SgRNA for cytosine base editing of sheep MSTN and SOCS2 genes and application thereof

By using a cytosine base editor (CBE) combined with the CRISPR/Cas9 system, sgRNA was designed to edit the MSTN and SOCS2 genes in sheep, solving the problem of low efficiency in single gene editing in existing technologies. This enabled efficient and precise gene editing in sheep, resulting in the cultivation of new breeds with fast growth and high meat yield.

CN122104707APending Publication Date: 2026-05-29YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2026-03-23
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Current technologies have limited efficiency in single-gene editing, making it impossible to synergistically improve growth and meat production traits in sheep. Furthermore, the CRISPR/Cas9 system may result in unpredictable frameshift mutations and large fragment deletions, leading to low efficiency.

Method used

By using a cytosine base editor (CBE) combined with the CRISPR/Cas9 system, specific sgRNAs were designed to edit the sheep MSTN and SOCS2 genes. Through CBE, efficient and precise gene conversion was achieved without causing DNA double-strand breaks, forming stop codons and avoiding uncontrollable Indel mutations.

Benefits of technology

The efficient synergistic editing of sheep MSTN and SOCS2 genes was achieved, resulting in new germplasm with rapid growth and high meat yield. This demonstrated high gene editing efficiency and targeting precision, and established a dual gene editing technology process suitable for sheep.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104707A_ABST
    Figure CN122104707A_ABST
Patent Text Reader

Abstract

The application discloses a kind of for sheep MSTN And SOCS2 The sgRNA of gene cytosine base editing and application thereof, the sgRNA includes nucleotide such as any one or several of SEQ ID NO.1~4.This application is respectively designed sgRNA guide sequence for sheep MSTN And SOCS2 Gene, introduce stop codon in target site using CBE system, select sgRNA guide sequence and its combination from which can efficiently target sheep MSTN And SOCS2 Gene, carry out gene editing efficiency verification on cell, and successfully obtain MSTN And SOCS2 Double gene editing goat by prokaryotic embryo microinjection technology, and gene editing sheep shows muscle fiber thickening, and fast growth rate.This application establishes a set of efficient, precise double gene editing technology system, provides key breeding material and technical support for quickly cultivating muscle developed, fast growth meat sheep new variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for sheep MSTN and SOCS2 sgRNAs edited by cytosine bases and their applications belong to the fields of genetic engineering and animal breeding. Background Technology

[0002] Myostatin (MSTN) is a member of the transforming growth factor-β (TGF-β) superfamily and a key negative regulator of muscle growth and development. Numerous studies have shown that loss-of-function mutations in the MSTN gene (such as in Belgian Blue cattle and Texel sheep) lead to skeletal muscle fiber hyperplasia and hypertrophy, producing a significant "double-muscle" phenotype and greatly increasing meat yield. Therefore, MSTN is one of the preferred target genes for genetic improvement in meat animals.

[0003] Cytokine signaling inhibitor 2 (Cytokine signaling inhibitor 2) SOCS2 ) is a member of the SOCS family and acts as a negative feedback regulator of the growth hormone (GH) signaling pathway, inhibiting animal growth by promoting the ubiquitination and degradation of the growth hormone receptor (GHR). Studies have shown that SOCS2 Gene-deficient mice gain 30-40% more body weight. SOCS2 Specific gene mutations are also positively correlated with increases in sheep body size and weight. Therefore, knockout or suppression... SOCS2 The gene function is expected to relieve its inhibition of the growth axis and promote the overall growth of animals.

[0004] Traditional CRISPR / Cas9 systems achieve gene knockout by inducing insertion / deletion (Indel) mutations after creating DNA double-strand breaks (DSBs). However, this method can produce unpredictable frameshift mutations and is inefficient for large deletions. Cytosine base editors (CBEs) can achieve efficient and precise conversion from C·G to T·A without inducing DSBs. This characteristic allows CBEs to directly convert specific glutamine (CAA, CAG) or arginine (CGA) codons and tryptophan (TGG) codons into stop codons (TAA, TAG, TGA), thus achieving precise gene knockout and avoiding the uncontrollability of Indels.

[0005] Currently, studies have utilized CRISPR / Cas9 or base editors to individually edit sheep DNA. MSTN or SOCS2 The resulting sheep phenotypes were unsatisfactory, and gene editing efficiency needs improvement. Furthermore, research combining these two approaches and using a dual-gene synergistic editing strategy to breed new breeds has not yet been reported. Meanwhile, applying CBE technology to the genetic improvement of the Haimen goat, a local breed, has significant industrial value and germplasm innovation implications. Summary of the Invention

[0006] Purpose of the invention: The purpose of this invention is to provide a method for sheep MSTN and SOCS2 The study explores sgRNAs for gene cytosine base editing and their applications to address the limitations of existing single-gene editing technologies in terms of efficiency and the inability to synergistically improve growth and meat production traits. This research aims to provide an efficient technical solution for breeding new goat breeds with fast growth and high meat yield.

[0007] Technical solution: This invention provides a method for editing sheep MSTN and SOCS2 The sgRNA of a gene, wherein the sgRNA comprises one or more nucleotides such as SEQ ID NO. 1~4: sgRNA1: 5'-AAACAACCTGAATCCAACTTAGG-3', as shown in SEQ ID NO.1; sgRNA2: 5'-CTCTGCCAAATACCAGTGCCTGG-3', as shown in SEQ ID NO.2; sgRNA3: 5'-GTGCACCAAGCAAACCCCAAAGG-3', as shown in SEQ ID NO.3; sgRNA4: 5'-AGAGCCAGTGGGGGACCGCGGGG-3', as shown in SEQ ID NO.4.

[0008] The present invention also provides a recombinant expression vector or recombinant bacteria containing the sgRNA.

[0009] The recombinant expression vector is obtained by ligating the sgRNA into the pGL3-U6-sgRNA-PGK-puromycin vector.

[0010] This invention also provides the application of the sgRNA in obtaining gene-edited sheep fetal fibroblasts and / or gene-single-base-edited sheep, wherein the gene is MSTN and / or SOCS2 Gene.

[0011] The method for obtaining the gene-edited fetal fibroblasts includes the following steps: co-transfecting sheep fetal fibroblasts with the CBE expression plasmid and the recombinant expression vector, and then screening the transfected cells with puromycin after electrotransfection.

[0012] The CBE expression plasmid is CMV-YE1-BE3-FNLS-CMV-mCherry plasmid; the recombinant expression vector is obtained by ligating the sgRNA into the pGL3-U6-sgRNA-PGK-puromycin vector; and the working concentration of the puromycin is 1.8~2.0 μg / mL.

[0013] The method for obtaining single-base edited sheep includes the following steps: mixing the sgRNA and CBE expression plasmid to obtain a microinjection mixture; injecting the microinjection mixture into sheep fertilized eggs, injecting 3-6 pL of the mixture into each embryo; and transferring the injected embryos to the oviduct of a recipient ewe in estrus at the same time for pregnancy.

[0014] The final concentration of the recombinant expression vector is 20-50 ng / μL, and the final concentration of the CBE expression plasmid is 50-100 ng / μL.

[0015] The final concentration of sgRNA was 20–200 ng / μL, and the final concentration of CBE expression plasmid was 50–200 ng / μL.

[0016] The present invention also provides a primer pair for amplifying the sgRNA, wherein the nucleotide sequence of the primer pair is any one or more of SEQ ID NO. 5-6, SEQ ID NO. 7-8, SEQ ID NO. 9-10 or SEQ ID NO. 11-12: sgRNA1-F: AAACAACCTGAATCCAACTTgttttagagctagaaatagc, as shown in SEQ ID NO.5; sgRNA1-R: AAGTTGGATTCAGGTTGTTTaccggtgtttcgtcctttcc, as shown in SEQ ID NO.6; sgRNA2-F: CCTTGCCAAATACCAGTGCCgttttagagctagaaatagc, as shown in SEQ ID NO.7; sgRNA2-R: GGCACTGGTATTTGGCAGAGaccggtgtttcgtcctttcc, as shown in SEQ ID NO.8; sgRNA3-F: GTGCACCAAGCAAACCCCAAgttttagagctagaaatagc, as shown in SEQ ID NO.9; sgRNA3-R: TTGGGGTTTGCTTGGTGCACaccggtgtttcgtcctttcc, as shown in SEQ ID NO.10; sgRNA4-F: AGAGCCAGTGGGGGACCGCGgttttagagctagaaatagc, as shown in SEQ ID NO.11; sgRNA4-R: CGCGGTCCCCCACTGGCTCTaccggtgtttcgtcctttcc, as shown in SEQ ID NO.12.

[0017] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. This invention is the first to apply CBE technology to the simultaneous editing of sheep. MSTN and SOCS2 The gene aims to synergistically improve the meat production performance and growth rate of sheep by eliminating the effects of two major negative regulators of muscle growth and overall growth, representing a novel breeding approach.

[0018] 2. This invention has successfully screened for inhibitors targeting Haimen goats at the cellular level. SOCS2 The gene's highly efficient sgRNA (efficiency 31.57%) was identified, and the effectiveness of multiple MSTN sgRNAs (up to 37%) was validated. At the individual level, four animals were successfully obtained. MSTN and SOCS2 Healthy lambs that underwent double gene editing, and 2 others SOCS2 Single-gene-edited lambs. Detection of all predicted off-target sites revealed no off-target effects, demonstrating the high targeting accuracy of the YE1-BE3-FLNS system in Haimen goats.

[0019] 3. This invention forms a set of dual-gene base editing technology processes applicable to sheep, from sgRNA design and screening, cell-level verification to embryo microinjection, embryo transfer and genotype identification. It has strong reproducibility and provides a technical model for the improvement of other economic traits.

[0020] 4. The double-gene-edited sheep obtained by this invention is a breeding material for developing new breeds of fast-growing, high-lean-meat sheep, and has good industrial application value. Attached Figure Description

[0021] Figure 1 For sheep fetal fibroblasts MSTN and SOCS2Gene CBE editing efficiency detection graph: A: sgRNA sequence information in Example 1 of the present invention; B: Fluorescence expression after 24 h of electrotransfection in Example 1 of the present invention; C: Sanger sequencing peak diagram of three sgRNAs of MSTN gene and sgRNA4 of SOCS2 gene; Figure 2 This is a sequencing image of gene-edited lambs; where WT represents wild type; #S91, #S11, #S31, #S32, #241, and #242 are the gene-edited lamb numbers; Figure 3 Genotyping diagram of gene-edited lambs; sequence results of TA clone of PCR product; Figure 4 The results of MSTN and SOCS2 protein expression level detection in the hindquarter muscle of edit-type Haimen goats; Figure 5 Comparison of growth performance among Haimen goat groups. A: Analysis of body weight data of double gene-edited lambs (0-90 days old) and wild-type control lambs born at the same time; where WT represents wild-type and Mut represents double gene-edited lambs; B: Image of double gene-edited lambs; C: H&E stained sections (scale bar: 100 μm); D: Quantitative analysis and distribution frequency map of muscle fiber cross-sectional area. Detailed Implementation

[0022] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0023] Example 1: sgRNA in editing sheep fibroblasts MSTN and SOCS2 Applications in genes 1. Gene Sequence Acquisition and sgRNA Design: Genes of Haimen goat sequences were obtained from the NCBI database. MSTN Gene (Gene ID:100860887) and SOCS2 The CDS and genome sequence of the gene (Gene ID: 102178979) were obtained. Using online tools, regions containing CAA, CAG, or CGA codons were selected in the second and third exons of the MSTN gene and the second exon of the SOCS2 gene, respectively, to design a total of 4 sgRNAs.

[0024] sgRNA1 (SEQ ID NO.1): 5'-AAACAACCTGAATCCAACTTAGG-3'; sgRNA2 (SEQ ID NO.2): 5'-CTCTGCCAAATACCAGTGCCTGG-3'; sgRNA3 (SEQ ID NO.3): 5'-GTGCACCAAGCAAACCCCAAAGG-3'; sgRNA4 (SEQ ID NO. 4): 5'-AGAGCCAGTGGGGGACCGCGGGG-3'.

[0025] 2. Construction of sgRNA expression vector: (1) First, based on the sgRNA expression vector pGL3-U6-sgRNA-PGK-puromycin (addgene: #51133), design homologous recombination primer sequences for each sgRNA: sgRNA1-F (SEQ ID NO.5):AAACAACCTGAATCCAACTTgttttagagctagaaatagc; sgRNA1-R (SEQ ID NO.6): AAGTTGGATTCAGGTTGTTTaccggtgtttcgtcctttcc; sgRNA2-F (SEQ ID NO.7): CTCTGCCAAATACCAGTGCCgttttagagctagaaatagc; sgRNA2-R (SEQ ID NO.8): GGCACTGGTATTTGGCAGAGaccggtgtttcgtcctttcc; sgRNA3-F (SEQ ID NO.9): GTGCACCAAGCAAACCCCAAgttttagagctagaaatagc; sgRNA3-R (SEQ ID NO. 10): TTGGGGTTTGCTTGGTGCACaccggtgtttcgtcctttcc; sgRNA4-F (SEQ ID NO. 11): AGAGCCAGTGGGGGACCGCGttttagagctagaaatagc; sgRNA4-R (SEQ ID NO. 12): CGCGGTCCCCCACTGGCTCTaccggtgtttcgtcctttcc.

[0026] (2) Synthesis of sgRNA double-stranded DNA fragment: PCR amplification was performed using high-fidelity Taq enzyme 2*Keypo master mix (Novizan, PK511) according to the following reaction system: 40 μL reaction volume: 2*Keypo master mix: 20 μL, sgRNA-F: 1.6 μL, sgRNA-R: 1.6 μL, pGL3-U6-sgRNA-PGK-puromycin plasmid DNA: 2 μL, H2O added to 40 μL. The PCR reaction conditions were: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 30 s, 48℃ annealing for 15 s, 72℃ extension for 5 s, for a total of 35 cycles, followed by a 72℃ extension for 10 min. The obtained PCR product was purified using a product recovery kit (Novizan, DC301) to obtain sgRNA.

[0027] (3) Homologous recombination ligation: The purified sgRNA was homologously recombinated with pGL3-U6-sgRNA-PGK-puromycin using the ClonExpress II One Step Cloning Kit (Novizan, C112-01 / 02). The total reaction volume was 10µL, and the reaction was carried out at 37℃ for 30 min to obtain the recombinant sgRNA expression plasmid. The plasmid was then transformed into DH5α Escherichia coli competent cells to obtain single colonies. After shaking, the colonies were sent to General Biotechnology (Anhui) Co., Ltd. for sequencing, and the sgRNA sequence was confirmed using the U6 universal primer.

[0028] 3. Cell Transfection and Editing Efficiency Verification: Haimen goat fetal fibroblasts were resuscitated and cultured to passages 3-5. When the cell confluence in six-well plates reached 70-80%, electroporation transfection was performed under the following conditions: voltage 330 V, current 500 μs, pulse 2 times. Each recombinant sgRNA expression plasmid (1.75 μg) and the CBE expression plasmid CMV-YE1-BE3-FNLS-CMV-mCherry (addgene; #154005) (11.25 μg) were co-transfected into the cells. Forty-eight hours after transfection, the medium was replaced with RPMI 1640 (Gibco) containing puromycin (1.5 μg / mL) for selection for 72 hours.

[0029] 4. Genome Extraction and Sequencing Analysis: Genomic DNA was extracted from a mixed cell population. Primers were designed based on the sequences flanking the target site for PCR amplification. The PCR sequencing primers are shown in Table 1. The PCR products were then subjected to Sanger sequencing. The reaction system was 20 μL: Green Taq Mix (Novizan, P131): 10 μL, upstream primer: 0.8 μL, downstream primer: 0.8 μL, genomic DNA from the mixed cell population: 2 μL, and H2O was added to bring the total volume to 20 μL. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 48℃ annealing for 15 s, 72℃ extension for 60 s, for a total of 35 cycles, followed by a final extension at 72℃ for 10 min. The sequencing peaks were analyzed using software such as Snapgene to calculate the C-to-T editing efficiency.

[0030] Table 1

[0031] 5. Results: sgRNA sequence information is as follows Figure 1 As shown in A. (As indicated by...) Figure 1 As shown in B, cells expressed red fluorescence 24 h after electrotransfection. Figure 1 As shown in Figure C, for the MSTN gene, all three sgRNAs (SG1, SG2, and SG3) showed obvious C>T mixed peaks at the target site, with calculated editing efficiencies of 25%, 37%, and 29%, respectively. For the SOCS2 gene, a designed sgRNA (SG4) successfully guided CBE editing at the target C site (within the CAG codon), with the sequencing peak diagram showing a C / T mixed peak and an editing efficiency of 31.57%. This editing successfully converted CAG to TAG, forming a stop codon. Figure 1 SG1, SG2, SG3, and SG4 are sgRNA1, sgRNA2, sgRNA3, and sgRNA4, respectively, and Exon1-3 represent exons 1-3.

[0032] Example 2: Preparation MSTN and SOCS2 Double gene-edited sheep 1. Preparation of sgRNA: The MSTN-sgRNA2 (SEQ ID NO. 2), MSTN-sgRNA3 (SEQ ID NO. 3), and SOCS2-sgRNA4 (SEQ ID NO. 4) with the highest editing efficiency screened in Example 1 were sent to Beijing Qingke Biotechnology Co., Ltd. for synthesis of the corresponding sgRNAs. APOBEC-Cas9n-UGI was amplified using the CMV-YE1-BE3-FNLS-CMV-mCherry vector (addgene, #154005) as a template. PCR amplification system: 10 μL of 2*Keypo master mix, 0.8 μL of forward primer F (TAATACGACTCACTATAGGGGATCC), 0.8 μL of reverse primer R (TCGAGGCTGATCAGCGGGTTTTTA), 1 μL of DNA, and H2O to a final volume of 20 μL; amplification conditions: 95℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 25 s, 33 cycles; 72℃ extension for 1 min. The APOBEC-Cas9n-UGI fragment was recovered and purified for in vitro transcription. The APOBEC-Cas9n-UGI fragment was analyzed using mMESSAGE mMACHINE. TM In vitro transcription was performed using the T7 ULTRA Transcription Kit, following the instructions in the kit's manual. Post-transcriptional RNA purification was performed according to MEGAclear guidelines. TM TranscriptionClean-Up Kit.

[0033] 2. Embryo microinjection: Superovulation was performed on the donor according to the literature (Li-You An 1, Yu-Guo Yuan, Bao-Li Yu, Ting-Jia Yang, Yong Cheng, Generation of human lactoferrin transgenic clonedgoats using donor cells with dual markers and a modified selection procedure. Theriogenology. 2012 Oct 1;78(6):1303-11.), and the recipient was synchronized with estrus to obtain fertilized eggs. Based on the results of Example 1, sgRNA2 (SEQ ID NO.2, final concentration 50 ng / μL), sgRNA3 (SEQ ID NO.3, final concentration 50 ng / μL), sgRNA4 (SEQ ID NO.4, final concentration 50 ng / μL), and mRNA (100 ng / μL) of CBE expression plasmid CMV-YE1-BE3-FNLS-CMV-mCherry were mixed in RNase-free water. Using a micromanipulation system, approximately 5 pL of the above mixture was injected into the cytoplasm of the fertilized egg (pronuclear stage).

[0034] 3. Embryo Transfer: Embryos injected via microinjection are cultured in IVC medium for a short period (2-4 hours). Embryos with normal morphology are selected and surgically transferred into the oviducts of recipient ewes that are in estrus (24-48 hours after estrus). 3-6 embryos are transferred to each recipient.

[0035] 4. Lamb Birth and Identification: After the recipient sheep reached full term, a total of 6 healthy lambs were born, numbered #S91, #S11, #S31, #S32, #241, and #242. The sgRNA sites microinjected into #S91, #S11, #S31, and #S32 were sgRNA2 from the MSTN gene and sgRNA4 from the SOCS2 gene, while the microinjected sgRNA sites microinjected into #241 and #242 were sgRNA3 from the MSTN gene and sgRNA4 from the SOCS2 gene. Two weeks after birth, ear tissue samples were collected from the lambs, and genomic DNA was extracted.

[0036] 5. Genotyping: Primers were designed targeting the MSTN and SOCS2 sites respectively for PCR amplification. The PCR amplification procedure, primers, and system were the same as step 4 in Example 1. Sequencing peaks were analyzed using software such as Snapgene. Figure 2The results showed that #S91, #S32, #241, and #242 were double-gene-edited goats, while #S11 and #S31 were SOCS2 single-gene-edited goats. The PCR products were further ligated into a TA cloning vector (Novizan, C603), transformed into *E. coli*, and 10-15 single clones were selected for Sanger sequencing. Genotyping results showed ( Figure 3 In the SOCS2 gene target site, all six lambs exhibited heterozygous mutations. One allele in the target sequence of #S11 showed a base substitution, while one allele in the target sequence of #S31 had a single base insertion, resulting in a frameshift mutation. #241 and #242 showed biallelic mutations, with C>T editing detected at one allele target site, changing the codon CAG to the stop codon TAG. The other allele target site of #241 had a 64-base deletion near its target site. C>T editing was detected at one allele target site in #S91, and a 13-base deletion was detected near one allele target site in #S32. At the MSTN gene target site, #241 and #242 showed homozygous biallelic mutations at the MSTN gene SG3 target site, both showing C>T editing. #S32 showed a biallelic mutation at the MSTN gene SG2 target site, while #S11 showed a monollelic mutation at the MSTN gene SG2 target site, with a single base substitution in the target sequence. Of the six lambs, four had edits detected at both the MSTN and SOCS2 target sites (double gene editing), with the editing types including homozygous and heterozygous; the other two lambs had edits detected only at the SOCS2 gene site (SOCS2 single gene editing).

[0037] 6. Detection of MSTN and SOCS2 protein expression in gene-edited sheep tissues: Hindquarter muscle tissues from gene-edited and wild-type Haimen goats were surgically collected and Western-blotting was performed. The results are as follows: Figure 4 As shown in the figure. The results indicate that MSTN protein levels were reduced and SOCS2 protein was knocked out in gene-edited Haimen goats. In the figure, WT represents the wild type, and MSTN... - / - This indicates homozygous editing of the MSTN gene, SOCS2. + / - This indicates heterozygous editing of the SOCS2 gene.

[0038] Example 3: Tracking the growth performance of goats 1. The obtained double gene-edited lambs and wild-type control lambs born at the same time were fed and managed in a routine manner, and their body weights at 0, 30, 60 and 90 days of age were recorded regularly.

[0039] 2. Histological analysis: Gluteus maximus muscle samples were collected from knockout goats and wild-type control goats for H&E staining and morphometric analysis.

[0040] 3. Results: such as Figure 5 A and Figure 5 As shown in Figure B, under the same feeding conditions, the double gene-edited lamb group (Mut) showed a trend towards increased average weight at 3 months of age compared to the wild-type control group, and body condition scores indicated more developed muscles. Figure 5 C and Figure 5 As shown in Figure D, the average cross-sectional area of ​​muscle fibers in both double-gene knockout goats and single-gene knockout goats was significantly increased compared to wild-type goats (P<0.01), exhibiting a hypertrophic muscle fiber phenotype. The average cross-sectional area of ​​muscle fibers in double-gene knockout goats was significantly increased compared to single-gene knockout goats (P<0.05). Further monitoring of their long-term growth performance, carcass traits, and reproductive performance will be conducted to comprehensively evaluate their breeding value. Figure 5 In C, WT represents wild type, and M / S + / - Indicates a single-gene-edited lamb, M - / - / S + / - This refers to double gene-edited lambs; Figure 5 In D, WT represents wild type, M / S + / - Indicates a single-gene-edited lamb, M / S - / - This refers to double gene-edited lambs; the M... - / - / S + / - The MSTN gene was homozygous edited and the SOCS2 gene was heterozygous edited.

Claims

1. A tool for editing sheep MSTN and SOCS2 The sgRNA of a gene is characterized by, The sgRNA includes one or more nucleotides such as SEQ ID NO. 1 to 4.

2. A recombinant expression vector or recombinant bacteria, characterized in that, It contains the sgRNA as described in claim 1.

3. The recombinant expression vector or recombinant bacteria according to claim 2, characterized in that, The recombinant expression vector was obtained by ligating the sgRNA into the pGL3-U6-sgRNA-PGK-puromycin vector.

4. The application of the sgRNA according to claim 1 in obtaining gene-edited sheep fetal fibroblasts and / or gene-singled sheep, characterized in that, The gene is MSTN and / or SOCS2 Gene.

5. The application according to claim 4, characterized in that, The method for obtaining the gene-edited fetal fibroblasts includes the following steps: co-transfecting sheep fetal fibroblasts with the CBE expression plasmid and the recombinant expression vector of claim 2, and then screening the transfected cells with puromycin after electrotransfection.

6. The application according to claim 4, characterized in that, The CBE expression plasmid is CMV-YE1-BE3-FNLS-CMV-mCherry plasmid; the working concentration of the puromycin is 1.8~2.0 μg / mL.

7. The application according to claim 4, characterized in that, The method for obtaining single-base edited sheep includes the following steps: mixing the sgRNA and CBE expression plasmid mRNA as described in claim 1 to obtain a microinjection mixture; injecting the microinjection mixture into sheep fertilized eggs, injecting 3 to 6 pL of the mixture into each embryo; and transferring the injected embryos to the oviduct of a recipient ewe in estrus at the same time for pregnancy.

8. The application according to claim 6, characterized in that, The final concentration of the recombinant expression vector is 20-50 ng / μL, and the final concentration of the CBE expression plasmid is 50-100 ng / μL.

9. The method according to claim 7, characterized in that, The final concentration of sgRNA was 20–200 ng / μL, and the final concentration of CBE expression plasmid mRNA was 50–200 ng / μL.

10. A primer pair for amplifying the sgRNA of claim 1, characterized in that, The nucleotide sequences of the primer pairs are any one or more of SEQ ID NO.5~6, SEQ ID NO.7~8, SEQ ID NO.9~10 or SEQ ID NO.11~12.