Method for heterologous synthesis of dammarane-type ginsenosides in endosperm of crop seeds, vector, plant and application

By heterologously expressing specific genes in rice endosperm and constructing multi-gene expression vectors, the directed synthesis of dammarane-type ginsenosides was achieved, solving the problems of low synthesis efficiency and autotoxicity in existing technologies and providing an efficient production route for anticancer biopharmaceutical raw materials.

CN122104775APending Publication Date: 2026-05-29THE AFFILIATED HOSPITAL OF SOUTHWEST MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
THE AFFILIATED HOSPITAL OF SOUTHWEST MEDICAL UNIV
Filing Date
2026-02-10
Publication Date
2026-05-29

Smart Images

  • Figure CN122104775A_ABST
    Figure CN122104775A_ABST
Patent Text Reader

Abstract

The present application relates to the field of biotechnology, in particular to a method for heterologous synthesis of dammarane-type ginsenosides in the endosperm of crop seeds, a vector, a plant and application. Through modular design, a core gene module driven by an endosperm-specific promoter is assembled in the T-DNA region of the vector, and a downstream glycosylation or hydroxylation-glycosylation modification module is configured to realize the directional synthesis of PPD-type and PPT-type ginsenosides, respectively. The transgenic crops obtained by using the vector can specifically accumulate target ginsenosides in the endosperm. The obtained ginseng rice shows clear anti-tumor activity in in vitro tumor cell experiments and tumor-bearing mouse models. The present application provides a new strategy for low-cost production of high-value natural products, and opens up a new direction for the application of functional crops in the field of medicine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to plant genetic engineering and metabolic engineering, and particularly to methods, carriers, plants, and applications for heterologous synthesis of dammarane-type ginsenosides in crop seed endosperm. Background Technology

[0002] Ginseng, a traditional and precious medicinal herb, possesses a variety of pharmacological activities, primarily dammarane-type ginsenosides, which exhibit anti-cancer and immunomodulatory effects, leading to a growing market demand. However, extracting saponins from ginseng plants faces inherent bottlenecks. Ginseng has a long growth cycle spanning several years, requires demanding cultivation conditions, and is susceptible to continuous cropping obstacles, resulting in unstable raw material supply and high costs. Furthermore, the natural content of saponins in ginseng is very low, and the extraction and separation processes are complex, making it difficult to meet the needs of large-scale applications.

[0003] To overcome resource limitations, heterologous production of ginsenosides using synthetic biology has become a research hotspot. Microbial (e.g., yeast) cell factories have been used to synthesize some ginsenosides, but this method relies on expensive fermentation equipment and synthetic culture media, resulting in high production costs and difficulties in large-scale scaling. On the other hand, using plants as bioreactors offers advantages such as low cost and scalability, but existing attempts still have significant limitations. For example, expressing saponin synthesis genes in model plants like tobacco often leads to impaired plant growth, exhibiting autotoxicity issues and affecting normal reproduction and biomass accumulation. More importantly, current heterologous synthesis research in cereals such as rice mostly only achieves the accumulation of ginsenoside aglycones (e.g., PPD, PPT), failing to complete the subsequent crucial glycosylation modification steps. Therefore, it cannot produce multiple end-product ginsenosides (e.g., Rd, Rg3, Rg1, etc.) with complete structures and higher activity.

[0004] Rice, as a key global food crop and a classic model plant, serves as an ideal bioreactor carrier for its seeds. The physiologically active proteins and nutrients in rice are mostly concentrated in the seed coat and embryo, while refined edible rice retains only the starch-rich endosperm, significantly weakening its nutritional function. Therefore, genetically modifying rice endosperm using genetic engineering techniques to directionally synthesize and enrich specific nutrients and functional active substances has become a key research focus in the field of functional rice breeding. Thus, developing a rice germplasm capable of efficiently and specifically synthesizing various dammarane-type ginsenosides in the rice endosperm, which could be used for the development of anti-cancer functional foods and the production of biopharmaceutical raw materials, is of great significance. Summary of the Invention

[0005] The purpose of this invention is to address the problems in existing technologies, such as the fact that rice heterologous synthesis systems can only produce ginsenosides and cannot obtain dammarane-type ginsenosides with high pharmacological activity, as well as the autotoxicity of other expression systems (such as tobacco), by providing a method, carrier, plant, and application for heterologous synthesis of dammarane-type ginsenosides in crop seed endosperm.

[0006] To achieve the above objectives, the present invention employs the following technical solution:

[0007] The first aspect of this invention provides the use of the tHMGR, SQE, DS, PPDS, UGT101, UGT74AE2, UGT94Q2 and PPTS genes in the heterologous expression of crop seed endosperm to produce dammarane-type ginsenosides.

[0008] A second aspect of the present invention provides a transgenic breeding method for producing ginsenosides in the endosperm of crop seeds, comprising the following steps: S1. Using an endosperm-specific promoter of the breeding crop, fusing it with a target gene to construct multiple gene expression cassettes; S2. Combining the gene expression cassettes obtained in S1 according to the type of ginsenosides to be produced, constructing a plant expression vector; the vector for producing PPD-type ginsenosides comprises a DS gene expression cassette and a PPDS gene expression cassette, and further comprises at least one of a UGT101 gene expression cassette, a UGT74AE2 gene expression cassette, and a UGT94Q2 gene expression cassette; and / or, further comprises at least one of a tHMGR gene expression cassette and a SQE gene expression cassette;

[0009] The vector used to produce PPT-type ginsenosides includes a DS gene expression cassette, a PPTS gene expression cassette, and a PPDS gene expression cassette, and also includes a UGT101 gene expression cassette; and / or, it also includes at least one of a tHMGR gene expression cassette and a SQE gene expression cassette.

[0010] S3. The plant expression vector constructed in S2 is introduced into the breeding crop recipient, genetically transformed, and transgenic crops that accumulate dammarane-type ginsenosides in the seed endosperm are screened to obtain transgenic crops.

[0011] Preferably, the vector for producing PPD-type ginsenosides contains expression cassettes of the tHMGR, SQE, DS, PPDS, UGT101, UGT74AE2 and UGT94Q2 genes, and the vector for producing PPT-type ginsenosides contains expression cassettes of the tHMGR, SQE, DS, PPDS, UGT101 and PPTS genes.

[0012] Furthermore, the breeding crops include rice, corn, wheat, or soybeans.

[0013] Furthermore, when the breeding crop is rice, the tHMGR gene is the functional region tOsHMGR2 of the rice OsHMGR2 gene with the sequence shown in SEQ ID NO:1, the SQE gene is the Arabidopsis thaliana AtSQE1 gene with the sequence shown in SEQ ID NO:2, the DS gene is the ginseng PgDS gene with the sequence shown in SEQ ID NO:3, the PPDS gene is the ginseng PgPPDS gene with the sequence shown in SEQ ID NO:4, the UGT101 gene is the ginseng PgUGT101 gene with the sequence shown in SEQ ID NO:5, the UGT74AE2 gene is the ginseng PgUGT74AE2 gene with the sequence shown in SEQ ID NO:6, the UGT94Q2 gene is the ginseng PgUGT94Q2 gene with the sequence shown in SEQ ID NO:7, and the PPTS gene is the ginseng CYP716A53v2 gene with the sequence shown in SEQ ID NO:8.

[0014] Furthermore, when the breeding crop is rice, the endosperm-specific promoters used are rice endosperm-specific storage protein promoters PGluB2, PGluB1, Pnpr33, PGluD, P10K, P26K and P16K, the sequences of which are shown in SEQ ID NO:9 to SEQ ID NO:15, respectively.

[0015] Further, specifically including the following steps: S1: Construct the following gene expression cassettes respectively: tOsHMGR2 gene expression cassette driven by the promoter shown in SEQ ID NO:9; AtSQE1 gene expression cassette driven by the promoter shown in SEQ ID NO:10; PgDS gene expression cassette driven by the promoter shown in SEQ ID NO:11; PgPPDS gene expression cassette driven by the promoter shown in SEQ ID NO:12; PgUGT101 gene expression cassette driven by the promoter shown in SEQ ID NO:13; PgUGT74AE2 gene expression cassette driven by the promoter shown in SEQ ID NO:14; PgUGT94Q2 gene expression cassette driven by the promoter shown in SEQ ID NO:15; CYP716A53v2 gene expression cassette driven by the promoter shown in SEQ ID NO:14; wherein, the assembly order of the gene expression cassettes is not limited to the above arrangement order. S2: Assemble at least one of the PgDS gene expression cassette, PgPPDS gene expression cassette, PgUGT101 gene expression cassette, PgUGT74AE2 gene expression cassette, and PgUGT94Q2 gene expression cassette obtained in S1; and / or, further assemble at least one of the tOsHMGR2 gene expression cassette and AtSQE1 gene expression cassette to construct a multi-gene expression vector pPPD7G for the production of PPD-type ginsenosides;

[0016] Alternatively, the PgDS gene expression cassette, CYP716A53v2 gene expression cassette, and PgPPDS gene expression cassette, as well as the PgUGT101 gene expression cassette obtained in S1, are assembled; and / or, at least one of the tOsHMGR2 gene expression cassette and AtSQE1 gene expression cassette is also assembled; a multi-gene expression vector pPPT6G for the production of PPT-type ginsenosides is constructed; S3: the multi-gene expression vector pPPD7G or pPPT6G is introduced into Agrobacterium, and the Agrobacterium is used to transform rice callus tissue. After screening and regeneration, transgenic rice plants that accumulate dammarane-type ginsenosides in the endosperm are obtained.

[0017] Preferably, S2: The gene expression cassettes tOsHMGR2, AtSQE1, PgDS, PgPPDS, PgUGT101, PgUGT74AE2 and PgUGT94Q2 obtained in S1 are assembled to construct a multi-gene expression vector pPPD7G for the production of PPD-type ginsenosides; or the gene expression cassettes tOsHMGR2, AtSQE1, PgDS, PgPPDS, PgUGT101 and CYP716A53v2 obtained in S1 are assembled to construct a multi-gene expression vector pPPT6G for the production of PPT-type ginsenosides.

[0018] A third aspect of the present invention provides a multi-gene expression vector pPPD7G constructed by the above method, the vector comprising a PgDS gene expression cassette, a PgPPDS gene expression cassette, and at least one of a PgUGT101 gene expression cassette, a PgUGT74AE2 gene expression cassette, and a PgUGT94Q2 gene expression cassette; and / or, further comprising at least one of a tOsHMGR2 gene expression cassette and an AtSQE1 gene expression cassette. Preferably, the vector comprises expression cassettes of the tOsHMGR2, AtSQE1, PgDS, PgPPDS, PgUGT101, PgUGT74AE2, and PgUGT94Q2 genes.

[0019] A fourth aspect of the present invention provides a multi-gene expression vector pPPT6G constructed by the above method, the vector comprising a PgDS gene expression cassette, a CYP716A53v2 gene expression cassette, a PgPPDS gene expression cassette, and a PgUGT101 gene expression cassette; and / or, further comprising at least one of a tOsHMGR2 gene expression cassette and an AtSQE1 gene expression cassette. Preferably, the vector comprises expression cassettes of the tOsHMGR2, AtSQE1, PgDS, PgPPDS, PgUGT101, and CYP716A53v2 genes.

[0020] The fifth aspect of the present invention provides a transgenic rice plant, which is prepared by the above method or contains the T-DNA region of the above-mentioned multi-gene expression vector in its genome; the seed endosperm of the plant accumulates dammarane-type ginsenosides.

[0021] The sixth aspect of the present invention provides the use of the above-described transgenic rice plants in the preparation of medicaments for the prevention or treatment of cancer.

[0022] A first multi-gene expression vector for the heterologous synthesis of dammarane-type ginsenosides in rice endosperm, the vector comprising a T-DNA region containing the following gene expression cassettes connected in sequence: an expression cassette for the truncated rice 3-hydroxy-3-methylglutaryl-CoA reductase gene tOsHMGR2 driven by a first endosperm-specific promoter; an expression cassette for the Arabidopsis squalene epoxidase gene AtSQE1 driven by a second endosperm-specific promoter; an expression cassette for the ginseng dammarene diol synthase gene PgDS driven by a third endosperm-specific promoter; an expression cassette for the ginseng protopanaxadiol synthase gene PgPPDS driven by a fourth endosperm-specific promoter; an expression cassette for the ginseng UDP-glycosyltransferase gene PgUGT101 driven by a fifth endosperm-specific promoter; and an expression cassette for the ginseng UDP-glycosyltransferase gene PgUGT74AE2 driven by a sixth endosperm-specific promoter. And the expression cassette of the ginseng UDP-glycosyltransferase gene PgUGT94Q2 driven by the seventh endosperm-specific promoter.

[0023] A second multi-gene expression vector for heterologous synthesis of dammarane-type ginsenosides in rice endosperm, the vector comprising a T-DNA region containing the following gene expression cassettes connected in sequence: an expression cassette for the tOsHMGR2 gene driven by a first endosperm-specific promoter; an expression cassette for the AtSQE1 gene driven by a second endosperm-specific promoter; an expression cassette for the PgDS gene driven by the third endosperm-specific promoter; an expression cassette for the PgPPDS gene driven by the fourth endosperm-specific promoter; an expression cassette for the ginsenoside protopanaxadiol synthase gene (PPTS) CYP716A53v2 driven by an eighth endosperm-specific promoter; and an expression cassette for the PgUGT101 gene driven by the fifth endosperm-specific promoter.

[0024] Gene expression cassettes driven by specific endosperm-specific promoters are sequentially assembled in the T-DNA region. These cassettes include a core precursor supply module and a backbone synthesis module. Different types of saponins are then synthesized by configuring different downstream modification modules. For PPD-type saponins, a first-class vector (e.g., pPPD7G) integrates a glycosylation module composed of PgUGT101, PgUGT74AE2, and PgUGT94Q2, specifically catalyzing the C-3 and C-20 glycosylation of protopanaxadiol (PPD). The resulting transgenic rice exhibits an endosperm-specific accumulation of saponins characterized by ginsenoside Rd. For PPT-type saponins, a second-class vector (e.g., pPPT6G) switches to a hydroxylation-glycosylation module (CYP716A53v2 and PgUGT101). CYP716A53v2 hydroxylates PPD to protopanaxadiol (PPT), followed by glycosylation of the C-20 position of PPT by PgUGT101. This vector leads to a drastically different product profile, with the transgenic rice endosperm specifically accumulating ginsenosides Rg1, F1, and CK, among which Rg1 is significantly predominant. Importantly, the extracts of "ginseng rice" produced by both of these vector systems have shown clear anticancer activity, achieving unexpected results.

[0025] Furthermore, the first endosperm-specific promoter is the PGluB2 promoter, the second endosperm-specific promoter is the PGluB1 promoter, the third endosperm-specific promoter is the Pnpr33 promoter, the fourth endosperm-specific promoter is the PGluD promoter, the fifth endosperm-specific promoter is the P10K promoter, the sixth endosperm-specific promoter is the P26K promoter, and the seventh endosperm-specific promoter is the P16K promoter.

[0026] Specifically, a first multi-gene expression vector for heterologous PPD-type ginsenosides in rice endosperm, wherein the T-DNA region of the vector contains the following gene expression cassettes connected in sequence: an expression cassette of a truncated rice 3-hydroxy-3-methylglutaryl-CoA reductase gene tOsHMGR2 driven by a first endosperm-specific promoter and connected with a first terminator.

[0027] Expression cassette of Arabidopsis squalene cyclooxygenase gene AtSQE1, driven by a second endosperm-specific promoter and connected to a second terminator;

[0028] The expression cassette of the ginseng dammarene diol synthase gene PgDS, driven by a third endosperm-specific promoter and linked with a third terminator;

[0029] The expression cassette of the ginsenoside diol synthase gene PgPPDS, driven by a fourth endosperm-specific promoter and connected with a fourth terminator;

[0030] Expression cassette of ginseng UDP-glycosyltransferase gene PgUGT101, driven by the fifth endosperm-specific promoter and connected with the fifth terminator;

[0031] Expression cassettes for the ginseng UDP-glycosyltransferase gene PgUGT74AE2 driven by the sixth endosperm-specific promoter and connected to the sixth terminator; and expression cassettes for the ginseng UDP-glycosyltransferase gene PgUGT94Q2 driven by the seventh endosperm-specific promoter and connected to the seventh terminator.

[0032] A second multi-gene expression vector for heterologous synthesis of PPT-type ginsenosides in rice endosperm, wherein the T-DNA region of the vector contains the following gene expression cassettes connected in sequence: an expression cassette of the tOsHMGR2 gene driven by a first endosperm-specific promoter and connected to a first terminator; an expression cassette of the AtSQE1 gene driven by a second endosperm-specific promoter and connected to a second terminator; an expression cassette of the PgDS gene driven by a third endosperm-specific promoter and connected to a third terminator; an expression cassette of the PgPPDS gene driven by a fourth endosperm-specific promoter and connected to a fourth terminator; an expression cassette of the ginsenoside protopanaxadiol synthase gene CYP716A53v2 driven by a sixth endosperm-specific promoter and connected to an eighth terminator; and an expression cassette of the PgUGT101 gene driven by a fifth endosperm-specific promoter and connected to a fifth terminator.

[0033] Furthermore, the first endosperm-specific promoter is the PGluB2 promoter, the second endosperm-specific promoter is the PGluB1 promoter, the third endosperm-specific promoter is the Pnpr33 promoter, the fourth endosperm-specific promoter is the PGluD promoter, the fifth endosperm-specific promoter is the P10K promoter, the sixth endosperm-specific promoter is the P26K promoter, and the seventh endosperm-specific promoter is the P16K promoter; the first, second, and third terminators are T35 terminators, the fourth terminator is the T10 terminator, the fifth, sixth, and eighth terminators are Tnos terminators, and the seventh terminator is the Tglub4 terminator.

[0034] A host cell whose genome integrates the T-DNA region of the aforementioned first multi-gene expression vector.

[0035] A fourth aspect of the present invention provides a host cell whose genome integrates the T-DNA region of the aforementioned second multi-gene expression vector.

[0036] Furthermore, the host cell is a rice cell.

[0037] A transgenic rice plant comprising the aforementioned rice cells; the seed endosperm of the plant accumulates dammarane-type ginsenosides.

[0038] The above-mentioned transgenic rice plants are used in the preparation of drugs for the prevention or treatment of lung adenocarcinoma.

[0039] A method for producing transgenic rice rich in PPD-type ginsenosides includes the steps of: (i) constructing the first multi-gene expression vector described above; (ii) introducing the first multi-gene expression vector into rice recipient cells to obtain a transformant; and (iii) screening and cultivating the transformant to obtain transgenic rice plants, wherein PPD-type ginsenosides accumulate in the seed endosperm of the plant.

[0040] A method for producing transgenic rice rich in PPT-type ginsenosides includes the following steps:

[0041] (i) Construct the second multi-gene expression vector described above;

[0042] (ii) The second multi-gene expression vector was introduced into rice recipient cells to obtain transformants;

[0043] (iii) Screening and cultivating the transformants to obtain transgenic rice plants, wherein PPT-type ginsenosides are accumulated in the seed endosperm of the plants.

[0044] The dammarane-type ginsenoside synthesis system constructed in this invention employs a modular design strategy that combines core gene modules with modification gene modules. The DS and PPDS genes are essential for forming the PPD-type saponin backbone. Based on this backbone synthesis, the introduction of one or more of the UGT101, UGT74AE2, and UGT94Q2 genes enables the synthesis of PPD-type saponins (it should be noted that introducing the UGT94Q2 gene alone cannot achieve this synthetic effect).

[0045] The DS, PPDS, and PPTS genes are essential for the synthesis of protopanaxadiol (PPT) type saponins. By further introducing the UGT101 gene, the synthesis of PPT type ginsenosides can be achieved.

[0046] The role of tHMGR and SQE genes is to enhance the supply of precursor substances in the anabolic pathway. Introducing one or both of these genes can significantly increase the yield of saponins.

[0047] In this invention, each gene expression cassette contains an independent promoter and terminator. Their tandem order within the T-DNA region of the vector does not affect the function of a single expression cassette, nor does it alter the overall saponin synthesis efficiency. Therefore, any arrangement or combination of the aforementioned gene expression cassettes is within the scope of protection of this invention.

[0048] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0049] This invention relates to the field of biotechnology, specifically to a method, carrier, plant, and application for the heterologous synthesis of dammarane-type ginsenosides from crop seed endosperm. This invention employs a modular design, assembling a core module driven by an endosperm-specific promoter in the T-DNA region of a plant binary expression vector, and achieving the targeted synthesis of different dammarane-type ginsenosides by configuring different downstream modification modules. A first-class carrier targeting PPD-type saponins integrates a specific glycosylation module, enabling the accumulation of PPD-type ginsenosides in the endosperm of transgenic crops. A second-class carrier targeting PPT-type saponins uses a hydroxylation-glycosylation module, enabling the specific accumulation of ginsenosides, primarily PPT-type ginsenosides, in the rice endosperm. Extracts of "ginseng rice" produced by both systems exhibited clear antitumor activity. Feeding tumor-bearing mice with PPD-type ginseng rice also showed significant antitumor activity. This invention provides a low-cost solution for the production of valuable natural metabolites with complex biosynthetic pathways, and opens up innovative research directions for the transformation and integration of transgenic crops into medical applications. Attached Figure Description

[0050] Figure 1 This is a schematic diagram of the biosynthetic metabolic pathway of dammarane-type ginsenosides in ginseng (Panax ginseng).

[0051] Figure 2 The results show the structure of the multi-gene expression vector and the molecular identification of the transgenic lines used for the engineered synthesis of dammarane-type ginsenosides in rice. Figure 2 A in the diagram is a schematic diagram of the T-DNA region of the seven-gene expression vector pPPD7G, which is used to synthesize protopanaxadiol (PPD) type ginsenosides. Figure 2 B in the diagram is a schematic diagram of the T-DNA region of the six-gene expression vector pPPT6G used to synthesize protopanaxadiol (PPT) type ginsenosides; Figure 2 C in the image represents the PCR verification electrophoresis diagram of the target gene in the T3 generation transgenic line.

[0052] Figure 3 The image shows the extracted ion chromatogram (XIC) of ginsenosides from transgenic rice grains.

[0053] Figure 4The image shows the M7 mass spectrum of ginsenoside standards and ginsenoside components in PPT6G and PPD7G transgenic seeds.

[0054] Figure 5 This is a graph showing the in vitro anticancer effects of transgenic rice extract on human lung adenocarcinoma cells A549 and PC-9. Figure 5 A and B in the diagram are cell proliferation assays detected by the CCK-8 assay. Figure 5 CF in the figure represents the colony formation experiment and quantitative analysis diagram; Figure 5 GL in the figure represents a representative image and quantitative analysis graph from the Transwell migration and invasion experiments; Figure 5 M in the figure represents the Western blot analysis of proteins related to the AKT / GSK-3β / β-catenin signaling pathway.

[0055] Figure 6 The study aimed to investigate the in vitro and in vivo anticancer effects of transgenic rice extracts and dietary therapy on mouse Lewis lung cancer (LLC) cells. Figure 6 In the diagram, A represents the LLC cell proliferation assay detected by the CCK-8 assay. Figure 6 BC in the diagram represents the experimental and quantitative analysis of colony formation. Figure 6 The DF in the image represents a representative image and quantitative analysis graph from the Transwell migration and invasion experiments. Figure 6 G in the figure represents a representative nodule in the lung tissue of an orthotopic tumor-bearing mouse and a test image of an H&E stained section. Figure 6 In the figure, H represents a Western blot analysis of proteins related to the AKT / GSK-3β / β-catenin signaling pathway in tumor-bearing tissue. Detailed Implementation

[0056] The present invention will now be described in detail with reference to the accompanying drawings.

[0057] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0058] Example 1

[0059] This invention, through research, has discovered that hydroxymethylglutaryl-CoA reductase (HMGR), squalene epoxidase (SQE), dammarene diol synthase (DS), protopanaxadiol synthase (PPDS), protopanaxadiol synthase (PPTS), and UDP glycosyltransferases (UGTs, including but not limited to UGT101, UGT74AE2, and UGT94Q2) are key enzymes required for the efficient synthesis of dammarane-type ginsenosides in crop endosperm (their core biosynthetic pathways are as follows...). Figure 1(As shown). Based on the above research, this embodiment establishes a transgenic breeding method for producing ginsenosides in rice endosperm, specifically including the following steps:

[0060] S1. Gene expression cassettes were constructed by fusing endosperm-specific promoters of breeding crops with target genes.

[0061] 1) Cloning of ginsenoside biosynthesis gene CDS: RNA was extracted from rice, Arabidopsis thaliana and ginseng leaves, and reverse transcribed to synthesize cDNA. Using cDNA as template, the CDS sequences of eight genes, namely tOsHMGR, AtSQE, DS, CYP716A47, PgUGT101, PgUGT74AE2, PgUGT94Q2 and CYP716A53v2, were cloned.

[0062] 2) Cloning of rice endosperm-specific promoters: Rice genomic DNA was extracted and used as a template to clone rice endosperm-specific promoter sequences such as PGluB2, PGluB1, Pnpr33, PGluD, P10k, P26k and P16k.

[0063] 3) Cloning of terminators: Using the rice genome as a template, the TGlub4 and T10k terminator sequences were cloned, and the T35S and Tnos terminator sequences were cloned using the binary expression vector pCAMBIA1301 as a template.

[0064] 4) Assembly of ginsenoside biosynthesis gene CDS and terminator: DNA sequences of tOsHMGR and T35S, AtSQE and T35S, DS and T10Kda prolamin, CYP716A47 and T10Kda prolamin, PgUGT101 and Tnos, PgUGT74AE2 and Tnos, PgUGT94Q2 and TGlub4, and CYP716A53v2 and Tnos were spliced ​​together by overlapping PCR and cloned into the pGEMT-easy vector. After sequencing to ensure accuracy, the sequenced DNA sequences were ready for use.

[0065] 5) Ginsenoside gene expression cassette assembly: Primers were designed based on the CDS start sequence of the ginsenoside synthesis gene and its adjacent vector sequence. PCR was performed using high-fidelity DNA polymerase to linearize the plasmid containing the ginsenoside synthesis gene and terminator sequence. Furthermore, Gibson assembly technology was used to clone rice endosperm-specific promoters into the linearized plasmids, resulting in eight ginsenoside gene expression cassettes containing promoters, CDS, and terminators: PGluB2-tOsHMGR-T35, PGluB1-AtSQE-T35, Pnpr33-DS-T35, PGluD-PgPPDS-T10kda, P10k-PgUGT101-Tnos, P26k-PgUGT74AE2-Tnos, P16k-PgUGT94Q2-TGlub4, and P26k-CYP716A53v2-Tnos. These cassettes were verified by sequencing and then put into use.

[0066] Assembly of S2 multi-gene binary expression vector

[0067] 1) Construction of basic vectors based on Gateway LR response: The ccdB lethal gene between the recombination sites attR1 and attR2 in Gateway vector pDEST15 was inserted into the hygromycin selection gene and R-border in the T-DNA region of plant binary expression vector pCAMBIA1300 to obtain the target vector pCAMBIA1300-attR. The kanamycin resistance of Gateway vector pENTR-gus was replaced with ampicillin resistance to obtain the donor vector pENTR-amp.

[0068] 2) Preliminary assembly of ginsenoside synthesis genes: Using the above-mentioned high-fidelity PCR and Gibson assembly techniques, the seven ginsenoside gene expression cassettes were assembled into three expression cassettes: AtSQE-tOsHMGR expression cassette, CYP716A47-PgUGT101-DS expression cassette, and PgUGT94Q2-PgUGT74AE2 expression cassette.

[0069] 3) Assembly of multi-gene expression vectors: Using high-fidelity PCR and Gibson assembly technology, the expression cassettes DS, CYP716A47, and PgUGT101 were cloned into the donor vector pENTR-amp between the recombination sites attL1 and attL2 to obtain pENTR-CYP716A47-UGT101-DS. The AtSQE-tOsHMGR expression cassette was further integrated into pENTR-CYP716A47-UGT101-DS to obtain the donor vector pENTR-tOsHMGR-SQE-CYP716A47-UGT101-DS; PgUGT... The 74AE2-PgUGT94Q2 expression cassette was cloned into the attR2 site and R-Border of the expression vector pCAMBIA1300-attR to obtain the target vector pCAMBIA1300-attR-UGT94Q2-UGT74AE2. The CYP716A53v2 expression cassette was cloned into the attR2 site and R-Border of the expression vector pCAMBIA1300-attR to obtain the target vector pCAMBIA1300-attR-53v2. Using a Gateway LR reaction, the tOsHMGR-SQE-CYP716A47-UGT101-DS element from the donor vector was recombined into the attR1 and attR2 sites of the target vectors pCAMBIA-attR-UGT94Q2-UGT74AE2 and pCAMBIA-attR-53v2, respectively, to obtain the final multi-gene expression vectors pPPD7G and pPPT6G. Figure 2 After being verified by PCR and sequencing, AB was used for the genetic transformation of rice callus tissue.

[0070] Genetic transformation and detection of rice using S3 multi-gene expression vectors pPPD7G and pPPT6G

[0071] 1) Induction of rice callus

[0072] After the mature Nipponbare seeds are dehulled, plump, clean, and sterile brown rice is selected, sterilized, and placed on a mature embryo induction medium for dark culture for 3 weeks. Pale yellow, dense, spherical embryogenic callus tissue is then selected for use.

[0073] 2) Infection of rice callus tissue

[0074] The plasmid of the multi-gene expression vector was transformed into Agrobacterium strain EHA105. One day before the genetic transformation of the callus, the Agrobacterium suspension containing the multi-gene expression vector was inoculated into LB medium and shaken at 28°C until the OD600 of the suspension reached 0.4–0.6. The cultured suspension was centrifuged at 5000 rpm for 10 min at room temperature, the supernatant was discarded, and the cells were washed with an equal volume of sterile MgSO4 solution (10 mM). The suspension was then centrifuged again at 5000 rpm for 10 min at room temperature, and the precipitate was resuspended in AAM medium until the OD600 was maintained at approximately 0.1. Dense, yellow callus tissue was selected and immersed in the Agrobacterium suspension for 30 min. After draining, the tissue was placed in a co-culture medium and incubated at 25°C for 2.5 days.

[0075] 3) Screening and differentiation of resistant callus

[0076] The co-cultured callus tissue was transferred to a hygromycin resistance selection medium and cultured in the dark at 26°C until granular resistant callus tissue grew around the callus tissue. The resistant callus tissue with green spots was selected and transferred to a differentiation medium to differentiate into transgenic seedlings, thus obtaining transgenic plants.

[0077] 4) Screening and generation of transgenic plants

[0078] Genomic DNA was extracted from the leaves of the obtained T0 generation plants using the CTAB method. Using the extracted DNA as a template, the exogenous genes HygR, tOsHMGR2, AtSQE1, PgDS, PgPPDS, PgUGT101, PgUGT74AE2, PgUGT94Q2, and CYP716A53v2 were amplified by PCR. The primers used are as follows:

[0079] Primer T-HygR-F: TGGGGAGTTTAGCGAGAGCCTGAC;

[0080] Primer T-HygR-R: ATTAACGCCGAATTAATTCGGG;

[0081] The exogenous HygR gene was detected, and the amplified fragment size was 1024 bp.

[0082] Primer T-tOsHMGR2-F: TGGCCACGCAAAAATGACA;

[0083] Primer T-tOsHMGR2-R: GATCTTCCCCGCCACGACCTC;

[0084] The exogenous tOsHMGR2 gene was detected, and the amplified fragment size was 597 bp.

[0085] Primer T-AtSQE1-F: TGCCTTTCCTTTTGTACTGTTTTA;

[0086] Primer T-AtSQE1-R: CACACGCTGAGCATCTATTTCT;

[0087] The exogenous AtSQE1 gene was detected, and the amplified fragment size was 561 bp.

[0088] Primer T-PgDS-F: GATCTACTGCCGGTGCACTTAC;

[0089] Primer T-PgDS-R: GGCAACCAAACACGTTTCCGATAT;

[0090] The exogenous PgDS gene was detected, and the amplified fragment size was 1503 bp.

[0091] Primer T-PgPPDS-F: AGGCGGTGATTAAGCAAAGAAAAG;

[0092] Primer T-PgPPDS-R: TGGGGATGTAGATGAATGGGAAGT;

[0093] The exogenous PgPPDS gene was detected, and the amplified fragment size was 721 bp.

[0094] Primer T-PgUGT101-F: GGCCTCGCGTTCCATCTCCAG;

[0095] Primer T-PgUGT101-R: GCGGGGCCCATCCAATAACTTTT;

[0096] The exogenous PgUGT101 gene was detected, and the amplified fragment size was 604 bp.

[0097] Primer T-PgUGT74AE2-F: AGTTTGAGGGACCCGTTGTATCTG;

[0098] Primer T-PgUGT74AE2-R: TGGCCTTGAGCTGGGAATGG;

[0099] The exogenous PgUGT74AE2 gene was detected, and the amplified fragment size was 745bp.

[0100] Primer T-PgUGT94Q2-F: TTTTATTTTGCGTCACGTTGTATCT;

[0101] Primer T-PgUGT94Q2-R: AATTTCTTTTCGCGAGTTGTTTG;

[0102] The exogenous PgUGT94Q2 gene was detected, and the amplified fragment size was 547 bp.

[0103] Primer T-CYP716A53v2-F: AACCGATCCATGTCACCCTCAAG;

[0104] Primer T-CYP716A53v2-R: GAGGCACCGCAGAAAACTACC;

[0105] The exogenous CYP716A53v2 gene was detected, and the amplified fragment size was 346 bp.

[0106] The amplification program used was: 95℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 33 cycles; total extension time was 5 min. Results showed that the target gene was detectable in all transgenic plants, while the non-transgenic control (NIP) could not amplify the exogenous gene. Figure 2 C).

[0107] 5) Expression analysis of exogenous genes

[0108] T3 generation seeds at the grain-filling stage were ground into powder under liquid nitrogen. Total RNA was extracted from the seeds using Trizol, and the total RNA was reverse transcribed into DNA using a reverse transcription kit. The foreign gene was detected by RT-PCR, with the rice OsActin1 gene used as an internal reference. The primers used are as follows:

[0109] Primer RT-OsActin-F: GTGGTCGCCCCTCCTGAAAG;

[0110] Primer RT-OsActin-R: GGCTTAGCATTCTTGGGTCCG;

[0111] The internal reference OsActin gene was detected, and the amplified fragment size was 251 bp.

[0112] Primer RT-HygR-F: CCACGGCCTCCAGAAGAAGATGTT;

[0113] Primer RT-HygR-R: TGGGGAGTTTAGCGAGAGCCTGAC;

[0114] The expression of the exogenous HygR gene was detected, and the amplified fragment size was 475 bp.

[0115] Primer RT-tOsHMGR2-F: AACCCGGCCAACTTCGATACTCTT;

[0116] Primer RT-tOsHMGR2-R: GTTCTGGACGCCCTTGGACACC;

[0117] The expression of the exogenous tOsHMGR2 gene was detected, and the amplified fragment size was 168 bp.

[0118] Primer T-AtSQE1-F: TGACGGTGGAGGAATGACG;

[0119] Primer T-AtSQE1-R: ATACCCCCGAGGCCCAGATAAT;

[0120] The expression of the exogenous AtSQE1 gene was detected, and the amplified fragment size was 253 bp.

[0121] Primer T-PgDS-F: AACCGGGCAATTCAAGCACAC;

[0122] Primer T-PgDS-R: ATCCCCATCCACCATCCTCATT;

[0123] The expression of the exogenous PgDS gene was detected, and the amplified fragment size was 187 bp.

[0124] Primer T-PgPPDS-F: ACGCATCCCCCAGAAAGAAAAT;

[0125] Primer T-PgPPDS-R: AACACTGCTCGGGAACCAAACT;

[0126] The expression of the exogenous PgPPDS gene was detected, and the amplified fragment size was 274 bp.

[0127] Primer T-PgUGT101-F: CGCAGTGGGCATCGCTTCTTG;

[0128] Primer T-PgUGT101-R: ACGGGCACGCCACACCACAC;

[0129] The expression of the exogenous PgUGT101 gene was detected, and the amplified fragment size was 248 bp.

[0130] Primer T-PgUGT74AE2-F: CTTGTGCTGTTGGTGCCATTTATTA;

[0131] Primer T-PgUGT74AE2-R: GCCATTTTGCTTCCTCATTTTCA;

[0132] The expression of the exogenous PgUGT74AE2 gene was detected, and the amplified fragment size was 249bp.

[0133] Primer T-PgUGT94Q2-F: GGCCATAATGAAGATCCAAAAACA;

[0134] Primer T-PgUGT94Q2-R: AGCCCACCCCTCCACAACCAA;

[0135] The expression of the exogenous PgUGT94Q2 gene was detected, and the amplified fragment size was 261 bp.

[0136] Primer T-CYP716A53v2-F: CTTAGCAGGCGAGAAAATGGTAGT;

[0137] Primer T-CYP716A53v2-R: AAAGTGCTGCCTCGTTGTCC;

[0138] The expression of the exogenous CYP716A53v2 gene was detected, and the amplified fragment size was 238 bp.

[0139] The amplification program used was: 95℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 31 cycles; total extension time was 5 min. Results showed that the target gene expression was detectable in all transgenic plants, while no exogenous gene expression was detected in the non-transgenic control (NIP). Figure 2 D).

[0140] Example 2

[0141] Analysis of the composition and content of ginsenosides in genetically modified rice

[0142] 1) Qualitative analysis of ginsenosides in transgenic rice

[0143] Brown rice was ground into powder, and 200 mg of the powder was added to 10 mL of methanol for extraction by ultrasonication at 2 kHz. After centrifugation at 3000 g for 10 min, the supernatant was filtered through a 0.22 μm microporous membrane for analysis. Ginsenosides in the transgenic seeds were identified using an ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UHPLC-Q-TOF-MS) system. Chromatographic separation was performed using a Waters ACQUITYUPLC® HSS T3 column (1.8 μm, 2.1 × 100 mm), at a column temperature of 50 ℃, with an injection volume of 4 μL. The mobile phase consisted of water containing 6.5 mM ammonium bicarbonate (A) and 90% methanol / water containing 6.5 mM ammonium bicarbonate (B), with a flow rate of 0.3 mL / min. Gradient elution program: 0-2 min 5% B, 2-37 min 5%-99% B, 37-42 min 99% B, 42-42.1 min 99%-5% B, 42.1-45 min 5% B. Mass spectrometry was performed using full-scan MS and information-dependent acquisition (IDA) secondary ion scanning, with negative ion mode detection. Optimized conditions: ion source temperature 350℃, curtain gas flow rate 35 psi, declustering voltage (DP) -80 V, collision energy (CE) -10 eV, MS / MS collision voltage 35±15 eV, primary MS scan range 70-1050 Da, secondary MS scan range 50-1050 Da. Ginsenoside standards CK, Rh2, Rg3, F1, F2, Rg1, and Rd were detected under the same conditions.

[0144] By comparing the mass spectra and retention times with ginsenoside standards, F2, Rg3, and Rd were identified in the PPD7G transgenic line, and Rh2, F1, F2, Rg1, CK, Rg3, and Rd were identified in the PPT6G transgenic line. Figure 3 (Figure 4). No signals of these seven ginsenosides were detected in non-transgenic NIP, confirming that the endogenous biosynthetic pathways for these metabolites do not exist in wild-type NIP. The presence of ginsenosides in transgenic lines can be clearly attributed to the stable expression of exogenous transgenes.

[0145] 2) Quantitative analysis of ginsenosides in transgenic rice

[0146] Due to the higher sensitivity and specificity of QQQ-MS / MS, its quantitative range is 3-5 orders of magnitude higher than that of Q-TOF. Subsequently, the identified ginsenosides were quantitatively analyzed using a Shimadzu LC-MS 8040 QQQ-MS / MS system. Chromatographic separation was performed using a Shim-pack GIST C18 column (2.1 × 50 mm, 2 μm; Shimadzu, Japan), at a column temperature of 40℃ and an injection volume of 5 μL. The mobile phase consisted of water (A) containing 0.1% formic acid and acetonitrile (B), with a flow rate of 0.3 mL / min. The gradient elution program was: 0–0.5 min 90% B, 0.5–5 min 90%–10% B, 5–6 min 10% B, 6–6.1 min 10%–90% B, and 6.1–8 min 90% B. Mass spectrometry conditions: electrospray ionization (ESI) source, negative ion mode, nebulizer gas flow rate (N2) 3 L / min, heating gas flow rate (air) 10 L / min, interface temperature 300℃, desolvation line (DL) temperature 200℃, heating block temperature 350℃, drying gas flow rate (N2) 5 L / min, scanning mode multiple reaction monitoring (MRM).

[0147] As shown in Table 1, the ginsenoside composition profiles of the PPD7G transgenic lines were relatively consistent, with Rd, F2, and Rg3 detected in all lines. Rd was the main component (72.1%-80.5%), while F2 had the lowest content (1.7%-3.7%). The total ginsenoside content varied significantly among different lines, with PPD7G-3# having the highest total content (19.08±0.98 μg / g dry weight). Compared to the PPD7G transgenic lines, the PPT6G transgenic lines exhibited a more diverse ginsenoside composition, with Rg1 being the main component (45.2%-60.6%). Furthermore, F1, CK, and Rh2 were relatively abundant, while F2, Rg3, and Rd were detected only in trace amounts or not at all. All seven identified ginsenosides were detected in the PPT6G-12# and PPT6G-17# strains, with relatively high total contents (4.83±0.45 ng / g dry weight and 4.10±0.11 ng / g dry weight, respectively).

[0148] Example 3

[0149] Analysis of the in vitro and in vivo antitumor effects of genetically modified rice

[0150] 1) Biological effects of ginseng rice extract on cancer cells

[0151] Ginsenoside extracts were obtained from the seed powders (20 g) of PPD7G-3#, PPT6G-12#, and NIP by ultrasonic extraction with methanol at 20 kHz. The supernatant after centrifugation was concentrated, and the residue was dissolved in 1 mL of dimethyl sulfoxide (DMSO). The solution was then filtered through a 0.22 μm microporous membrane for analysis.

[0152] Lung cancer cell lines A549, PC-9, and LLC were selected for experiments. Cells in the exponential growth phase were divided into four groups: DMSO group, NIP extract group, PPD7G-3# extract group, and PPT6G-12# extract group. DMSO and NIP extract served as solvent control and negative control, respectively, to eliminate the potential influence of rice itself. Each group of cells was cultured in DMEM medium (containing 2% (v / v) ginsenoside extract, supplemented with 10% fetal bovine serum, 1% streptomycin, and 1% penicillin) at 37 ℃ in a 5% CO2 incubator.

[0153] Based on the quantitative results of ginsenosides in ginseng rice (Table 1), the final ginsenoside concentrations of PPD7G-3# and PPT6G-12# extracts in the culture medium were 7.63 μg / mL and 1.93 μg / mL, respectively. Compared with DMSO, the NIP extract had no significant biological effect on all tested cancer cells. Figure 5 AL, Figure 6 (AF), indicating that non-transgenic NIP had no significant anti-cancer activity against these cell lines. Except for the effect of PPT6G-12# extract on LLC migration, both PPD7G-3# and PPT6G-12# extracts significantly reduced cancer cell viability, colony number, and migration and invasion abilities. Figure 5 AL, Figure 6 AF). Meanwhile, the PPD7G-3# extract showed significantly stronger inhibitory activity against all tested cancer cells than the PPT6G-12# extract (AF). Figure 5 AL, Figure 6 AF).

[0154] 2) Evaluation of the in vivo antitumor effect of PPD7G-3# seeds delivered via diet

[0155] Dietary intake of ginsenoside-fortified rice is a low-cost, highly acceptable ginsenoside delivery strategy. Given the significant tumor-inhibiting effect of PPD7G-3# extract on lung cancer cells, a homologous in situ lung cancer model was established by inoculating C57BL / 6J mice with LLC cells. PPD7G-3# grains were then fed to evaluate its anti-tumor effect through dietary delivery. Tumor progression was compared among the standard diet group (SC), the NIP group, and the PPD7G-3# group. After 4 weeks of dietary intervention, mice were sacrificed, and lung tissue was collected for observation. HE staining of the lung tissue confirmed that the observed nodules were malignant tumors. Figure 6 G). Compared with the SC group and the NIP group, the number of lung nodules in the PPD7G-3# group was significantly reduced, indicating that PPD7G-3# seeds have strong in vivo antitumor activity.

[0156] 3) The molecular mechanism of ginseng rice's anti-tumor effect is elucidated.

[0157] To further explore the molecular mechanism by which ginseng rice inhibits tumors, we focused on the AKT / GSK-3β / β-catenin signaling pathway, which plays a crucial role in the progression of lung adenocarcinoma. The expression and phosphorylation levels of key components and downstream effectors of the AKT / GSK-3β / β-β-catenin signaling pathway were detected in human A549 and PC-9 cells and mouse LLC cells treated with PPD7G-3# extract, as well as in an orthotopic LLC mouse model. The results showed that the protein expression profiles detected in in vitro cells were consistent with those in the in vivo model. Figure 5 L, Figure 6 H): PPD7G-3# treatment significantly reduced the phosphorylation levels of AKT, GSK-3β, and β-catenin, decreased the protein levels of downstream effectors c-Myc, MMP2, VEGF-A, cyclin D1, TIMP1, and N-cadherin, while increasing the expression level of E-cadherin. These results suggest that inhibiting the AKT / GSK-3β / β-catenin signaling pathway may be a key molecular mechanism underlying the antitumor activity of PPD7G-3#.

[0158] Table 1. Analysis of ginsenoside content in transgenic rice.

[0159] NIP PPD7G-1# PPD7G-3# PPD7G-8# PPD7G-14# PPT6G-2# PPT6G-6# PPT6G-12# PPT6G-17# Rd nd 13.84±3.90 13.75±0.85 4.67±0.09 10.66±6.19 nd nd 0.24±0.02 0.22±0.01 F2 nd 0.35±0.15 0.40±0.21 0.22±0.02 0.23±0.13 0.13±0.05 0.04±0.02 0.07±0.02 0.02±0.02 Rg3 nd 4.14±2.18 4.93±1.22 1.13±0.31 2.36±1.52 0.10±0.02 nd 0.08±0.04 0.07±0.01 Rh2 nd nd nd nd nd 0.24±0 0.24±0 0.35±0.01 0.32±0 CK nd nd nd nd nd 0.32±0.02 0.10±0.07 0.65±0.07 0.54±0.08 Rg1 nd nd nd nd nd 1.25±0.33 0.61±0.08 2.94±0.28 2.46±0.11 F1 nd nd nd nd nd 0.72±0.07 0.25±0.04 0.50±0.1 0.43±0.01 Total nd 18.33±6.10 19.08±0.98 6.03±0.24 13.24±1.98 2.77±0.36 1.22±0.07 4.83±0.45 4.10±0.11

[0160] This embodiment uses rice endosperm as a bioreactor to successfully produce dammarane-type ginsenosides by reconstructing the ginsenoside biosynthetic pathway in rice endosperm. Multiple ginsenosides accumulate in the endosperm without exhibiting toxicity to the host transgenic rice. PPD7G-3# extract / dietary feeding effectively inhibited the proliferation, migration, and invasion of lung adenocarcinoma cells both in vitro and in vivo; its anticancer effect may be attributed to the inhibition of the AKT / GSK-3β / β-catenin pathway. Transgenic "ginseng rice" provides a sustainable and low-cost dietary intake of ginsenosides, and the strategy employed in this study offers valuable insights for the production and application of rare or high-value natural metabolites.

[0161] In one or more embodiments, a transgenic breeding method for producing ginsenosides in the endosperm of crop seeds is provided, comprising the following steps: S1. Using an endosperm-specific promoter of the breeding crop, multiple gene expression cassettes are fused with target genes to construct a plurality of gene expression cassettes; S2. According to the type of ginsenosides to be produced, the gene expression cassettes obtained in S1 are combined to construct a plant expression vector; the vector for producing PPD-type ginsenosides includes a DS gene expression cassette and a PPDS gene expression cassette, and further includes at least one of a UGT101 gene expression cassette, a UGT74AE2 gene expression cassette, and a UGT94Q2 gene expression cassette; and / or, further includes at least one of a tHMGR gene expression cassette and a SQE gene expression cassette;

[0162] The vector used to produce PPT-type ginsenosides includes a DS gene expression cassette, a PPTS gene expression cassette, and a PPDS gene expression cassette, and also includes a UGT101 gene expression cassette; and / or, it also includes at least one of a tHMGR gene expression cassette and a SQE gene expression cassette.

[0163] S3. The plant expression vector constructed in S2 is introduced into the breeding crop recipient, genetically transformed, and transgenic crops that accumulate dammarane-type ginsenosides in the seed endosperm are screened to obtain transgenic crops.

[0164] Preferably, the vector for producing PPD-type ginsenosides contains expression cassettes of the tHMGR, SQE, DS, PPDS, UGT101, UGT74AE2 and UGT94Q2 genes, and the vector for producing PPT-type ginsenosides contains expression cassettes of the tHMGR, SQE, DS, PPDS, UGT101 and PPTS genes.

[0165] In one or more embodiments, the breeding crop includes rice, corn, wheat, or soybean.

[0166] In one or more embodiments, when the breeding crop is rice, the tHMGR gene is the functional region tOsHMGR2 of the rice OsHMGR2 gene having the sequence shown in SEQ ID NO:1, the SQE gene is the Arabidopsis thaliana AtSQE1 gene having the sequence shown in SEQ ID NO:2, the DS gene is the ginseng PgDS gene having the sequence shown in SEQ ID NO:3, the PPDS gene is the ginseng PgPPDS gene having the sequence shown in SEQ ID NO:4, the UGT101 gene is the ginseng PgUGT101 gene having the sequence shown in SEQ ID NO:5, the UGT74AE2 gene is the ginseng PgUGT74AE2 gene having the sequence shown in SEQ ID NO:6, the UGT94Q2 gene is the ginseng PgUGT94Q2 gene having the sequence shown in SEQ ID NO:7, and the PPTS gene is the ginseng CYP716A53v2 gene having the sequence shown in SEQ ID NO:8.

[0167] In one or more embodiments, when the breeding crop is rice, the endosperm-specific promoters used are rice endosperm-specific storage protein promoters PGluB2, PGluB1, Pnpr33, PGluD, P10K, P26K and P16K, the sequences of which are shown in SEQ ID NO:9 to SEQ ID NO:15, respectively.

[0168] In one or more embodiments, the specific steps include:

[0169] S1: Construct at least one of the following gene expression cassettes: tOsHMGR2 gene expression cassette driven by the promoter shown in SEQ ID NO:9; AtSQE1 gene expression cassette driven by the promoter shown in SEQ ID NO:10; PgDS gene expression cassette driven by the promoter shown in SEQ ID NO:11; PgPPDS gene expression cassette driven by the promoter shown in SEQ ID NO:12; PgUGT101 gene expression cassette driven by the promoter shown in SEQ ID NO:13; PgUGT74AE2 gene expression cassette driven by the promoter shown in SEQ ID NO:14; PgUGT94Q2 gene expression cassette driven by the promoter shown in SEQ ID NO:15; and CYP716A53v2 gene expression cassette driven by the promoter shown in SEQ ID NO:14; wherein the assembly order of the gene expression cassettes is not limited to the above-mentioned arrangement.

[0170] S2: Assemble at least one of the PgDS gene expression cassette, PgPPDS gene expression cassette, PgUGT101 gene expression cassette, PgUGT74AE2 gene expression cassette, and PgUGT94Q2 gene expression cassette obtained in S1; and / or, further assemble at least one of the tOsHMGR2 gene expression cassette and AtSQE1 gene expression cassette to construct a multi-gene expression vector pPPD7G for the production of PPD-type ginsenosides;

[0171] Alternatively, the PgDS gene expression cassette, CYP716A53v2 gene expression cassette, and PgPPDS gene expression cassette, as well as the PgUGT101 gene expression cassette obtained in S1, are assembled; and / or, at least one of the tOsHMGR2 gene expression cassette and AtSQE1 gene expression cassette is also assembled; a multi-gene expression vector pPPT6G for the production of PPT-type ginsenosides is constructed; S3: the multi-gene expression vector pPPD7G or pPPT6G is introduced into Agrobacterium, and the Agrobacterium is used to transform rice callus tissue. After screening and regeneration, transgenic rice plants that accumulate dammarane-type ginsenosides in the endosperm are obtained.

[0172] Preferably, S2: The gene expression cassettes tOsHMGR2, AtSQE1, PgDS, PgPPDS, PgUGT101, PgUGT74AE2 and PgUGT94Q2 obtained in S1 are assembled to construct a multi-gene expression vector pPPD7G for the production of PPD-type ginsenosides; or the gene expression cassettes tOsHMGR2, AtSQE1, PgDS, PgPPDS, PgUGT101 and CYP716A53v2 obtained in S1 are assembled to construct a multi-gene expression vector pPPT6G for the production of PPT-type ginsenosides.

[0173] A third aspect of the present invention provides a multi-gene expression vector pPPD7G constructed by the above method, the vector comprising a PgDS gene expression cassette, a PgPPDS gene expression cassette, and at least one of a PgUGT101 gene expression cassette, a PgUGT74AE2 gene expression cassette, and a PgUGT94Q2 gene expression cassette; and / or, further comprising at least one of a tOsHMGR2 gene expression cassette and an AtSQE1 gene expression cassette. Preferably, the vector comprises expression cassettes of the tOsHMGR2, AtSQE1, PgDS, PgPPDS, PgUGT101, PgUGT74AE2, and PgUGT94Q2 genes.

[0174] A fourth aspect of the present invention provides a multi-gene expression vector pPPT6G constructed by the above method, the vector comprising a PgDS gene expression cassette, a CYP716A53v2 gene expression cassette, a PgPPDS gene expression cassette, and a PgUGT101 gene expression cassette; and / or, further comprising at least one of a tOsHMGR2 gene expression cassette and an AtSQE1 gene expression cassette. Preferably, the vector comprises expression cassettes of the tOsHMGR2, AtSQE1, PgDS, PgPPDS, PgUGT101, and CYP716A53v2 genes.

[0175] The fifth aspect of the present invention provides a transgenic rice plant, which is prepared by the above method or contains the T-DNA region of the above-mentioned multi-gene expression vector in its genome; the seed endosperm of the plant accumulates dammarane-type ginsenosides.

[0176] The sixth aspect of the present invention provides the use of the above-described transgenic rice plants in the preparation of medicaments for the prevention or treatment of cancer.

[0177] The sequence of tOsHMGR2 is shown in SEQ ID NO: 1:

[0178]

[0179] The sequence of AtSQE1 is shown in SEQ ID NO: 2:

[0180]

[0181] The sequence of PgDS is shown in SEQ ID NO: 3:

[0182]

[0183] The sequence of PgPPDS is shown in SEQ ID NO: 4:

[0184]

[0185] The sequence of PgUGT101 is shown in SEQ ID NO: 5:

[0186]

[0187] The sequence of PgUGT74AE2 is shown in SEQ ID NO: 6:

[0188]

[0189] The sequence of PgUGT94Q2 is shown in SEQ ID NO: 7:

[0190]

[0191] The sequence of CYP716A53V2 is shown in SEQ ID NO: 8:

[0192]

[0193] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of the genes tHMGR, SQE, DS, PPDS, UGT101, UGT74AE2, UGT94Q2 and PPTS in the heterologous expression of crop seed endosperm for the production of dammarane-type ginsenosides.

2. A transgenic breeding method for producing ginsenosides in crop seed endosperm, characterized in that, Includes the following steps: S1. Using endosperm-specific promoters of breeding crops, multiple gene expression cassettes were constructed by fusing them with target genes. S2. Based on the type of ginsenoside expected to be produced, combine the gene expression cassettes obtained in S1 to construct a plant expression vector; wherein, the vector for producing PPD-type ginsenosides includes a DS gene expression cassette and a PPDS gene expression cassette, and also includes at least one of the UGT101 gene expression cassette, UGT74AE2 gene expression cassette, and UGT94Q2 gene expression cassette; and / or, also includes at least one of the tHMGR gene expression cassette and SQE gene expression cassette; The vector used to produce PPT-type ginsenosides includes a DS gene expression cassette, a PPTS gene expression cassette, and a PPDS gene expression cassette, and also includes a UGT101 gene expression cassette; and / or, it also includes at least one of a tHMGR gene expression cassette and a SQE gene expression cassette. S3. The plant expression vector constructed in S2 is introduced into the breeding crop recipient, genetically transformed, and transgenic crops that accumulate dammarane-type ginsenosides in the seed endosperm are screened to obtain transgenic crops.

3. The breeding method according to claim 2, characterized in that, The breeding crops include rice, corn, wheat, or soybeans.

4. The breeding method according to claim 2, characterized in that, When the breeding crop is rice, the tHMGR gene is the functional region tOsHMGR2 of the rice OsHMGR2 gene with the sequence shown in SEQ ID NO:1, the SQE gene is the Arabidopsis AtSQE1 gene with the sequence shown in SEQ ID NO:2, the DS gene is the ginseng PgDS gene with the sequence shown in SEQ ID NO:3, the PPDS gene is the ginseng PgPPDS gene with the sequence shown in SEQ ID NO:4, the UGT101 gene is the ginseng PgUGT101 gene with the sequence shown in SEQ ID NO:5, the UGT74AE2 gene is the ginseng PgUGT74AE2 gene with the sequence shown in SEQ ID NO:6, the UGT94Q2 gene is the ginseng PgUGT94Q2 gene with the sequence shown in SEQ ID NO:7, and the PPTS gene is the ginseng CYP716A53v2 gene with the sequence shown in SEQ ID NO:

8.

5. The breeding method according to claim 4, characterized in that, When the breeding crop is rice, the endosperm-specific promoters used are rice endosperm-specific storage protein promoters PGluB2, PGluB1, Pnpr33, PGluD, P10K, P26K and P16K, the sequences of which are shown in SEQ ID NO:9 to SEQ ID NO:15, respectively.

6. The breeding method according to claim 5, characterized in that, Specifically, the following steps are included: S1: Construct one or more of the following gene expression cassettes: tOsHMGR2 gene expression cassette driven by the promoter shown in SEQ ID NO:9; AtSQE1 gene expression cassette driven by the promoter shown in SEQ ID NO:10; PgDS gene expression cassette driven by the promoter shown in SEQ ID NO:11; PgPPDS gene expression cassette driven by the promoter shown in SEQ ID NO:12; PgUGT101 gene expression cassette driven by the promoter shown in SEQ ID NO:13; PgUGT74AE2 gene expression cassette driven by the promoter shown in SEQ ID NO:14; PgUGT94Q2 gene expression cassette driven by the promoter shown in SEQ ID NO:15; and CYP716A53v2 gene expression cassette driven by the promoter shown in SEQ ID NO:

14. S2: Assemble at least one of the PgDS gene expression cassette, PgPPDS gene expression cassette, PgUGT101 gene expression cassette, PgUGT74AE2 gene expression cassette, and PgUGT94Q2 gene expression cassette obtained in S1; and / or, further assemble at least one of the tOsHMGR2 gene expression cassette and AtSQE1 gene expression cassette to construct a multi-gene expression vector pPPD7G for the production of PPD-type ginsenosides; Alternatively, the PgDS gene expression cassette, CYP716A53v2 gene expression cassette, and PgPPDS gene expression cassette, as well as the PgUGT101 gene expression cassette obtained in S1, are assembled; and / or, at least one of the tOsHMGR2 gene expression cassette and AtSQE1 gene expression cassette is also assembled; a multi-gene expression vector pPPT6G for the production of PPT-type ginsenosides is constructed; S3: the multi-gene expression vector pPPD7G or pPPT6G is introduced into Agrobacterium, and the Agrobacterium is used to transform rice callus tissue. After screening and regeneration, transgenic rice plants that accumulate dammarane-type ginsenosides in the endosperm are obtained.

7. A multi-gene expression vector pPPD7G constructed by the method of claim 6, characterized in that, The vector comprises at least one of the following: PgDS gene expression cassette, PgPPDS gene expression cassette, PgUGT101 gene expression cassette, PgUGT74AE2 gene expression cassette, and PgUGT94Q2 gene expression cassette; and / or, at least one of the following: tOsHMGR2 gene expression cassette and AtSQE1 gene expression cassette.

8. A multi-gene expression vector pPPT6G constructed by the method of claim 6, characterized in that, The vector comprises a PgDS gene expression cassette, a CYP716A53v2 gene expression cassette, and a PgPPDS gene expression cassette, as well as a PgUGT101 gene expression cassette; and / or, further comprises at least one of a tOsHMGR2 gene expression cassette and an AtSQE1 gene expression cassette.

9. A transgenic rice plant, characterized in that, The plant is prepared by the method described in claim 6, or contains the T-DNA region of the multi-gene expression vector described in claim 7 or 8 in its genome; dammarane-type ginsenosides accumulate in the seed endosperm of the plant.

10. Use of the transgenic rice plant of claim 9 in the preparation of a medicament for the prevention or treatment of cancer.