siRNA targeting ADAM17 gene based on intestinal barrier repair and application thereof in improving visceral hypersensitivity of IBS
By using an siRNA inhibitor targeting the ADAM17 gene to block its cleavage of IL-10RA and maintain the integrity of the intestinal mucosal barrier, the root cause intervention problem of visceral hypersensitivity in IBS was solved, and significant improvements were achieved in reducing intestinal permeability and increasing the pain threshold.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE CHILDRENS HOSPITAL ZHEJIANG UNIV SCHOOL OF MEDICINE
- Filing Date
- 2026-04-09
- Publication Date
- 2026-05-29
AI Technical Summary
Current technologies lack precise intervention strategies for ADAM17 and intestinal mucosal barrier repair, especially quantifiable and verifiable indicators for the protection of IL-10 receptor integrity, making it difficult to effectively improve the symptoms of visceral hypersensitivity in IBS.
By employing an siRNA inhibitor targeting the ADAM17 gene to block its cleavage of IL-10RA, the integrity of membrane-bound IL-10 receptors is maintained, promoting intestinal mucosal barrier repair. Targeted delivery is achieved through delivery systems such as liposomes or lipid nanoparticles.
It significantly increased the intestinal pain threshold, reduced intestinal permeability, and improved symptoms of visceral hypersensitivity. The barrier repair effect was verified by dual indicators of soluble IL-10 receptor fragment and tight junction protein expression.
Smart Images

Figure CN122104709A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biopharmaceutical technology, and in particular to a siRNA targeting the ADAM17 gene based on intestinal barrier repair and its application in improving visceral hypersensitivity in IBS. Background Technology
[0002] Irritable bowel syndrome (IBS) is a common functional gastrointestinal disorder characterized by recurrent abdominal pain, bloating, and changes in bowel habits. Visceral hypersensitivity is widely considered a core pathophysiological factor in the development and maintenance of IBS symptoms: under the same intestinal mechanical stimulation (such as colorectal distension), individuals with IBS are more prone to amplified pain and a lowered pain threshold. Current treatments primarily focus on symptomatic relief such as antispasmodics, regulation of intestinal motility, anti-anxiety / antidepressant medications, probiotics, or dietary interventions. However, overall efficacy varies significantly among individuals, relapse rates are high, and there is a lack of stable and repeatable molecularly targeted intervention strategies for the root cause of visceral hypersensitivity. Therefore, developing treatment plans with clear molecular mechanisms, quantifiable evaluation indicators, and translatability around the key pathological aspects of IBS remains a pressing technical challenge in this field.
[0003] Recent research and translational trends indicate that impaired intestinal mucosal barrier function (including disruption of epithelial tight junction structures, increased permeability, and imbalance of mucosal immune homeostasis) is closely related to IBS, especially visceral hypersensitivity. The intestinal barrier is composed of multiple levels of structures, including the mucus layer, epithelial cell layer, and tight junctions. The continuity of expression and localization of tight junction proteins (such as ZO-1 and Occludin) is crucial for maintaining selective permeability. After barrier damage, bacterial products, metabolites, and antigens in the lumen can more easily cross the epithelium into the lamina propria, inducing mucosal immune cell activation and low-grade inflammation. Simultaneously, it can promote the sensitization of sensory nerve endings in the intestinal wall through immune-neural coupling mechanisms, ultimately manifesting as a decreased pain threshold and visceral hypersensitivity. Therefore, IBS treatment focusing on barrier repair is considered to have strong theoretical rationale and clinical potential. However, most existing barrier repair strategies still focus on supplementing mucosal protectants, regulating the microbiota, or broad anti-inflammatory measures, lacking precise targeting of key upstream molecular events in the barrier protective signaling axis.
[0004] Among numerous barrier-protective factors, interleukin-10 (IL-10) is an important anti-inflammatory and tissue-protective cytokine, playing a crucial role in mucosal homeostasis, epithelial repair, and inflammation suppression. The function of IL-10 depends on the integrity of the IL-10 receptor complex on the cell membrane (mainly including the IL-10 receptor α subunit IL-10RA, etc.), and the integrity of the receptor's membrane localization directly determines whether IL-10 signals can be effectively received and transmitted. Therefore, maintaining the continuity of the IL-10 protective signaling pathway at the receptor level can theoretically promote the recovery of tight junction protein expression, reduce permeability, and alleviate neurosensitization driven by barrier damage. However, current interventions for IBS primarily focus on increasing IL-10 levels or inhibiting pro-inflammatory factors, lacking systematic technical pathways and quantifiable verification indicators regarding how the integrity of the IL-10 receptor itself is disrupted and how it can be protected.
[0005] ADAM17 (A Disintegrin And Metalloprotease 17, also known as TACE) is a transmembrane metalloproteinase whose typical biological function is to mediate the shedding of extracellular domains of various cell membrane proteins, thereby affecting the solubility of cytokines, receptors, and ligands, as well as signaling networks. Publicly available information shows that ADAM17 is closely related to various inflammatory, immune, and tumor-related processes. Its classic research framework mainly revolves around its cleavage and release of TNF-α precursors, TNF receptors, EGFR ligands, etc., thereby regulating inflammation amplification, cell proliferation, and the tumor microenvironment. Precisely because of this classic substrate-pro-inflammatory / proliferative paradigm, current drug development and patent strategies related to ADAM17 have long focused on inflammatory diseases and tumor treatment.
[0006] From the perspective of Chinese patents, existing technologies have disclosed various intervention tools and indications related to ADAM17, but their technical objectives and evaluation systems are still mainly focused on inhibiting inflammatory mediators / tumor growth. For example, Chinese patent CN104498498A discloses siRNA for inhibiting the ADAM17 gene and its applications. Its core lies in providing chemically modified double-stranded siRNA molecules for the treatment of arthritis and related inflammation, proposing that the expression of inflammatory factors can be inhibited through local injection to achieve anti-inflammatory therapeutic effects. The technical starting point of this document still belongs to the general cognitive framework of ADAM17 as an upstream regulator of inflammation, and does not establish any specific mechanism chain or verification indicators related to intestinal mucosal barrier repair, visceral hypersensitivity, or IL-10 receptor protection.
[0007] For example, Chinese patent CN119241707A discloses an antibody targeting the ADAM17 protein and its applications. It explicitly identifies ADAM17 as a target related to biliary tract malignancies, emphasizing its high expression in biliary tract tumor tissues and low expression in normal tissues, and constructs an anti-ADAM17 antibody for tumor treatment applications. The evaluation endpoints of this type of technical approach are typically the inhibition of tumor cell proliferation, migration, or a reduction in tumor burden, which differs significantly from the treatment goals of functional bowel disorders (IBS), which involve barrier structure repair—decreased permeability—and an increase in the pain threshold.
[0008] Furthermore, Chinese patent CN119185550A discloses the use of ADAM17 inhibition for the treatment of membranous nephropathy, which essentially still positions ADAM17 as a general target for inflammation / immune-related diseases, mainly focusing on inflammation regulation and tissue protection in the context of kidney disease. This type of approach further expands the indications for ADAM17.
[0009] In summary, existing technologies have at least the following shortcomings and gaps: First, existing patents and conventional research are mostly confined to the pro-inflammatory / proliferative mechanism paradigm of ADAM17 cleavage of classic substrates such as TNF-α / EGFR ligands, lacking technical insights linking ADAM17 to the cleavage and inactivation of epithelial protective receptors (especially IL-10RA). Second, current applications of ADAM17 intervention are mainly focused on inflammatory diseases such as arthritis, organ-related inflammation diseases such as kidney disease, and malignant tumors such as biliary tract tumors; a clear technical route for using ADAM17 inhibition for non-tumor functional bowel disorders (IBS) with intestinal barrier repair as the therapeutic endpoint has not yet been established. Third, existing technologies lack a quantifiable verification framework targeting receptor cleavage, membrane receptor reduction, protective signal blocking, decreased tight junction proteins, increased permeability, and visceral hypersensitivity, especially lacking an evaluation system using receptor cleavage products such as soluble IL-10 receptor fragments as direct biomarkers. Against this backdrop, there is an urgent need to propose a novel technical solution capable of precisely intervening in the aforementioned upstream key events at the molecular level, and verifiable through both receptor integrity and barrier function indicators. Summary of the Invention
[0010] The technical objective of this invention is to provide a targeted siRNA for silencing the ADAM17 gene and its drug application. By inhibiting the abnormal cleavage of the α subunit (IL-10RA) of the IL-10 receptor on the intestinal epithelial cell membrane by ADAM17, the integrity and signal transduction capacity of the membrane-bound IL-10 receptor are maintained, thereby promoting the restoration of tight junction structures, reducing intestinal permeability and repairing the intestinal mucosal barrier, and thus improving the visceral hypersensitivity symptoms associated with irritable bowel syndrome (IBS) from the upstream pathological links.
[0011] Firstly, in order to achieve the above-mentioned objectives, the present invention adopts the following technical solution:
[0012] A double-stranded small interfering RNA inhibitor targeting the ADAM17 gene, wherein the double-stranded small interfering RNA inhibitor is used to silence ADAM17 gene expression, thereby inhibiting ADAM17-mediated extracellular domain cleavage of intestinal epithelial cell membrane IL-10RA, in order to maintain the integrity of intestinal epithelial cell membrane IL-10RA and promote intestinal mucosal barrier repair.
[0013] Preferably, the double-stranded small interfering RNA inhibitor can maintain the silencing effect on the ADAM17 gene; in the 50-100 nt region after the start codon, the double-stranded small interfering RNA contains two oligonucleotides, a sense strand and an antisense strand, and the two oligonucleotides can complement each other; the nucleotide length of the sense strand and / or antisense strand is 19-23 nucleotides, and the 3′ end contains 1-3 deoxynucleotide overhangs.
[0014] Preferably, the nucleotide sequence of the double-stranded small interfering RNA inhibitor is as follows: (1) sense strand: 5′-GGAUCUACAUGAAGCAGUA[dT][dT]-3′ (SEQ ID NO:1); (2) antisense strand: 3′-[dT][dT]CCUAGAUGUACUUCGUCAU-5′ (SEQ ID NO:2); and the [dT] is deoxythymidine.
[0015] Preferably, the double-stranded small interfering RNA inhibitor is a variant having no more than two base mismatches, insertions, or deletions compared to SEQ ID NO:1 and / or SEQ ID NO:2, and the variant retains gene silencing activity against ADAM17; the gene silencing activity refers to reducing ADAM17 mRNA expression by ≥30% and / or reducing ADAM17 protein expression by ≥30% relative to the negative control in in vitro cells or in vivo colon tissue.
[0016] Preferably, at least one strand of the double-stranded small interfering RNA contains a chemical modification selected from: 2′-O-methyl modification, 2′-fluorine modification, phosphorothioate modification, locked nucleic acid (LNA) modification, cholesterol conjugation, or a combination thereof; the chemical modification is located near the 5′ end of the antisense strand and / or near the 3′ end of both strands.
[0017] In a second aspect, the present invention also provides a pharmaceutical composition for improving visceral hypersensitivity in irritable bowel syndrome (IBS), the pharmaceutical composition comprising the double-stranded small interfering RNA and a pharmaceutically acceptable carrier and / or delivery system.
[0018] Preferably, the delivery system is selected from: cationic liposomes, lipid nanoparticles, polymer nanoparticles, ionizable lipid delivery systems, cationic peptide delivery systems, or combinations thereof.
[0019] Preferably, the delivery system includes a liposome transfection reagent selected from Invivofectamine™ 3.0 or an equivalent in vivo nucleic acid delivery reagent.
[0020] Preferably, the dosage form of the pharmaceutical composition is an injection, a lyophilized powder for injection, an enema, an enteric-coated preparation, or an oral colon-targeted delivery preparation.
[0021] Preferably, the drug is used in mammals, and the irritable bowel syndrome includes at least irritable bowel syndrome with abdominal pain / discomfort accompanied by changes in bowel habits and a visceral hypersensitivity phenotype.
[0022] Secondly, the present invention also provides a method for preparing the pharmaceutical composition, comprising: mixing the double-stranded small interfering RNA inhibitor with a liposome transfection reagent or a lipid nanoparticle delivery system in a preset ratio to form a complex, and performing sterile treatment to obtain the pharmaceutical composition.
[0023] Secondly, the present invention also provides the use of the double-stranded small interfering RNA inhibitor or the pharmaceutical composition thereof in the preparation of a medicament for improving visceral hypersensitivity in irritable bowel syndrome (IBS).
[0024] Preferably, the route of administration of the drug includes intravenous administration, intraperitoneal administration, or rectal administration.
[0025] Preferably, the dosage of the double-stranded small interfering RNA inhibitor is 0.1–5 mg / kg body weight, the frequency of administration is 1–5 times per week, and the course of treatment is 1–4 weeks.
[0026] Preferably, the efficacy evaluation of the drug includes at least one of the following:
[0027] (1) Increased pain threshold corresponding to abdominal withdrawal reflex (AWR) score induced by colorectal dilatation (CRD);
[0028] (2) The serum FITC-glucan concentration decreased after oral administration of FITC-glucan to reflect the decrease in intestinal permeability;
[0029] (3) Enhanced immunofluorescence signal of intestinal epithelial cell membrane-bound IL-10Rα;
[0030] (4) Increased expression of tight junction proteins ZO-1 and / or Occludin.
[0031] (5) Decreased expression of 5-hydroxytryptamine in serum;
[0032] (6) The abundance of miR-3163, miR-145 and / or miR-148a in the serum or feces of the subjects was measured.
[0033] Preferably, the efficacy evaluation of the drug includes detecting soluble interleukin-10 receptors (sIL-10R) in serum, wherein the soluble interleukin-10 receptors are soluble fragments generated from the extracellular domain of IL-10Rα, used to characterize the degree of cleavage of IL-10Rα by ADAM17.
[0034] Preferably, the efficacy evaluation of the drug includes detecting serum 5-hydroxytryptamine (5'-HT), wherein the 5'-HT mainly originates from platelet release and intestinal spillover, to characterize the regulatory relationship between ADAM17 and 5'-HT.
[0035] Preferably, the efficacy evaluation of the drug includes detecting the abundance of exosomes in serum or fecal samples, wherein miR-3163, miR-145 and / or miR-148a are small nucleic acid fragments contained in exosomes that act on ADAM17-3'UTR and are used to characterize the relationship between ADAM17 and the abundance of miRs in exosomes.
[0036] This invention directly blocks the abnormal extracellular domain cleavage of ADAM17 on the α subunit of the IL-10 receptor (IL-10RA) by silencing the expression and proteolytic activity of ADAM17 in intestinal epithelium and colon tissue using specific siRNA. Mechanistically, this achieves a continuous technical effect of receptor protection—signal restoration—barrier repair—sensitivity reduction. On the one hand, after ADAM17 is inhibited, the localization and fluorescence intensity of membrane-bound full-length IL-10RA on the intestinal epithelial cell membrane are significantly restored / enhanced, while the level of soluble IL-10 receptor fragments (sIL-10R) generated by cleavage in serum decreases accordingly. Thus, the dual indicators of reduced cleavage products and increased membrane receptors directly demonstrate that receptor cleavage is blocked. It inhibits and restores the effective reception of IL-10 protective signals; on the other hand, after the IL-10 signal is re-established, the expression levels of intestinal epithelial tight junction proteins ZO-1 and Occludin and the continuity of intercellular junctions are significantly improved, and the integrity of the intestinal mucosa structure is improved, as manifested by a significant reduction in intestinal permeability (such as a decrease in serum fluorescence concentration after oral administration of FITC-glucan), thereby reducing mucosal immune activation and nerve ending sensitization caused by transbarrier leakage of intraluminal antigens / bacterial products; finally, at the overall phenotypic level, this invention significantly increases the abdominal withdrawal reflex (AWR) pain threshold induced by colorectal dilatation (CRD) and improves stress-induced visceral hypersensitivity behavior. Unlike existing ADAM17 intervention technologies that only target the inhibition of inflammatory factors such as TNF-α, this invention focuses on the protection of IL-10 receptor integrity and physical repair of the intestinal barrier as the core efficacy endpoints. It also establishes a quantifiable and verifiable pathway using sIL-10R as a direct biomarker of cleavage activity. This approach can achieve barrier repair and symptom improvement without significantly affecting the total IL-10 protein level, thus exhibiting stronger targeting, mechanism specificity, and the potential for root cause intervention with high visceral sensitivity in IBS. Attached Figure Description
[0037] Figure 1 The expression of ADAM17 in the colonic mucosa of model mice was significantly reduced after siRNA treatment. Figure 1 Representative immunoblot images of ADAM17 protein bands in the colon tissues of mice in the A, CT, WAS+NC, and WAS+siRNA groups. Figure 1 In section B, the relative gray values of ADAM17 / GAPDH in each group were compared, n = 6. *** represents P < 0.005; **** represents P < 0.001; ns represents P > 0.05, indicating no statistically significant difference.
[0038] Figure 2 This describes the cleavage of IL10 in the colon of model mice after siRNA treatment. Figure 2 Image A: Representative immunoblot bands of IL10 in the colon tissue of mice from each group. Figure 2Comparison of relative gray values of ADAM17 / GAPDH in each group (B). Figure 2 The levels of sIL10 in the serum of mice in each group were detected by ELISA. Figure 2 In the middle D, representative immunofluorescence images of IL10RA in the colon of mice in each group, scale bar = 20µm, Merge indicates merged / overlay images. Figure 2 Comparison of IL-0RA immunofluorescence intensity in the colonic epithelial cell membrane of mice in different groups. n = 6. * represents P < 0.05; *** represents P < 0.005; ns represents P > 0.05, indicating no statistically significant difference.
[0039] Figure 3 To investigate the effect of siRNA treatment on the colonic barrier in model mice. Figure 3 Image A: Representative immunofluorescence images of ZO1 and Occludin in the colon of mice in each group, scale bar = 20µm. Figure 3 Comparison of immunofluorescence intensity of ZO1 and Occludin in the colon of mice in group B. n = 6. * represents P<0.05; ** represents P<0.01; ns represents P > 0.05, indicating no statistically significant difference.
[0040] Figure 4 The concentration of FITC-glucan in the serum of mice in each group is shown. **** represents P < 0.001; ns represents P > 0.05, indicating no statistically significant difference.
[0041] Figure 5 The effect of ADAM17 on the pain threshold of the abdominal wall withdrawal reflex in mice. *** represents P<0.001; ** represents P<0.01; ns represents P>0.05. Detailed Implementation
[0042] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the protection scope of the present invention.
[0043] This invention provides an siRNA targeting the ADAM17 gene, which is designed and used to specifically inhibit the expression of ADAM17, thereby blocking its cleavage of IL-10RA, thus maintaining the integrity of IL-10R, ensuring the normal transmission of IL-10-mediated intestinal epithelial direct protection and repair signals, and ultimately repairing the integrity of the mucosal barrier to treat IBS and its visceral hypersensitivity symptoms.
[0044] 1. siRNA sequence:
[0045] siRNA positive strand: 5'-GGAUCUACAUGAAGCAGUA[dT][dT]-3' (SEQ ID NO: 1)
[0046] siRNA antisense strand: 3'[dT][dT]CCUAGAUGUACUUCGUCAU-5' (SEQ ID NO: 2)
[0047] (Note: This siRNA sequence targets the ADAM17 mRNA sequence (GCTCTCAGACTACGATATTCT), and is optimized for its extracellular domain or regions near the cleavage active site to maximize interference with its proteolytic function, especially the cleavage of IL-10RA.)
[0048] 2. Verification scheme (demonstrating the uniqueness of the mechanism):
[0049] Validation was performed using an IBS mouse model established through water avoidance stress:
[0050] (1) Model establishment: IBS visceral hypersensitivity rat / mouse model was established by using chronic water avoidance stress (WAS) or mother-infant separation combined with restraint stress.
[0051] (2) Experimental groups: blank control group (healthy animals, labeled as CT group); model group (WAS induced, injected with physiological saline, labeled as WAS+NC group); treatment group (WAS induced, injected with the ADAM17 siRNA preparation of this invention, labeled as WAS+siRNA group)
[0052] (3) Dosage regimen: After mixing siRNA with Invivofectamine™ 3.0 reagent, administer via tail vein injection 2-3 times per week for 1 week. The dose is 1 mg siRNA / kg body weight.
[0053] (4) Detection indicators and methods:
[0054] (a) Visceral sensitivity assessment: After treatment, a colorectal dilatation (CRD) test was performed to measure the pain pressure threshold of the abdominal withdrawal reflex (AWR) to objectively assess the improvement of visceral hypersensitivity.
[0055] (b) Intestinal permeability assessment: Before the CRD experiment, FITC-labeled dextran (4 kDa) was administered orally by gavage. Serum was collected 4 hours later, and the serum FITC-dextran concentration was detected by fluorescence spectrophotometer to directly quantify changes in intestinal barrier permeability.
[0056] (c) Validation by enzyme-linked immunosorbent assay (ELISA): The concentration of soluble IL-10R (sIL10R) in serum was detected as a direct quantitative biomarker of ADAM17’s cleavage activity against IL-10R (the core validation point of this invention).
[0057] (d) Validation by Western blotting: Detection of colon tissue in:
[0058] ADAM17 protein expression level (to verify siRNA silencing efficiency);
[0059] Total IL10 protein expression level (to verify that siRNA cleavage of IL10 RA via ADAM17 does not affect the overall IL10 expression level).
[0060] (e) Validation by immunofluorescence: Staining frozen sections of the colon provides a visual representation.
[0061] The integrity of IL-10RA's localization and fluorescence intensity on the intestinal epithelial cell membrane (core verification point);
[0062] The continuity and expression of tight junction proteins ZO-1 and Occludin at epithelial cell junctions (downstream functional indicators).
[0063] 3. Key mechanisms and differences from existing technologies:
[0064] (1) Mechanism difference: Existing technologies use ADAM17 inhibition to block the production of mediators such as TNF-α; the present invention uses ADAM17 inhibition to protect the integrity of IL-10 receptor, thereby enhancing protective signals.
[0065] (2) Validation marker differences: The efficacy validation of existing technologies relies on the decrease in the level of inflammatory factors such as TNF-α; the key validation of this invention relies on the decrease in the level of sIL-10R, the increase in the level of membrane-bound full-length IL-10R, and the resulting increase in barrier proteins.
[0066] (3) Difference in treatment endpoints: The endpoint of the prior art is anti-inflammatory or anti-proliferative; the endpoint of the present invention is receptor protection and physical barrier repair.
[0067] 4. Principle:
[0068] This invention is based on a newly discovered pathological mechanism: Under IBS stress, ADAM17 in the intestinal epithelium is abnormally activated, and its proteolytic activity directly cleaves IL-10RA on the membrane, producing a soluble fragment (sIL-10R), leading to a reduction in functional receptors on the cell membrane. This prevents IL-10, which plays a role in barrier protection and repair, from effectively transmitting signals, resulting in impaired synthesis of tight junction proteins in the intestinal epithelium and disruption of barrier integrity. The siRNA provided by this invention efficiently silences ADAM17, preventing its cleavage of IL-10RA, maintaining normal reception of protective signals, thereby autonomously repairing the damaged intestinal barrier and cutting off upstream stimuli that cause visceral hypersensitivity.
[0069] 5. Verification results:
[0070] (1) siRNA effectively silences ADAM17 expression in mouse colon
[0071] Western blot results showed that, compared with the WAS+NC group, the expression level of ADAM17 protein in the colon tissue of mice treated with the siRNA of this invention (WAS+siRNA group) was significantly reduced by approximately 50% (0.87±0.11 vs. 1.72±0.13, P<0.001). Figure 1 This study confirms that the siRNA delivery system is effective and has a significant gene silencing effect.
[0072] (2) The cleavage effect of ADAM17 on IL-10RA was specifically inhibited.
[0073] Western blot results showed that, compared with the CT group mice, there was no significant difference in the total IL10 protein level in the colon tissue of the WAS+NC group and the WAS+siRNA group mice (0.89±0.11 vs. 0.92±0.16, P>0.05; 0.90±0.12 vs. 0.92±0.16, P>0.05). Figure 2 (AB). ELISA results showed that, compared with the CT group mice, the serum sIL10R content in the WAS+NC group mice was significantly increased (1081.00±32.46 vs. 802.20±33.65, P<0.005). Figure 2 In the WAS+siRNA group, the serum sIL10R content was significantly lower than that in the WAS+NC group (912.60±28.95 vs. 1081.00±32.46, P<0.05). Figure 2(C). Immunofluorescence results showed that IL10RA was mainly expressed on the cell membrane of colonic epithelial cells in the CT group mice, with a strong fluorescence signal, while it was weaker in the WAS+NC group mice; compared with the WAS+NC group, the WAS+siRNA group mice showed higher expression of IL10RA on the cell membrane of colonic epithelial cells, and the fluorescence signal was also stronger. Figure 2 (D); Statistical results showed that compared with the CT group mice, the fluorescence intensity of IL10RA on the cell membrane of colonic epithelial cells in the WAS+NC group mice was significantly reduced (0.50±0.02 vs. 0.99±0.05, P<0.005). Figure 2 In the middle E group, the WAS+siRNA group was significantly higher than the WAS+NC group (1.00±0.07 vs. 0.50±0.02, P<0.005). Figure 2 (E).
[0074] The above results indicate that the siRNA of this invention does not affect the total protein expression of IL10, but only cleaves IL10 on the cell membrane, which is then absorbed into the blood to become sIL10R.
[0075] (3) Upregulation of tight junction protein expression leads to barrier structure repair
[0076] Immunofluorescence results showed that the fluorescence signal of ZO1 on the colonic epithelial cells of mice in the CT group was continuous and strong, while the fluorescence signal of ZO1 on the colonic epithelial cells of mice in the WAS+NC group was intermittent and weak. Figure 3 (A) Statistical results showed that the difference in fluorescence intensity between the two groups of ZO1 was statistically significant (0.70 ± 0.03 vs. 1.00 ± 0.06, P < 0.01). Figure 3 (B); Compared with the WAS+NC group, the WAS+siRNA group showed more and stronger fluorescence signals of ZO1 on the colonic epithelial cells of mice. Figure 3 The difference was statistically significant (1.00±0.07 vs. 0.70±0.03, P<0.05). Figure 3 In addition, the fluorescence signal on the colonic epithelial cells of mice in the CT group was stronger, while the fluorescence signal of Occludin on the colonic epithelial cells of mice in the WAS+NC group was weaker. Figure 3 (A) Statistical results showed that the difference in fluorescence intensity between the two groups of Occludin was statistically significant (0.59±0.06 vs. 0.93±0.08, P<0.01). Figure 3 (B); Compared with the WAS+NC group, the WAS+siRNA group showed more and stronger fluorescence signals of Occludin on the colonic epithelial cells of mice. Figure 3 The difference was statistically significant (0.89±0.06 vs. 0.59±0.06, P<0.01). Figure 3 (B). The above results indicate that WAS causes damage to the intestinal barrier in model mice, and the application of the siRNA of this invention can upregulate the expression of dense junction protein in the mouse colon and repair the barrier structure.
[0077] (4) Decreased intestinal barrier permeability
[0078] Serum FITC-glucan levels were detected in mice in the WAS+NC group compared to the CT group (23.87 ± 1.61 vs. 11.47 ± 0.92, P < 0.005). Figure 4 The concentration of FITC-glucan in the serum of mice in the WAS+siRNA group was significantly lower than that in the WAS+NC group (13.11±1.25 vs. 23.87±1.61, P<0.05). Figure 4 This indicates that WAS causes increased intestinal permeability in model mice, and that the application of the siRNAn of this invention can reduce intestinal permeability in model mice.
[0079] (5) Improvement of visceral hypersensitivity behavior
[0080] Colorectal dilation (CRD) experiments showed that, at the same abdominal withdrawal reflex (AWR) score (2 points), the pain threshold in the WAS+NC group was significantly lower than that in the CT group (23.17±3.14 vs. 47.33±4.49 mmHg, P<0.001). Figure 5 After treatment with the siRNA of this invention, the pain stress threshold of the model rats was significantly increased (42.67±1.75 vs. 23.17±3.14 mmHg, P<0.01). Figure 5 This indicates that the application of the siRNA of the present invention can improve the visceral hypersensitivity behavior of model mice.
[0081] The foregoing description of embodiments of the present invention, through which those skilled in the art are able to implement or use the present invention, will be readily apparent to those skilled in the art. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novelty disclosed herein.
Claims
1. A double-stranded small interfering RNA inhibitor targeting the ADAM17 gene, characterized in that, The double-stranded small interfering RNA inhibitor is used to silence ADAM17 gene expression, thereby inhibiting ADAM17-mediated extracellular domain cleavage of intestinal epithelial cell membrane IL-10RA, in order to maintain the integrity of intestinal epithelial cell membrane IL-10RA and promote intestinal mucosal barrier repair.
2. The double-stranded small interfering RNA inhibitor according to claim 1, characterized in that, The double-stranded small interfering RNA inhibitor can maintain the silencing effect on the ADAM17 gene; in the 50-100nt region after the start codon, the double-stranded small interfering RNA inhibitor contains two oligonucleotides, a sense strand and an antisense strand, and the two oligonucleotides can complement each other; the nucleotide length of the sense strand and / or antisense strand is 19-23 nucleotides, and the 3′ end contains 1-3 deoxynucleotide overhangs.
3. The double-stranded small interfering RNA inhibitor according to claim 2, characterized in that, The nucleotide sequence of the double-stranded small interfering RNA inhibitor is as follows: (1) Justice chain: 5′-GGAUCUACAUGAAGCAGUA[dT][dT]-3′; (2) Antisense chain: 3′-[dT][dT]CCUAGAUGUACUUCGUCAU-5′; Furthermore, the [dT] is deoxythymidine.
4. The double-stranded small interfering RNA inhibitor according to claim 3, characterized in that, The double-stranded small interfering RNA inhibitor is a variant with no more than two base mismatches, insertions, or deletions compared to SEQ ID NO:1 and / or SEQ ID NO:2, and the variant retains gene silencing activity against ADAM17; The gene silencing activity refers to a reduction of ADAM17 mRNA expression by ≥30% and / or a reduction of ADAM17 protein expression by ≥30% relative to the negative control in in vitro cells or in vivo colon tissue.
5. The double-stranded small interfering RNA inhibitor according to any one of claims 2-4, characterized in that, At least one strand of the double-stranded small interfering RNA inhibitor contains a chemical modification selected from: 2′-O-methyl modification, 2′-fluorine modification, thiophosphate modification, locked nucleic acid modification, cholesterol conjugation, or a combination thereof; the chemical modification is located near the 5′ end of the antisense strand and / or near the 3′ end of both strands.
6. A pharmaceutical composition for improving visceral hypersensitivity in irritable bowel syndrome, characterized in that, The pharmaceutical composition comprises a double-stranded small interfering RNA inhibitor as described in any one of claims 1 to 5, and a pharmaceutically acceptable carrier and / or delivery system.
7. The pharmaceutical composition according to claim 6, characterized in that, The delivery system is selected from: cationic liposomes, lipid nanoparticles, polymer nanoparticles, ionizable lipid delivery systems, cationic peptide delivery systems, or combinations thereof.
8. The pharmaceutical composition according to claim 7, characterized in that, The delivery system includes a liposome transfection reagent selected from Invivofectamine™ 3.0 or an equivalent in vivo nucleic acid delivery reagent; And / or, the dosage form of the pharmaceutical composition is an injection, a lyophilized powder for injection, an enema, an enteric-coated preparation, or an oral colon-targeted delivery preparation; And / or, the drug is used in mammals, and the irritable bowel syndrome includes at least irritable bowel syndrome with abdominal pain / discomfort accompanied by changes in bowel habits and a visceral hypersensitivity phenotype.
9. A method for preparing the pharmaceutical composition according to any one of claims 6-8, characterized in that, include: The double-stranded small interfering RNA inhibitor is mixed with a liposome transfection reagent or a lipid nanoparticle delivery system in a predetermined ratio to form a complex, and then subjected to aseptic treatment to obtain the drug composition.
10. The use of the double-stranded small interfering RNA inhibitor according to any one of claims 1 to 5 or the pharmaceutical composition according to any one of claims 6 to 8 in the preparation of a medicament for improving visceral hypersensitivity in irritable bowel syndrome.
11. The application according to claim 10, characterized in that, The routes of administration of the drug include intravenous administration, intraperitoneal administration, or rectal administration; And / or, the dosage of the double-stranded small interfering RNA inhibitor is 0.1–5 mg / kg body weight, the frequency of administration is 1–5 times per week, and the course of treatment is 1–4 weeks; And / or, the efficacy evaluation of the drug includes at least one of the following: (1) Increased pain threshold corresponding to abdominal withdrawal reflex scores induced by colorectal distension; (2) The serum FITC-glucan concentration decreased after oral administration of FITC-glucan to reflect the decrease in intestinal permeability; (3) Enhanced immunofluorescence signal of intestinal epithelial cell membrane-bound IL-10RA; (4) Increased expression of tight junction proteins ZO-1 and / or Occludin; (5) Decreased expression of 5-hydroxytryptamine in serum; (6) Measure the increased abundance of miR-3163, miR-145 and / or miR-148a in the serum or feces of the subjects.
12. The application according to claim 11, characterized in that, The efficacy evaluation of the drug includes detecting soluble interleukin-10 receptors in serum, wherein the soluble interleukin-10 receptors are soluble fragments generated from the extracellular domain of IL-10RA, used to characterize the degree of cleavage of IL-10RA by ADAM17.
13. The application according to claim 11, characterized in that, The efficacy evaluation of the drug includes the detection of serum serotonin, wherein the serotonin mainly originates from platelet release and intestinal spillover, and is used to characterize the regulatory relationship between ADAM17 and serotonin.
14. The application according to claim 11, characterized in that, The efficacy evaluation of the drug includes detecting the abundance of exosomes in serum or fecal samples, wherein miR-3163, miR-145 and / or miR-148a are exosomes containing small nucleic acid fragments that act on the ADAM17-3'UTR and are used to characterize the relationship between ADAM17 and the abundance of miRs in exosomes.
Citation Information
Patent Citations
CN119185550A
CN119241707A
CN104498498A
CN104560997A
CN118910056A