] Apigenin, a natural flavonoid isolated from plants, possesses various biological activities, including antitumor, antioxidant, antiviral, antibacterial, and antihypertensive effects. Regarding its antihypertensive effect, apigenin exerts its effect through mechanisms such as regulating lipid metabolism and improving vascular function. However, chemically synthesized antihypertensive drugs often have significant toxicity issues. In contrast, apigenin has virtually no adverse reactions when used for antihypertensive purposes, thus demonstrating high development potential. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides an industrial hemp endophytic fungus, HDDMZ04, that produces apigenin and sennain, and its applications.

[0005] This invention provides an endophytic fungus of industrial hemp, HDDMZ04, which is a Fusarium sp. HDDMZ04. It has been deposited at the China Center for Type Culture Collection (CCTCC) at Wuhan University, Wuhan City, on December 25, 2025, with accession number CCTCC NO: M 20253016.

[0006] The colonies of the industrial hemp endophytic fungus HDDMZ04 of this invention are white, with dense, velvety hyphae, and a white substrate. Unbranched sporophytes and spores grow on the hyphae.

[0007] The ITS rDNA sequence (567 bp) of the industrial hemp endophytic fungus HDDMZ04 of this invention was submitted to the NCBI database, BLAST analysis was performed and compared, and a phylogenetic tree of the endophytic fungus HDDMZ04 was constructed using MEGA11 software, as follows: Figure 3 As shown, the HDDMZ04 strain sequence showed 100% similarity to Fusarium solani (MT530244.1). The endophytic fungus HDDMZ04 was identified as Fusarium solani.

[0008] The present invention relates to the application of the industrial hemp endophytic fungus HDDMZ04 in the fermentation production of safflower flavonoids.

[0009] The present invention relates to the application of the industrial hemp endophytic fungus HDDMZ04 in the fermentation production of apigenin.

[0010] This invention relates to the application of the industrial hemp endophytic fungus HDDMZ04 in in vitro antioxidant activity.

[0011] The beneficial effects of this invention are:

[0012] This invention isolates an endophytic fungus, HDDMZ04, from industrial hemp, identified as *Fusarium solani*. The secondary metabolites of HDDMZ04 contain apigenin and safflowerin, exhibiting good antioxidant activity, providing a new method for producing apigenin and safflowerin using microbial fermentation. Microbial fermentation does not damage plant resources, yields high output, produces few byproducts, causes minimal pollution, has a short production cycle, low cost, and relatively simple product separation, making it suitable for industrial production. Attached Figure Description

[0013] Figure 1 This image shows the colony morphology of the industrial hemp endophytic fungus HDDMZ04.

[0014] Figure 2 Image showing the hyphal morphology of HDDMZ04, an endophytic fungus in industrial hemp.

[0015] Figure 3 Phylogenetic tree of HDDMZ04, an endophytic fungus in industrial hemp;

[0016] Figure 4 The scavenging ability of fermentation broth of HDDMZ04, an endophytic fungus in industrial hemp, against DPPH free radicals;

[0017] Figure 5 The scavenging ability of fermentation broth of HDDMZ04, an endophytic fungus in industrial hemp, against •OH free radicals;

[0018] Figure 6 HPLC analysis results of compound A in the fermentation broth of HDDMZ04, an endophytic fungus of industrial hemp;

[0019] Figure 7 The results of HPLC analysis of compound B in the fermentation broth of HDDMZ04, an endophytic fungus of industrial hemp. Detailed Implementation

[0020] The embodiments of the present invention will be described in detail below. The following embodiments are implemented based on the technical solution of the present invention, and detailed implementation schemes and specific operation processes are given. However, the protection scope of the present invention is not limited to the following embodiments.

[0021] Example 1:

[0022] The industrial hemp endophytic fungus HDDMZ04 in this embodiment is Fusarium sp. HDDMZ04, which has been deposited at the China Center for Type Culture Collection (CCTCC) at Wuhan University, Wuhan City, on December 25, 2025, with accession number CCTCC NO: M 20253016.

[0023] The method for obtaining the industrial hemp endophytic fungus HDDMZ04 in this embodiment is as follows:

[0024] Take the leaves of industrial hemp (Cannabis sativa L.) (Longma No. 5, collected from the Science and Technology Innovation Farm of Suihua Branch of Heilongjiang Academy of Agricultural Sciences), and disinfect the surface. The disinfection procedure is as follows: soak in 75% alcohol for 30 seconds, wash with sterile water, then soak in NaClO for 5 minutes, wash with sterile water, then soak in 75% alcohol for 30 seconds, and finally wash with sterile water.

[0025] Using a sterile scalpel, cut the sterilized experimental material into small square pieces with sides of 5 mm. Place them in PDA medium and incubate at 28°C for 5–7 days. After the final wash of the sterilization procedure, spread the inoculum onto PDA medium. Place the sterilized, uncut experimental material on PDA medium, roll it once, and then remove it for co-culturing with endophytic fungal isolation medium as a control.

[0026] Preparation of Potato Solid Culture Medium (PDA): Weigh 200g of fresh, peeled potato chunks and place them in boiling water. Keep boiling for 30 min, filter, add 20g of glucose and 20g of agar powder to the filtrate, and after they are completely dissolved, add water to make up the total volume of the culture medium to 1 L. Set the pH to natural, dispense, sterilize (121℃, 0.1 MPa, 30 min), and cool for later use.

[0027] Endophytic fungus HDDMZ04 was isolated from industrial hemp leaves. No fungi grew in either the negative control plate or the negative control solution culture medium. This was repeated multiple times, thus proving that the isolated fungus was an endophytic fungus of industrial hemp.

[0028] Example 2: Identification of the endophytic fungus HDDMZ04 in industrial hemp

[0029] The colony morphology of the industrial hemp endophytic fungus HDDMZ04 is shown in the figure below. Figure 1 As shown in the diagram, the hyphal morphology is as follows: Figure 2 As shown. The colonies of the industrial hemp endophytic fungus HDDMZ04 are white, with dense, velvety hyphae, and the substrate is white. Unbranched sporophytes and spores grow on the hyphae.

[0030] The ITS rDNA sequence (567 bp) of the industrial hemp endophytic fungus HDDMZ04 of this invention was submitted to the NCBI database, BLAST analysis was performed and compared, and a phylogenetic tree of the endophytic fungus HDDMZ04 was constructed using MEGA11 software, as follows: Figure 3 As shown, the HDDMZ04 strain sequence showed 100% similarity to Fusarium solani (MT530244.1). The endophytic fungus HDDMZ04 was identified as Fusarium solani.

[0031] The ITS rDNA sequence of strain HDDMZ04 (as shown in SEQ ID NO: 1 in the sequence listing):

[0032] GATATGCTTAAGTTCAGCGGGTATTCCCTACCTGATTCGAGGTCAACATTCAGAAGTTGGGTGTTTTACGGCATGGCCGCGCCGTCTCCAGTTGGCGAGGTGTTAGCTACTACGCAATGGAAGCTGCGGCGGGACCGCCACT GTATTTGAGGGACGGCGTGTGCCCACAGGGGGCTTCCGCCGATCCCCAACGCCAGGCCCGGGGGCCTGAGGGTTGTAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGAT GATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAATTTATTTGCTTGTTACTCAGAAAAACATTATAAAAACAGAGTTAGGG GTCCTCTGGCGGGGGCGGCCCGTTGTTACAGGGCCGTCTGTTCCCGCCGAAGCAACGTTTTAGGTATGTTCACAGGGTTGATGAGTTGTATAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGAC

[0033] Example 3: Antioxidant Activity Analysis of Endophytic Fungus HDDMZ04 from Industrial Hemp

[0034] Activation of endophytic fungus HDDMZ04: Take endophytic fungus HDDMZ04, inoculate it onto the surface of PDA medium under aseptic conditions, and incubate at 28 ℃ for 3 days for later use.

[0035] Preparation of fermentation broth from endophytic fungus HDDMZ04: Activated endophytic fungus HDDMZ04 was used. Mycelia were picked and inoculated into 50 mL of PDB medium under aseptic conditions. The medium was then cultured in a shaker at 28 ℃ and 120 r / min for 5 days to prepare 1×10⁻⁶ fermentation broth. 7 CFU / mL seed culture; the seed culture was transferred to 3L of sterilized PDB medium at an inoculation rate of 20% (v / v), and cultured on a shaker at 28℃ and 120 r / min for 15 days. The fermentation broth was collected, concentrated under reduced pressure, extracted with ethyl acetate (3×100mL), concentrated at low temperature to a paste, dried at 60℃, pulverized, and prepared as fermentation broth powder for later use.

[0036] 1. Determination of DPPH free radical scavenging ability

[0037] Dissolve an appropriate amount of DPPH in methanol and bring the volume to 100 mL to prepare a solution with a mass concentration of 0.15 mmol·L⁻¹. -1 DPPH solution; dissolve an appropriate amount of vitamin C in methanol and dilute to 10 mL to obtain 200 μg / mL. -1 The reference solution;

[0038] Dissolve the above-mentioned endophytic fungus HDDMZ04 fermentation broth powder in an appropriate amount of methanol to prepare a solution with a concentration of 200 μg·mL. -1 The test solution.

[0039] The above reference standard and test solution were diluted sequentially to a concentration gradient of 100 μg / mL. -1 50 μg·mL -1 25 μg·mL -1 12.5 μg·mL -1 6.25 μg·mL -1 Pipette 2 mL of each solution into a test tube, with methanol serving as a blank control. Add 0.15 mmol·L⁻¹ to each test tube. -1 4 mL of DPPH solution was added and placed in the dark for 30 min. The absorbance of each sample was measured at 517 nm (n=3). The formula for calculating the DPPH free radical scavenging rate is as follows:

[0040]

[0041] Where A i To measure the absorbance of both the sample and the DPPH solution added simultaneously; A jA1 represents the absorbance when the test sample and blank control are added simultaneously; A0 represents the absorbance when the blank control and DPPH solution are added simultaneously.

[0042] The scavenging ability of the fermentation broth of industrial hemp endophytic fungus HDDMZ04 against DPPH free radicals is shown in [reference needed]. Figure 4 The curve ■ represents Vc, and the curve ▲ represents the fermentation broth.

[0043] from Figure 4 It can be seen that the fermentation broth of the endophytic fungus HDDMZ04 has a certain DPPH free radical scavenging ability, and the scavenging rate is related to the concentration of the fermentation broth. When the concentration of the endophytic fungus HDDMZ04 fermentation broth is between 6.25 μg / mL and 100 μg / mL, its DPPH free radical scavenging ability is positively correlated with the concentration. The experimental results show that the fermentation broth of the industrial hemp endophytic fungus HDDMZ04 has good antioxidant activity.

[0044] 2. Determination of ·OH free radical scavenging ability

[0045] Take 2 mL of each of the above-mentioned test solutions of different concentrations and place it in a test tube. Add 2 mL of 6 mmol·L⁻¹ solution to each tube. -1 FeSO4, 2 mL 6 mmol·L -1 Add H2O2, shake to mix well, let stand for 10 min, then add 2 mL of 6 mmol·L⁻¹ H₂O₂. -1 The salicylic acid-ethanol solution was allowed to stand at 37℃ for 30 min, and the absorbance of each sample was measured at 510 nm (n=3). The formula for calculating the ·OH free radical scavenging rate is as follows:

[0046]

[0047] Where A1 is the absorbance of the added sample; A2 is the absorbance of distilled water as a substitute for H2O2; and A0 is the absorbance of methanol as a substitute for the sample.

[0048] The scavenging ability of the fermentation broth of HASZ5, an endophytic fungus in industrial hemp, against ·OH free radicals is shown in [reference needed]. Figure 5 The curve ■ represents vitamin C, and the curve ▲ represents the fermentation broth.

[0049] Depend on Figure 5 It can be seen that the fermentation broth of the endophytic fungus HDDMZ04 has a certain ·OH free radical scavenging ability, and the scavenging rate is related to the concentration of the fermentation broth. When the concentration of the endophytic fungus HDDMZ04 fermentation broth is between 6.25 μg / mL and 100 μg / mL, its ·OH free radical scavenging ability is positively correlated with the concentration. The experimental results show that the fermentation broth of the industrial hemp endophytic fungus HDDMZ04 has good antioxidant activity.

[0050] Example 4: Antibacterial activity analysis of endophytic fungus HDDMZ04 in industrial hemp

[0051] 1. Activation of endophytic fungus HDDMZ04: Take endophytic fungus HDDMZ04, inoculate it onto the test surface containing PDA medium under aseptic conditions, and incubate at 28 ℃ for 3 days for later use.

[0052] 2. Preparation of the test solution: The fermentation broth of endophytic fungus HDDMZ04 was concentrated to 50 mL under reduced pressure at 50℃. Then, 50 mL of methanol was added, and the mixture was extracted three times by sonication. The extract was concentrated to dryness under reduced pressure, and then dissolved in 10 mL of methanol to prepare the test solution. Appropriate amounts of streptomycin and nystatin powder were dissolved separately in methanol to prepare a 200 μg / mL positive control solution for later use.

[0053] 3. Preparation of plates containing the test strain

[0054] Activated test bacteria, including Staphylococcus aureus, Bacillus pumilus, Bacillus subtilis, Listeria monocytogenes, Enterococcus facalis, Enterococcus faecium, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baummanii, and Pseudomonas aeruginosa, were inoculated into NA test tube slants and incubated at 37 °C for 1 day. Activated test fungi, Candida albicans, were inoculated into PDA test tube slants and incubated at 28 °C for 3 days for later use. All test strains were purchased from the Heilongjiang Provincial Institute of Microbiology.

[0055] Take the activated test strains mentioned above, add an appropriate amount of sterile water, shake, and dilute each strain to 1×10⁻⁶. 7 The bacterial suspension of CFU / mL was poured into the corresponding culture medium and dispensed into sterile plates containing Oxford cups. After solidification, the Oxford cups were removed and set aside for later use.

[0056] 4. Antibacterial activity analysis:

[0057] Accurately add 150 μL of the test solution, positive control solution, and negative control solution to two wells of the prepared bacterial plates. After incubating the plates containing bacteria at 37 ℃ for 1 day, measure the diameter of the inhibition zone (n=3); after incubating the plates containing fungi at 28 ℃ for 3 days, measure the diameter of the inhibition zone (n=3). The antibacterial activity of the fermentation broth of the endophytic fungus HDDMZ04 is shown in Table 1.

[0058] Table 1. Results of antibacterial activity of fermentation broth containing endophytic fungi HDDMZ04 from industrial hemp.

[0059]

[0060] Note: A: Staphylococcus aureus; B: Listeria monocytogenes; C: Bacillus subtilis; D: Enterococcus faecalis; E: Enterococcus faecium; F: Bacillus pumilus; G: Escherichia coli; H: Pseudomonas aeruginosa; I: Klebsiella pneumoniae; J: Acinetobacter baumannii; K: Candida albicans; Str: Streptomycin; Nys: Nystatin; -: No antibacterial activity observed.

[0061] As can be seen from the results in Table 1, the endophytic fungus HDDMZ04 in industrial hemp has antibacterial activity, especially against Bacillus subtilis, Bacillus pumilus, and Pseudomonas aeruginosa, indicating that there are antibacterial active substances in the fermentation broth of the endophytic fungus HDDMZ04.

[0062] Example 5: Extraction and separation of secondary metabolites from the endophytic fungus HDDMZ04 in industrial hemp

[0063] Take 20L of fermentation broth from endophytic fungi HDDMZ04 and slowly pass it through D 101 A macroporous adsorption resin column (chromatographic column: 6 cm in diameter, 50 cm in height) was used for gradient elution with 30%, 50%, 70%, and 90% ethanol, and different elution fractions were collected. The 30% ethanol eluent was collected, the ethanol was recovered, and the fraction was subjected to silica gel column chromatography with chloroform:methanol (10:1) as the eluent. The eluent was collected at 10 mL / vial and analyzed by thin-layer chromatography. The fractions from vials 216 to 271 were combined to obtain the crude product. The crude product was then subjected to secondary separation by polyamide column chromatography with chloroform:methanol (1:1) as the eluent. The fractions from vials 24 to 62 were combined, the solvent was recovered, and the product was recrystallized multiple times to obtain compound A.

[0064] Separately, the elution fraction of 70% ethanol was collected, the ethanol was recovered, and the fraction was separated by polyamide column chromatography. Using 70% ethanol as the eluent, the eluent fraction was collected at a rate of 10 mL / vial and analyzed by thin-layer chromatography. The eluents of vibrators 142 to 188 were combined to obtain the crude product. The crude product was then separated a second time by silica gel column chromatography using petroleum ether:ethyl acetate (7:1) as the eluent. The eluents of vibrators 166 to 190 were combined, the solvent was recovered, and the product was recrystallized multiple times to obtain compound B.

[0065] Compound A (4.227 mg), a yellow powder, is soluble in organic solvents such as methanol and dimethyl sulfoxide. Polyamide thin-layer chromatography was performed using a polyamide film with toluene-ethyl acetate-formic acid (6:4.5:0.5) as the developing solvent. After development and drying, the film was sprayed with 3% AlCl3 ethanol solution and observed under ultraviolet light (365 nm). The results showed that compound A appeared as a spot of the same color as the reference standard, lycopene, at the corresponding positions in the polyamide film. Three different developing solvents were used, and both compounds continued to appear as spots of the same color at the corresponding positions as the reference standard. Therefore, it is preliminarily speculated that compound A may be lycopene.

[0066] Compound A was analyzed by HPLC using ginsenoside as an external standard. The results are shown in the figure. Figure 6 . Figure 6 A: Compound A; B: Compound A + Jin Sheng Cao Huang Jin reference standard; C: Jin Sheng Cao Huang Jin reference standard.

[0067] Depend on Figure 6 It was found that compound A, ginsenoside reference standard, and their mixed standard all showed the same chromatographic peak at the same time. Compound A was determined to have a purity of 99.13%. To fully confirm its structure, proton nuclear magnetic resonance spectroscopy was used. 1 Systematic characterization was performed using 1H-NMR, and the results showed that compound A... 1 H-NMR: 1 HNMR (400 MHz, DMSO) δ: 12.95 (s, 1H), 10.83 (s, 1H), 9.98 (s, 1H), 7.54 (d, J=7.2 Hz, 2H), 6.90 (d, J=8.2 Hz, 2H), 6.48 (s, 1H), 6.16 (s, 1H), 3.86 (s, 3H).

[0068] Based on the above identification results, combined with its physicochemical properties and referenced literature, compound A can be identified as ginsenoside A, with the molecular formula C. 16 H 12 O6.

[0069] Compound B (7.662 mg) is a yellow needle-like crystal, readily soluble in organic solvents such as methanol and ethyl acetate, and practically insoluble in water. TLC was performed using silica gel GF. 254 Thin-layer chromatography (TLC) was performed using chloroform-methanol (20:40) as the developing solvent. After development, the plates were air-dried and observed under UV light (254 nm). The results showed that compound B and apigenin reference standard appeared as spots of the same color at the corresponding positions in the TLC. Even after changing to three different developing solvents, both compounds still appeared as spots of the same color at the corresponding positions as the reference standard. Therefore, it is preliminarily speculated that compound B may be apigenin.

[0070] Compound B was analyzed by HPLC using apigenin as an external standard. The results are shown in the figure. Figure 7 . Figure 7 A: Compound B; B: Compound B + apigenin reference standard; C: Apigenin reference standard.

[0071] Depend on Figure 7 It was found that compound B, apigenin reference standard, and their mixed standard all exhibited the same chromatographic peak at the same time point. The purity of this compound was determined to be 98.70%. To fully confirm its structure, systematic characterization was performed using high-performance liquid chromatography-mass spectrometry (HPLC-MS). The results showed that compound B had a quasi-molecular ion peak [M+H]. + The value is m / z 271, and the fracture of ring A or ring B also generates a [M-C8H6O3] molecule. + The ion has an m / z of 128, which proves that its molecular weight should be 270.

[0072] Based on the above identification results, combined with its physicochemical properties and referenced literature, compound B can be identified as apigenin, with the molecular formula C. 15 H 10 O5.

Claims

1. An industrial hemp endophytic fungus, HDDMZ04, producing apigenin and sennain, characterized in that... The endophytic fungus of industrial hemp is Fusarium sp. HDDMZ04, which has been deposited at the China Center for Type Culture Collection (CCTCC) at Wuhan University, Wuhan City, on December 25, 2025, with accession number CCTCC NO: M 20253016.

2. The application of the industrial hemp endophytic fungus HDDMZ04 as described in claim 1 in the fermentation production of senna flavonoids.

3. The application of the industrial hemp endophytic fungus HDDMZ04 as described in claim 1 in the fermentation production of apigenin.

4. The application of the industrial hemp endophytic fungus HDDMZ04 as described in claim 1 in in vitro antioxidant activity.

5. The application of the industrial hemp endophytic fungus HDDMZ04 as described in claim 1 in inhibiting bacteria.

6. The application according to claim 5, characterized in that, The bacteria are Bacillus subtilis, Bacillus pumilus, and Pseudomonas aeruginosa.