High-activity yeast engineering strain, construction method and application thereof

By integrating and fusing gene I into the chromosome of Saccharomyces cerevisiae, weakening or knocking out related genes, expressing MaFAR1, and optimizing the energy response pathway of yeast cells, the problem of insufficient research on the aging mechanism of yeast cells was solved, and the anti-aging performance and fatty alcohol synthesis capacity of yeast cells were improved.

CN122104457APending Publication Date: 2026-05-29DALIAN INSTITUTE OF CHEMICAL PHYSICS CHINESE ACADEMY OF SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
DALIAN INSTITUTE OF CHEMICAL PHYSICS CHINESE ACADEMY OF SCIENCES
Filing Date
2024-11-27
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies lack experimental research on anti-aging modules and chassis bioconstruction of bacterial strains through combined metabolic engineering, and research on the aging mechanism of yeast cells under energy restriction is insufficient.

Method used

By integrating fusion gene I into the chromosome of Saccharomyces cerevisiae, weakening or knocking out nitrogen-responsive transcription regulators and cAMP-dependent protein kinase catalytic subunits, expressing the acyl-CoA reductase gene MaFAR1, optimizing the rapamycin pathway and protein kinase A pathway, the anti-aging properties and fatty alcohol synthesis capacity of yeast cells were enhanced.

Benefits of technology

It improved the anti-aging properties of yeast cells, increased fatty alcohol synthesis, and enhanced cell survival and yield, reaching 277.6 mg/L.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104457A_ABST
    Figure CN122104457A_ABST
Patent Text Reader

Abstract

The application belongs to the field of microbial metabolic engineering and industrial biotechnology, and relates to a high-activity yeast engineering bacterium and a construction method and application thereof. The high-activity yeast engineering bacterium integrates a fusion gene I on the chromosome of a Saccharomyces cerevisiae starting strain; the fusion gene I encodes a fatty acyl-CoA reductase gene MaFAR1 from 5' to 3'. The base sequence of the fatty acyl-CoA reductase gene MaFAR1 is shown in SEQ ID NO:1. The high-activity yeast effectively improves cell viability and fatty alcohol synthesis capacity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial metabolic engineering and industrial biotechnology, and relates to a highly active engineered yeast strain, its construction method, and its application. Background Technology

[0002] The study of biological aging mechanisms has long been a hot topic in life science research. The aging process is influenced by many factors, such as metabolism, damage repair, and energy limitation. Using higher organisms as aging models faces numerous challenges, including high costs and complex backgrounds. However, *Saccharomyces cerevisiae*, as a eukaryotic model organism, possesses advantages such as rapid growth and reproduction, a short metabolic cycle, a clear genetic background, and mature and diverse gene-editing technologies, making it a suitable host for studying aging mechanisms. With the development of molecular biology techniques, genetic factors have been found to play a crucial role in cellular senescence. In yeast, autophagy is essential for cell survival during periods of unfavorable metabolite and organelle accumulation, as well as nutrient deficiency, because it degrades macromolecules, providing new nutrients and energy for intracellular metabolism. Autophagy is influenced by nutrient-response kinases, including the target of rapamycin (TOR), protein kinase A (PKA), and AMP-protein kinase (AMPK) (Fontana et al. Science. 2010, 328, 321-326). TOR is a primitive negative regulator of autophagy, which is inhibited under starvation conditions. It can promote starvation-induced autophagy by activating TOR targets ATG13, ULK1, and ULK2 (Ravikumar et al. Physiol. Rev. 2010, 90, 1383-1435). Energy restriction (DR), which involves reducing nutrient supply in the absence of malnutrition, is known to extend the lifespan of various organisms, from yeast to primates (Anderson et al. J. Hum. Biol. 2012, 24, 101-106). It is mainly mediated by the reduction of signaling in the overlapping RAS-PKA and TOR / SCH9 pathways. In recent years, there have been relatively systematic research results on the anti-aging mechanisms of yeast cells, but there are no experimental studies on anti-aging modules and chassis bioconstruction combined with metabolic engineering of bacterial strains. Summary of the Invention

[0003] The purpose of this invention is to provide a highly active engineered yeast strain, its construction method, and its application.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] A highly active engineered yeast strain, in which gene I is integrated and fused onto the chromosome of the original strain of Saccharomyces cerevisiae;

[0006] The fusion gene I encodes the acyl-CoA reductase gene MaFAR1 from the 5' end to the 3' end; wherein the base sequence of the acyl-CoA reductase gene MaFAR1 is shown in SEQ ID NO: 1.

[0007] The fusion gene I is T. ADH1 -P GAL1 -MaFAR1-T CYC1 .

[0008] The integration site of the fusion gene I is chromosome NSX-3.

[0009] The starting strain of Saccharomyces cerevisiae was selected from wild-type Saccharomyces cerevisiae or the highly efficient acyl-CoA accumulator strain PC06.

[0010] A highly active engineered yeast strain, wherein the highly active engineered yeast strain obtained in claim 1 is obtained by weakening or knocking out nitrogen-responsive transcriptional regulators and cyclic adenosine monophosphate (cAMP)-dependent protein kinase catalytic subunits in the chassis strain.

[0011] The weakening of the rapamycin pathway and protein kinase A pathway response to increase cellular resistance includes weakening the expression of the nitrogen-responsive transcriptional regulator gene TOR1 and knocking out the cAMP-dependent protein kinase catalytic subunit gene TPK1.

[0012] A method for constructing the highly active engineered yeast strain, the method comprising:

[0013] The fusion gene I was integrated into the chromosome of the starting strain of Saccharomyces cerevisiae using the CRISPR / Cas9 method to obtain the highly active engineered yeast strain.

[0014] Alternatively, CRISPR / Cas9 technology can be used to weaken the nitrogen-responsive transcription factor gene TOR1 in the highly active yeast engineered strain obtained above.

[0015] The nitrogen-responsive transcription factor gene TOR1 and the cAMP-dependent protein kinase catalytic subunit gene TPK1 of the engineered yeast strain were weakened using CRISPR / Cas9 technology.

[0016] Furthermore, the recombinant yeast engineered strain fused to express the acyl-CoA reductase gene MaFAR1; the expression is a direct fusion expression; the construction method includes optimizing the copy number of the acyl-CoA reductase gene MaFAR1 expressed on the chromosome; the recombinant yeast strain is constructed by sequentially fusing the upstream homologous arm, promoter, MaFAR1, terminator, and downstream homologous arm of the chromosome, and transforming it into Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, or Yersinia lipolytica; the construction method includes weakening or knocking out the TOR1 or TPK1 gene of the host strain.

[0017] To go further,

[0018] A method for constructing engineered bacteria to improve the production of fatty alcohols, wherein the recombinant yeast engineered bacteria integrates and expresses the acyl-CoA reductase gene MaFAR1 on its chromosome.

[0019] The expression described is a direct integration expression.

[0020] The construction method includes optimizing the copy number of the acyl-CoA reductase gene MaFAR1 expressed on the chromosome.

[0021] The recombinant yeast strain is constructed by sequentially fusing the upstream homologous arm, promoter, MaFAR1, terminator, and downstream homologous arm of the chromosome into Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, or Yersinia lipolytica.

[0022] The integrated expression involves inserting the acyl-CoA reductase gene MaFAR1, derived from Marinobacter sp. ES-1, into the chromosome of Saccharomyces cerevisiae through codon optimization.

[0023] The construction method involves expressing a copy of the acyl-CoA reductase gene MaFAR1 on chromosome NSX-3.

[0024] The recombinant yeast strain was constructed by sequentially fusing the upstream homologous arm, promoter, MaFAR1, terminator, and downstream homologous arm of the chromosome into the engineered Saccharomyces cerevisiae PC06.

[0025] The construction method includes knocking out the TPK1 gene of the engineered strain itself and weakening the expression of the TOR1 gene.

[0026] An application of the aforementioned highly active engineered yeast strain in the synthesis of fatty alcohols.

[0027] Advantages of this invention:

[0028] This invention constructs highly active yeast cell engineered strains to enhance anti-aging properties, thereby increasing the vitality and yield of fatty alcohol-synthesizing yeast strains. Firstly, the acyl-CoA reductase gene is expressed to catalyze the synthesis of fatty alcohols in yeast cells. The rapamycin pathway and protein kinase A pathway are optimized to respond to intracellular energy, resulting in improved cell viability and fatty alcohol synthesis in *Saccharomyces cerevisiae*. Specifically:

[0029] 1) The highly active yeast engineered strain provided by this invention integrates a gene that utilizes a highly efficient promoter fusion with the acyl-CoA reductase gene MaFAR1, effectively achieving the synthesis of fatty alcohols.

[0030] 2) The highly active yeast engineered strain provided in this application has undergone weakening of the nitrogen-responsive transcription factor gene TOR1 and knockout of the cAMP-dependent protein kinase catalytic subunit gene TPK1, thereby achieving the response of the anti-aging module, which is beneficial to the improvement of cell performance and energy production.

[0031] 3) This invention constructs highly active engineered yeast cells to enhance anti-aging properties, thereby increasing the activity and yield of yeast strains that synthesize fatty alcohols. First, the acyl-CoA reductase gene is expressed, catalyzing a fatty alcohol synthesis yield of 209.2 mg / L in yeast cells. Furthermore, the rapamycin pathway and protein kinase A pathway are optimized to respond to intracellular energy, resulting in improved cell viability and a fatty alcohol synthesis yield of 277.6 mg / L in *Saccharomyces cerevisiae*. Attached Figure Description

[0032] Figure 1 A schematic diagram illustrating a metabolic engineering strategy to promote fatty alcohol synthesis in Saccharomyces cerevisiae is shown.

[0033] Figure 2 The results show the fatty alcohol production of Saccharomyces cerevisiae modified by metabolic engineering.

[0034] Figure 3 The results show how optimizing the aging module response improves fatty alcohol production.

[0035] Figure 4 The cell growth of engineered Saccharomyces cerevisiae under a metabolic engineering combined with anti-aging modification strategy is shown. Detailed Implementation

[0036] The present application is described in detail below with reference to the embodiments, but the present application is not limited to these embodiments.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0038] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0039] This invention combines the anti-aging module of metabolically engineered strains with chassis bioconstruction, downregulating the response of aging pathways to upregulate the survival and biosynthetic capacity of yeast cells. The highly active engineered yeast strain is obtained by first integrating the fusion gene I on the chromosome of the Saccharomyces cerevisiae starting strain, and then by weakening or knocking out the nitrogen-responsive transcriptional regulator and cAMP-dependent protein kinase catalytic subunit of the engineered strain.

[0040] In this embodiment of the invention, the *Saccharomyces cerevisiae* strain PC06 was modified. The *Saccharomyces cerevisiae* strain PC06 was obtained by optimizing the central metabolic pathway of *Saccharomyces cerevisiae* to enhance the supply of the precursor acetyl-CoA and the cofactor NADPH. The detailed process is as follows:

[0041] The ATP-dependent citrate lyase gene MmACL, the malate synthase gene RtME, the signal peptide-removing malate dehydrogenase gene 'MDH3, and the citrate transporter gene CTP1 were integrated into the HIS3 gene locus (donor DNA: HIS3up-HIS3-P). TPI1 -MmACL-T FBA1 -P TDH3 -RtME-T CYC1 -P tHXT7 -'MDH3-T TDH2 -P PGK 1-CTP1-T ADH1 -P TEF1 -'tesA-T HIS3 ); The pyruvate carboxylase gene promoter P PYC1 Replace with promoter P TEF1 Overexpression of pyruvate transporter genes MPC1 and MPC3 at the XI-4 site (donor DNA XI-4up-P) tHXT7 -MPC3-T DIT1 -T MPC1 -MPC1-P TPI1 -XI-4dw); Integrating AnACL genes (AnACLa and AnACLb) into the X2 site (donor DNA is X2up-T). CYC1 -AnACLa-P GAL1 -P GAL10 -AnACLb-T ADH1 -X2dw); The citrate synthase gene RtCIT1, the isocitrate dehydrogenase gene IDP2, and the gene encoding citrate, oxaloacetate, and α-ketoglutarate transporters YHM2 were integrated into the GAL1, GAL7, and GAL10 sites (donor DNA was T). GAL7 -P TPI1 -RtCIT1-T FBA1 -T CYC1-IDP2-P THD3 -P TEF1 -YHM2-T GAL1 This involves integrating the DNA fragment while simultaneously knocking out the GAL1, GAL7, and GAL10 genes; and replacing the promoter of the glucose-6-phosphate isomerase PGI1 gene with promoter P. COX9 It also overexpressed the GND1, TKL1, TAL1, and ZWF1 genes of the pentose phosphate pathway, with P as the donor DNA. GI1 -P COX9 -T CYC1 -GND1-P THD3 -P tHXT7 -TKL1-T TDH2 -T ADH1 -TAL1-P PGK1 -P TEF1 -ZWF 1-T ZWF1 -PGI1up; This will promote the isocitrate dehydrogenase IDH2 gene promoter P... IDH2 Replace with promoter P GSY1 Knock out the multifunctional acyl-CoA thioesterase I gene 'tesA'.

[0042] The original strains used in the above embodiments are also applicable to wild-type Saccharomyces cerevisiae strains, such as strain S288C.

[0043] The basic (Delft) fermentation medium formulation used in the following examples is as follows: (NH4)2SO4 2.5 g / L, KH2PO4 14.4 g / L, MgSO4·7H2O 0.5 g / L, trace metals (3 mg / L F, FeSO4·7H2O, 4.5 mg / L ZnSO4·7H2O, 4.5 mg / L CaCl2·2H2O, 1 mg / L MnCl2·4H2O, 0.3 mg / L CoCl2·6H2O, 0.3 mg / L CuSO4·5H2O, 0.4 mg / L Na2MoO4·2H2O, 1 mg / L H3BO3, 0.1 mg / L KI, 19 mg / L Na2EDTA·2H2O), vitamins (0.1 mg / L biotin, 2 mg / L pantothenic acid, 2 mg / L thiamine, 2 mg / L pyridoxine, 2 mg / L niacin, 0.4 mg / L aminobenzoic acid, 50 mg / L inositol), with 20 g / L glucose added, and the initial pH adjusted to 5.6 with KOH.

[0044] The formula for enriched YPD culture medium is: 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose.

[0045] Example 1: Construction of a yeast strain for synthesizing fatty alcohols

[0046] A schematic diagram illustrating the metabolic engineering strategy that promotes fatty alcohol synthesis in brewer's yeast is shown below. Figure 1 As shown.

[0047] The modification method employed was CRISPR / Cas9, as referenced in Yang et al., Applied Microbiology and Biotechnology, 2020, 104: 3037-3047. The only difference lay in the chromosomal location of integration and the use of a different 20bp sgRNA sequence (NSX-3: TGCCTGAAACGATAGCTGTA / TCCGAGCAAGCAATCATCGG). The upstream and downstream homologous fragments at each integration site ranged in length from 300 to 500 bp.

[0048] Using *Saccharomyces cerevisiae* CEN.PK 113-11C (obtained from a known strain, CEN.PK113-11C(MATa; SUC2; MAL2-8c; his3Δ1; ura3-52;). See J. Agric. Food Chem. 2022, 70, 7180-7187) as a template, the upstream homologous arm NSX-3UP of the chromosome was amplified (primers: F: GGCCTTTGATCCTTCCCC; R: GTAAGAATTTTTGAAAATTCAATATAACAAAGCCCGAGAAACGCAAAT). The chromosome contains the following components: GC), promoter GAL1p (primers: F: TTTGTTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGAC; R: TTTGTATAGTTTTTTCTCCTTGACGTTAAAGTATAGAG), terminator CYC1t (primers: F: GATACCGTCGACCTCGAGTCATG; R: GGGTACCGGCCGCAAATTAAAG), and downstream homologous arm NSX-3DOWN (primers: F: CTCGAAGGCTTTAATTTGCGGCCGGTACCCCCCCGCGTAAATACGCGG; R: GGCAGTAAATGCCGCGC).

[0049] The acyl-CoA reductase gene MaFAR1 was synthesized in its entirety after codon optimization. The base sequence of the whole gene after codon optimization is shown in SEQ ID NO: 1.

[0050] The above-mentioned NSX-3UP, GAL1p, MaFAR1, CYC1t, and NSX-3DOWN are fused together to form growth fragments. The NSX-3 sgRNA expression vector (constructed as described in reference Yang et al., Applied Microbiology and Biotechnology, 2020, 104: 3037-3047) was based on the Cas9 protein recognition sequence selected from the NSX-3 sequence. The vector was divided into three parts: recognition site 1 fragment (primers: F: AAACTTCTCCGCAGTGAAAGATAAATGATCTGCCTGAAACGATAGCTG TAGTTTTAGAGCTAGAAATAG; R: GCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCC GCAGTGTTATC. Template: Saccharomyces cerevisiae CEN.PK 113-11C genome), vector backbone fragment (primer: GATCATTTATCTTTCACTGCGGAGAAG. Template: pYSg4), and recognition site 2 fragment (primer: F: AAACTTCTCCGCAGTGAAAGATAAATGATCTCCGAGCAAGCAATCATC). GGGTTTTAGAGCTAGAAATAG; R: GATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAA GGAGCTAACCGC. The template is the Saccharomyces cerevisiae CEN.PK 113-11C genome. The three fragments were fused using the ClonExpress II One Step Cloning Kit into the expression vector NSX-3sguide and the donor DNA (NSX-3UP-P). GAL1 -MaFAR1-T CYC1 500 ng each of -NSX-3DOWN were chemically transformed into Saccharomyces cerevisiae PC06. The transformed cells were plated onto screening plates and incubated upside down at 30°C for 3 days. Single-clone transformants were cultured in liquid SD medium and verified by colony PCR. Then, they were plated on plates containing 5-fluoroorotic acid for plasmid loss. The resulting strain was preserved for later use. The strain with plasmid loss was named engineered strain PFOH05.

[0051] Shake-flask fermentation of the engineered strain PFOH05 was used for cell state assessment, employing a 20 mL fermentation broth / 100 mL Erlenmeyer flask culture system. Delft medium (20 mL) was used, inoculated with an OD600 of 0.1 and a pH of 5.6. Fermentation was initiated at 30°C and 220 rpm. Glucose consumption (using 20 g / L glucose as the carbon source in Delft medium), ethanol accumulation, and biomass were measured at 8 h, 12 h, 18 h, 22 h, 30 h, 46 h, 56 h, and 96 h. After fermentation, fatty alcohols were extracted and tested, confirming that PFOH05 could synthesize fatty alcohols de novo. The fatty alcohol yield of the engineered strain PFOH05 reached 209.2 mg / L (see [link to relevant documentation]). Figure 2 ).

[0052] Example 2: Attenuated expression of nitrogen-responsive transcriptional regulator TOR1

[0053] The engineered strain PS01 was obtained by attenuating the expression of the nitrogen-responsive transcription factor TOR1 in the engineered strain PFOH05. The specific implementation method is as follows: First, an sgRNA expression vector targeting the TOR1 gene termination sequence was constructed; then, 300-400 bp sequences upstream and downstream of the TOR1 gene termination sequence were amplified respectively, and donor DNA fragments (TOR1 gene sguide: recognition site 1 fragment (primer: F: AAACTTCTCCGCAGTGAAAGATAAATGATCCTCGTCATTATGTGAAATGAGTTTTAGAGCTAGAAATAG; R: GCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATC. Template is Saccharomyces cerevisiae CEN.PK 113-11C genome), vector backbone fragment (primer: GATCATTTATCTTTCACTGCGGAGAAG. Template is pYSg4) and recognition site 2 fragment (primer: F: AAACTTCTCCGCAGTGAAAGATAAATGATCCTCGTCATTATGTGAAAT) were obtained by attenuating the expression of the nitrogen-responsive transcription factor TOR1 in the engineered strain PFOH05. The specific implementation method is as follows: First, an sgRNA expression vector targeting the TOR1 gene termination sequence was constructed; then, donor DNA fragments ... GAGTTTTAGAGCTAGAAATAG; R: GATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAA GGAGCTAACCGC. Template: Saccharomyces cerevisiae CEN.PK 113-11C genome (TOR1 gene expression cassette TOR1up-CLN2-TOR1dw: upstream homologous arm TOR1-UP (primer: F: CATTGGGGATTCGATTTACCGCC; R: GTTCAAGTTGGATGCCGAGCCGCCGCCGCCTCACCAGAATGGGCACCATCC.), insertion signal fragment (primer: F: GGCGGCGGCGGCTCGGCATCCAACTTGAACATTTCGAGAAAG; R: TTATATTACTTGGGTATTGCCCATACCAAAAG) and downstream homologous arm TOR1-DW (primer: F: CTTTTGGTATGGGCAATACCCAAGTAATATAAGGTACATAAATTGTGAA ATCAACTCCATTTAAAACAAC;R:GGGGGTACTTGGACGGAATAGTG.The templates were all *Saccharomyces cerevisiae* CEN.PK 113-11C genomes. Subsequently, the gRNA expression vector and gene expression cassette (500 ng each) were chemically transformed into *Saccharomyces cerevisiae*. The transformed cells were plated onto selection plates and incubated upside down at 30°C for 3 days. Single-clone transformants were cultured in liquid SD medium and verified by colony PCR. Then, they were plated on plates containing 5-fluoroorotic acid for plasmid loss. The resulting strain was named engineered strain PS01 and stored for later use. Fermentation was performed using 20 mL of basic fermentation medium per 100 mL shake flask, with an initial pH of 5.6, an initial OD600 of 0.1, at 30°C and 220 rpm for 96 h. The fatty alcohol yield was then measured. Using pentadecyl alcohol as an internal standard, GC analysis showed that the fatty alcohol yield of engineered strain PS01 reached 248.7 mg / L. Figure 3 ).

[0054] Example 3: Knockout of cAMP-dependent protein kinase catalytic subunit TPK1

[0055] The engineered strain PS02 was obtained by knocking out the cAMP-dependent protein kinase catalytic subunit TPK1 in the engineered strain PS01. The specific implementation method is as follows. First, an sgRNA expression vector targeting the TPK1 gene was constructed. Then, 300-400 bp sequences upstream and downstream of the TPK1 gene were amplified, and donor DNA fragments were obtained by fusion PCR. (TPK1 gene sguide: recognition site 1 fragment (primer: F: AAACTTCTCCGCAGTGAAAGATAAATGATCCGGGTACTTATCGAACTGTGGTTTTAGAGCTAGAAATAG; R: GCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATC. Template: Saccharomyces cerevisiae CEN.PK 113-11C genome), vector backbone fragment (primer: GATCATTTATCTTTCACTGCGGAGAAG. Template: pYSg4), and recognition site 2 fragment (primer: F: AAACTTCTCCGCAGTGAAAGATAAATGATCGACATCAACTACGGTGTT). CGTTTTAGAGCTAGAAATAG; R: GATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAA GGAGCTAACCGC. Template is Saccharomyces cerevisiae CEN.PK 113-11C genome) (TPK1 gene expression cassette TPK1up-TPK1dw: upstream homologous arm TPK1-UP (primer: F: CGCGCTATTAGGGGGGAG; R: CACACAATCAGCTATAATTCATGCACTGC.) and downstream homologous arm TPK1-DW (primer: F: AGCAGTGCATGAATTATAGCTGATTGTGTGCAACCCCTGTATAGTTACT ACGGAGATG; R: GGATGGAAAGAATGGATCTTTTCGTAGAC. Template is Saccharomyces cerevisiae CEN.PK 113-11C genome) (113-11C genome) Subsequently, the gRNA expression vector and gene expression cassette (500 ng each) were chemically transformed into *Saccharomyces cerevisiae*. The transformed cells were plated onto selection plates and incubated upside down at 30°C for 3 days. Single-clone transformants were cultured in liquid SD medium and verified by colony PCR. These transformants were then plated on plates containing 5-fluoroorotic acid for plasmid loss. The resulting strain was named engineered strain PS02 and stored for later use. Fermentation was performed using 20 mL of basal fermentation medium per 100 mL shake flask, with an initial pH of 5.6, an initial OD600 of 0.1, at 30°C and 220 rpm for 96 h. The yield of fatty alcohols was then determined. Pentadecyl alcohol was used as an internal standard, and detection was performed using GC.The engineered strain PSO2 produced 277.6 mg / L of fatty alcohol. Figure 3 ).

[0056] Example 4: Shake-flask fermentation for assessing the cell state of fatty alcohol synthesizing strains

[0057] Shake-flask fermentation was performed on engineered strains PFOH05, PS01, and PS02 for cell state assessment, using a 20 mL fermentation broth / 100 mL Erlenmeyer flask culture system. Delft medium (20 mL) was used, inoculated with OD600 = 0.1, pH 5.6, and fermentation was initiated at 30℃ and 220 rpm. Glucose consumption, ethanol accumulation, and biomass were measured at 8 h, 12 h, 18 h, 22 h, 30 h, 46 h, 56 h, and 96 h. Engineered strains PS01 and PS02, which jointly downregulated the aging pathway response, showed better cell state than engineered strain PFOH05. Shake-flask experiments confirmed that engineered strains PS01 and PS02, which jointly downregulated the aging pathway response, showed better cell state than engineered strain PFOH05. The results are shown below. Figure 4 As shown.

[0058] The above embodiments used the following amplification conditions: DNA fragment amplification was performed using Novizan Phanta Super-Fidelity DNA polymerase for PCR reaction, and the conditions were as follows:

[0059]

[0060]

[0061]

[0062] The above description is merely a few embodiments of this application and is not intended to limit this application in any way. Although this application discloses preferred embodiments as described above, it is not intended to limit this application. Any changes or modifications made by those skilled in the art without departing from the scope of the technical solution of this application using the disclosed technical content are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

[0063] SEQ ID NO: MaFAR1

[0064]

Claims

1. A highly active engineered yeast strain, characterized in that, Highly active engineered yeast strains integrated and fused gene I onto the chromosome of the starting strain of Saccharomyces cerevisiae; The fusion gene I encodes the acyl-CoA reductase gene MaFAR1 from the 5' end to the 3' end; wherein the base sequence of the acyl-CoA reductase gene MaFAR1 is shown in SEQ ID NO:

1.

2. The highly active engineered yeast strain according to claim 1, characterized in that, The fusion gene I is T ADH1 -P GAL1 -MaFAR1-T CYC1 .

3. The highly active engineered yeast strain according to claim 1 or 2, characterized in that, The integration site of the fusion gene I is chromosome NSX-3.

4. The highly active engineered yeast strain according to claim 1, characterized in that, The starting strain of Saccharomyces cerevisiae was selected from wild-type Saccharomyces cerevisiae or the highly efficient acyl-CoA accumulator strain PC06.

5. A highly active engineered yeast strain according to claim 1, characterized in that, The highly active engineered yeast strain is obtained by weakening or knocking out the nitrogen-responsive transcriptional regulator and cyclic adenosine monophosphate (cAMP)-dependent protein kinase catalytic subunit of the chassis strain, as described in claim 1.

6. The highly active engineered yeast strain according to claim 5, characterized in that, The weakening of the rapamycin pathway and protein kinase A pathway response to increase cellular resistance includes weakening the expression of the nitrogen-responsive transcriptional regulator gene TOR1 and knocking out the cAMP-dependent protein kinase catalytic subunit gene TPK1.

7. A method for constructing a highly active engineered yeast strain according to any one of claims 1 to 6, characterized in that, The construction method includes: The fusion gene I was integrated into the chromosome of the starting strain of Saccharomyces cerevisiae using the CRISPR / Cas9 method to obtain the highly active engineered yeast strain. Alternatively, CRISPR / Cas9 technology can be used to weaken the nitrogen-responsive transcription factor gene TOR1 in the highly active yeast engineered strain obtained above.

8. The construction method according to claim 7, characterized in that, The nitrogen-responsive transcription factor gene TOR1 and the cAMP-dependent protein kinase catalytic subunit gene TPK1 of the engineered yeast strain were weakened using CRISPR / Cas9 technology.

9. The application of the highly active engineered yeast strain according to claim 1, characterized in that: The application of the highly active engineered yeast strain in the synthesis of fatty alcohols.