Use of miR396f and / or grf7 related biologicals in improving heat tolerance in plants

By regulating rice heat tolerance through miR396f and GRF7-related bioproducts, the shortcomings of traditional strategies have been addressed, and the heat tolerance of rice at different developmental stages has been improved, providing a new approach for genetic improvement.

CN122104783APending Publication Date: 2026-05-29ZHEJIANG FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ZHEJIANG FORESTRY UNIVERSITY
Filing Date
2026-03-23
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the heat resistance of rice, traditional management strategies are inadequate to cope with the high temperature stress caused by global warming, and genetic improvement methods are laborious and time-consuming.

Method used

Heat tolerance in plants can be improved by regulating the expression levels of miR396f and GRF7 through miR396f and/or GRF7-related bioproducts, including recombinant overexpression vectors and silencing vectors.

Benefits of technology

The miR396f-GRF7 module coordinates the thermal adaptation of rice at different developmental stages, provides genetic resources, significantly improves the survival rate and seed setting rate of rice under high temperatures, and reveals a new genetic regulatory mechanism.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104783A_ABST
    Figure CN122104783A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant molecular biology and genetic engineering technology, specifically involving miR396f and / or GRF7 The application of related biological products in improving plant heat resistance. This invention confirms... miR396f This is a heat-inducible miRNA primarily located in the vascular bundles. Its promoter exhibits sequence polymorphisms in the heat-resistant variety HT54 and the heat-sensitive variety HT14, leading to differences in heat stress responses. Through a multi-step screening strategy, this invention identifies and validates for the first time... GRF7 for miR396f A direct target of the rice heat tolerance pathway. Genetic evidence suggests that... miR396f Through negative regulation GRF7 Positive regulation of heat tolerance during the seedling and reproductive stages of rice. This invention discloses... miR396f - GRF7 The module provides important genetic resources for breeding heat-resistant crops.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology and genetic engineering technology, specifically involving miR396f and / or GRF7 The application of related biological products in improving the heat resistance of plants. Background Technology

[0002] Rice ( Oryza sativa Rice cultivation faces severe challenges from increasingly frequent heat waves associated with global warming. High temperatures, especially during sensitive developmental windows such as flowering and fertilization, can severely impact grain filling and lead to significant yield losses. Therefore, developing heat-tolerant rice varieties through molecular breeding is crucial for ensuring food security, requiring a deep understanding of the genetic modules and molecular mechanisms underlying heat tolerance.

[0003] Crop heat tolerance is a complex biological process influenced by genetic, environmental, and managerial factors. In recent years, traditional management strategies have proven insufficient to cope with increasingly frequent heat stress, making the improvement of heat tolerance through genetic modification an urgent priority for stabilizing yield and quality. Map-based cloning has identified several quantitative trait loci (QTLs) and key genes that confer heat tolerance during the seedling or reproductive stages, including... OgTT1 , OsHTAS , OSSLG1 , OgTT2 , OrHTH5 , OsEMF1 , OgTT3 and QT12 .

[0004] Despite these advances, the application of these genes in breeding is still ongoing, and some alleles or haplotypes are only effective in specific genetic contexts. Furthermore, forward genetics methods are often laborious and time-consuming, resulting in a fragmented understanding of the genetic basis of heat tolerance in rice.

[0005] Therefore, there is an urgent need to provide a new strategy to improve the heat resistance of rice. Summary of the Invention

[0006] To solve the above problems, the present invention provides miR396f and / or GRF7 The application of related biological products in improving the heat resistance of plants.

[0007] This invention is achieved through the following technical solution: miR396f and / or GRF7 The application of related biological products in improving plant heat resistance, the miR396f The base sequence is shown in SEQ ID NO.1; GRF7The base sequence is shown in SEQ ID NO.2.

[0008] SEQ ID NO. 1: ucuccacaggcuuucuugaacu.

[0009] SEQ ID NO.2:

[0010] Preferably, the biological product is any one of the following: 1) miR396f Recombinant overexpression vectors; 2) GRF7 Recombinant silent carriers; 3) Recombinant engineered bacteria.

[0011] Preferably, the miR396f The recombinant overexpression vector is the vector that expresses the above-mentioned recombinant overexpression vector. miR396f The precursor pri- miR396f Obtained by inserting into the pCAMBIA1300NU vector.

[0012] Preferably, the precursor pri- miR396f The base sequence is shown in SEQ ID NO.3.

[0013] SEQ ID NO.3: TCCACAGGCTTCTTGAACTGTGAACTCGTGTGTGCATGCTCCTCATATATTGTTCTAGATCCCATGCATGATGCATATCGATCGATCTGATCTGAATTAGGTCATCGATGCGCATCTGGATCCCCATCTTGTTGATAGTTCAAGAAAGTCCTTGGAAA.

[0014] Preferably, the GRF7 The recombinant silencing vector is a vector that targets GRF7 The sequence design was obtained by ligating the gRNA target sequence into a CRISPR-Cas vector.

[0015] Preferably, the base sequence of the gRNA target sequence is as shown in SEQ ID NO.4.

[0016] SEQ ID NO. 4: TGCGAGCGGCACATAAACCGGGG.

[0017] Preferably, the recombinant Agrobacterium is obtained by introducing the recombinant overexpression vector or recombinant silencing vector into Agrobacterium.

[0018] Preferably, the Agrobacterium is... EHA105 .

[0019] Preferably, using the miR396f Recombinant overexpression vectors improve miR396f The expression level and / or the use of the GRF7 Recombinant silencing vectors were used to improve the heat resistance of plants.

[0020] Preferably, the plant is rice.

[0021] Compared with the prior art, the present invention has the following beneficial effects: This invention systematically studies miR396f The expression regulation and biological function of [the organism]. This invention confirms [the following]. miR396f This is a heat-inducible miRNA with significant tissue specificity, primarily found in vascular bundles. This invention reveals differences in its transcriptional response to heat between heat-tolerant and heat-sensitive varieties, which is related to polymorphisms in its promoter region. Through a multi-step screening strategy, this invention identifies… GRF7 yes miR396f The direct target. Genetic evidence suggests that... miR396f-GRF7 The module not only positively regulates heat tolerance during the seedling stage, but also, crucially, plays a regulatory role during the flowering stage. This invention reveals a novel genetic module that coordinates heat adaptation at different developmental stages of rice, providing valuable insights and genetic resources for breeding climate-adaptive crops. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Picture 1 The rice of this invention miR396f The representation pattern diagram; where A is miR396f Relative expression levels of the precursor in different tissues at the seedling and maturity stages of Nipponbare; B represents... miR396f Relative expression levels of mature organisms in different tissues during the seedling and mature stages in Nipponbare; error bars represent ± standard deviation (n=6).

[0024] Picture 2 For the present invention miR396f Tissue specificity and thermal inducibility analysis of promoters; where, represents A in proMiR396f:GUS Image showing GUS staining results in different tissues of transgenic plants; B represents the results of GUS staining in different tissues of the transgenic plant. proMiR396f:GUS Images showing GUS staining results in different tissues of transgenic plants; C shows the localization of GUS signals in specific cell types in roots, stems, and leaves in paraffin sections; D shows enhanced GUS staining after heat treatment; E shows the quantitative analysis of GUS activity after heat treatment; error bars represent ± standard deviation (n=4); ** indicates highly significant differences (…). p <0.01); wild type served as the control group.

[0025] Picture 3 For the present invention miR396f The high-temperature differential response and promoter analysis diagram; where A represents the response under thermal stress. miR396f Dynamic representation diagrams in HT54 and HT14; B represents the dynamic representation in HT54 and HT14. miR396f A schematic diagram of the promoter cis-type components.

[0026] Picture 4 For the identification of this invention GRF7 for miR396f The direct target image; where A is used for identification. miR396f Flowchart of a multi-step target screening strategy; B represents validation via 5' RLM-RACE. miR396f Cutting GRF7 mRNA plot; Left plot: Gel electrophoresis results of rapid cDNA end amplification; Right plot: Detailed sequence alignment of the product shown in the left plot, with arrows indicating cleavage sites; C is a target relationship diagram confirmed by dual-luciferase reporter gene assay; ** indicates extremely significant differences ( p <0.01); ns, no significant difference.

[0027] Picture 5 For the present invention miR396f - GRF7 Module-regulated seedling heat tolerance graph; where A represents the ratio of wild-type (WT) to seedling heat tolerance after heat stress. miR396f Survival rates of knockout lines (KO3-4 and KO3-6); B represents the survival rate of wild-type (WT) and... after heat stress. GRF7 Survival rate of the knockout line (GRF7KO); ** indicates highly significant difference ( p <0.01).

[0028] Picture 6 For the present invention miR396f - GRF7 Module-regulated heat tolerance during reproductive stages; where A represents the ratio of wild-type (WT) to [other types] under normal conditions. miR396f Seed setting rate of overexpression lines (OE6, OE7, and OE9); B represents the ratio of wild-type (WT) to wild-type (WT) after experiencing heat stress during flowering. miR396f Seed setting rate of overexpression lines (OE6, OE7, and OE9); ** indicates highly significant difference ( p <0.01); ns, no significant difference.

[0029] Picture 7 This provides a hint for the transcriptome analysis of the present invention. GRF7 Its role in glucose metabolism; where A represents the role under heat stress. grf7 Venn diagram (top A) and GO enrichment analysis diagram (bottom A) of upregulated genes in mutants; B is... grf7The mutant and the mutant from Chen (2024) GRF7 Overlap of target genes in ChIP-seq.

[0030] Picture 8 For the present invention miR396f A flowchart illustrating the step-by-step target screening process; where A shows the expression levels of 23 genes from the 78 candidate target genes predicted by psRNATarget in the MIM396 material; B shows the expression levels of 10 upregulated candidate target genes. miR396f Overexpression material diagram; C is miR396f Further verification diagrams were obtained from the knockout material.

[0031] Picture 9 This invention utilizes 5' RLM-RACE technology for verification. PIN3t Is it miR396f Target image; where A represents the target image detected using 5' RLM-RACE technology. miR396f right PIN3t The cutting diagram of bZIP34 mRNA (left image A) and PIN3t The actual cleavage site is located 16 bp upstream of the predicted cleavage site (A, right figure); B is a diagram showing that the dual-luciferase reporter gene detection experiment could not confirm the targeting relationship between the two. Detailed Implementation

[0032] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0033] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0034] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0035] Example 1 I. Materials and Methods 1. Plant materials and growing conditions Rice materials included wild-type (WT) varieties 'Nipponbare' and 'Zhonghua 11' (ZH11), 'Nipponbare' being known as Japanese Sunny Day and 'Zhonghua 11' as Zhonghua 11; heat-resistant line HT54, heat-sensitive line HT14, and various transgenic lines in the 'Nipponbare' or ZH11 background: miR396f Overexpression (396fOE) miR396f Knockout (396fKO) miR396 Family knockout line (MIM396, Gao et al., 2015) GRF7 Knockout (GRF7KO) and pro MiR396f :GUS strain. Plants were grown under standard conditions in a grow box / greenhouse (12 hours light / 12 hours dark, 28°C, 70% relative humidity). For heat stress during the seedling stage, 14-day-old seedlings were treated at 45°C. For stress during the reproductive stage, flowering plants were exposed to 39°C for 48 hours.

[0036] The heat-resistant wire HT54 is disclosed in the literature “Wei, H., Liu, J., Wang, Y., Huang, N., Zhang, X.,Wang, L., Zhang, J., Chen, J., Chen, X., and Zhang, L. (2013). A dominant major locus in chromosome 9 of rice (Oryza sativa L.) confers tolerance to 48℃ high temperature at seedling stage. J. Hered. 104: 287–294.”

[0037] The heat-sensitive wire HT14 was provided by Yu Jinsheng of the High-Temperature Resistant Rice Research Group of the Crop Science Department, College of Modern Agriculture, Zhejiang Agriculture and Forestry University. Tel: 13646859568.

[0038] 2. Plasmid construction and plant transformation for miR396f The recombinant overexpression vector will express pri- from HT54. miR396f The genomic fragment was cloned into the pCAMBIA1300NU vector and placed under the Ubiquitin promoter to obtain... miR396f Recombinant overexpression vectors.

[0039] Obtained using CRISPR-Cas9 technology miR396f Knockout mutants.

[0040] miR396 The family knock-down lineage was obtained using the target mimic method and was provided by Researcher Shi Zhenying of the Shanghai Academy of Agricultural Sciences.

[0041] For pro MiR396f :GUS, will come from HT54 miR396f The 2.0 kb promoter fragment of the gene was cloned into the DX2181b vector to obtain pro. MiR396f :GUS.

[0042] for GRF7 Recombinant silent vectors, targeting GRF7 Sequence design of gRNA target sequences was performed, and then these sequences were prepared into Oligo dimers and ligated into a CRISPR-Cas vector to obtain gRNA target sequences. GRF7 The recombinant silent carrier.

[0043] All constructs were validated by sequencing and introduced into Agrobacterium tumefaciens (Agrobacterium tumefaciens). Agrobacterium tumefaciens ) strain EHA105 Used for rice transformation to obtain transgenic lines; among them... miR396f Overexpression and knockout lines used 'Nipponbare' as the receptor. GRF7 The knockout and overexpression lines used ZH11 as the receptor.

[0044] 3. Promoter sequence analysis and cloning from Ensembl Search (https: / / plants.ensembl.org / index.html) OsmiR396f The upstream 2100 bp sequence of the gene was extracted. HT54 genomic DNA was extracted from rice seedling leaves using the CTAB method, and DNA concentration was determined using NanoDrop ONE (Thermo). Due to sequence complexity, KOD FX high-fidelity polymerase (TOYOBO) was used, and the DNA was extracted via primer P~ miR396f F1 and P~miR396fR were used for the first round of nested PCR, followed by primer P~ miR396f F2~-FN and P~miR396fRN were amplified in the second round. OsmiR396f The promoter and the primer sequences used are shown in Table 1.

[0045] Table 1 Primer sequences Table 1 Primer Sequences (Continued) Table 1 Primer Sequences (Continued) Table 1 Primer Sequences (Continued) 4. RNA extraction and qRT-PCR Total RNA was extracted using the TIANGEN RNAprep Pure Plant Kit. For miRNAs, reverse transcription was performed using stem-loop primers and the Hifair® V First-Strand cDNA Synthesis Kit. For mRNAs, SuperMix was digested using Hifair® V one-step RT-gDNA digestion. qRT-PCR was performed on a QuantStudio 6 Flex system using Hieff® qPCR SYBRGreen Master Mix. U6 snRNA and UBIQUITIN11 (UBQ11) were used as internal controls for miRNAs and mRNAs, respectively. 2^ (-ΔΔCt) The method is used for relative quantification.

[0046] 5. GUS staining and activity assay will come from pro MiR396f GUS-stained plant tissues were incubated overnight in GUS staining solution at 37°C, followed by chlorophyll removal with 70% ethanol. The stained tissues were observed under a stereomicroscope. For paraffin sections, the tissues underwent dehydration, embedding, sectioning, and observation. GUS activity was quantified using a fluorescence method with MUG as the substrate.

[0047] 5' RLM-RACE 5' RLM-RACE was performed using total RNA from Nipponbare seedlings using the FirstChoice™ RLM-RACE Kit (Invitrogen™). Gene-specific primers were designed for candidate targets, as shown in Table 1. The RACE product was cloned into the pMD19-T vector and sequenced to identify the cleavage site.

[0048] 6. Dual-luciferase reporter gene assay Will GRF7 and PIN3t Wild-type or mutant target sites are inserted into the 3' UTR sensor vector ( Addgene The effector plasmid contains [something] under the 35S promoter. miR396f Precursor. Utilized by Agrobacterium (strain) GV3101 The reporter gene and effector plasmids were co-infiltrated into Nicotiana benthamiana ( ). Nicotiana benthamiana In the leaves. 72 hours after immersion, the samples were analyzed using a dual-luciferase reporter gene assay system (DLC-C). Prome (USA) to measure luciferase activity.

[0049] 7. Heat resistance test For the seedling stage, the survival rate was calculated after 45℃ stress and 7 days of recovery. For the maturity stage, the seed setting rate of the main spike was determined after 39℃ stress during flowering and subsequent maturity.

[0050] 8. Transcriptome sequencing and analysis from GRF7 Total RNA was extracted from KO and WT (ZH11) seedlings at 14 days of age under control and heat stress (45°C for 12 hours) conditions. Three biological replicates were used for each sample. Libraries were sequenced on an Illumina NovaSeq 6000. Clean reads were aligned to the MSU v7.0 genome using HISAT2. Differentially expressed genes (DEGs) were identified using DESeq2. GO enrichment analysis was performed using AgriGO (https: / / systemsbiology.cau.edu.cn / agriGOv2 / , Tian et al., 2010).

[0051] 9. Bioinformatics Analysis Separating HT54 and HT14 miR396f Promoter sequences were analyzed, and cis-regulatory elements were analyzed using NewPLACE (https: / / www.dna.affrc.go.jp / PLACE / ) and PlantCARE (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ). psRNATarget The web server predicts using default parameters. miR396f The hypothetical target gene (https: / / www.zhaolab.org / psRNATarget).

[0052] 10. Statistical Analysis Data are presented as mean ± standard deviation of at least three biological replicates. Data were analyzed using Student's t-test or one-way ANOVA and Duncan's test (*). p *<0.05), indicating statistical significance.

[0053] II. Results 1 miR396f It is a heat-inducible miRNA with significant tissue specificity. In order to analyze miR396f The expression pattern of this invention is analyzed. miR396f Spatiotemporal expression in 'Nipponbare'. Pre-transcripts (pre- miR396fIt is mainly expressed in the stem during the seedling stage, and in the stem, leaves, and ears during the mature stage, with the highest expression levels in the stem and young ears, such as... Picture 1 As shown in A in the diagram. Mature. miR396f It also accumulates in seedling stems; at maturity, its expression is highest in leaves, followed by spikes, with higher accumulation in mature spikes than in young spikes, such as... Picture 1 As shown in B in the diagram.

[0054] For precise positioning miR396f The present invention generates a product based on HT54. miR396f Transgenic rice with promoter-driven β-glucuronidase (GUS) reporter gene (pro MiR396f Histochemical staining of T2 homozygous single-copy plants showed that GUS activity was present in various tissues, including roots, nodes, leaves, and floral organs, with particularly strong signals in nodes and young shoots, such as... Picture 2 As shown in A and B in the figure. Paraffin sections further refine this localization, revealing that promoter activity is mainly confined to vascular bundles and floral organs, such as... Picture 2 As shown in A~C, especially in the vascular cylinder and cambium of the root, such as Picture 2 As shown in C, this implies miR396f Its role in regulating the process of differentiation.

[0055] Subsequently, the thermal responsiveness of the promoter was tested. Compared with the control, GUS staining was enhanced after heat treatment, such as... Picture 2 As shown in D, quantitative measurements revealed that GUS activity increased approximately 6-fold after 2 hours of heat stress. Picture 2 E is shown in the figure. These results collectively indicate that, miR396f It is a heat-inducible miRNA with significant tissue specificity.

[0056] 2 miR396f Transcriptional responses to heat differ among varieties. Comparison of this invention miR396f Dynamic thermal responses in heat-resistant HT54 and heat-sensitive HT14. qRT-PCR analysis showed that in HT54, miR396f Expression was significantly upregulated by heat, reaching a peak at 24 hours. In contrast, its expression in HT14, while slightly higher than the control, showed a gradual change without a distinct induced peak. Picture 3 As shown in A, this indicates that the transcriptional response is more sensitive and stronger in heat-tolerant varieties.

[0057] This invention clones and compares HT54 and HT14. miR396fPromoter sequences. Both contain a core promoter element and various cis-acting elements associated with stress response, as shown in Table 2. However, sequence alignment reveals differences between the two varieties in the type, number, and location of specific elements, such as... Picture 3 As shown in B, this may partially explain the differences in their thermal stress responses.

[0058] Table 2. Details of cis-type element differences between the HT54 and HT14 starter subregions. Note: + indicates existence, (+) indicates a positive chain, (-) indicates a negative chain; " / " indicates that this item does not exist.

[0059] 3 GRF7 It is rice under heat stress miR396f direct target In order to systematically identify heat stress miR396f The direct target of this invention is a multi-step screening strategy, and the results are as follows: Picture 4 As shown in A, bioinformatics predictions generated 78 potential targets. Meanwhile, from... miR396f Transcriptome data from the overexpression lines showed 690 and 8416 significantly downregulated genes at the seedling and heading stages, respectively. The intersection of these datasets yielded 23 high-confidence candidate target genes, such as... Picture 4 A and Picture 8 As shown in A in the figure. Preliminary qRT-PCR screening using the miR396 family target mimicry line (MIM396) showed that 10 of these genes were significantly upregulated, such as Picture 8 As shown in A. Subsequently, these 10 genes in miR396f Consistent downregulation in overexpression lines, such as Picture 8 As shown in B, and in two independent knockout lines, 7 showed a stable upward trend, such as Picture 8 As shown in C in [the diagram]. Based on this consistent expression pattern, the present invention selects... LOC_Os01g45550 ( PIN3t ), LOC_Os03g59460 ( bZIP34 )and LOC_Os12g29980 ( GRF7 Further verification will be conducted.

[0060] The 5' RLM-RACE experiment confirmed that GRF7 In miR396f The complementary site was cleaved at nucleotides 11-12, consistent with prediction. Picture 4 As shown in B. For PIN3t , PIN3tThe actual cleavage site is located 16 bp upstream of the predicted cleavage site. The cleavage site is not at the predicted location, and no effective cleavage of bZIP34 was detected. Picture 9 As shown.

[0061] To further confirm the targeting relationship, this invention performed dual-luciferase reporter gene assays. miR396f With wild type GRF7 When the reporter gene of 3' UTR is co-expressed, luciferase activity is significantly reduced, but this inhibitory effect is eliminated when the target site is mutated, such as... Picture 4 As shown in C. No observation was made. miR396f right PIN3t The activity of reporter genes is significantly affected. In conclusion, this invention establishes that... GRF7 yes miR396f Directly cuts the target within the body.

[0062] 4 miR396f - GRF7 Module regulation of seedling heat resistance This invention utilized genetic materials to verify the function of this module in seedling heat tolerance. After exposure to 45°C heat stress, two independent... miR396f The survival rate of the knockout lines (KO3-4 and KO3-6, with a survival rate of 13%–17%) was significantly lower than that of the wild type (WT, with a survival rate of 37%), indicating that miR396f Positive regulation of seedling heat tolerance Figure 5 As shown in A. Accordingly, GRF7 The functional deficiency significantly enhanced the plant's heat resistance. grf7 The survival rate of the knockout strain (66% survival rate) was significantly higher than that of the WT strain (9% survival rate). Figure 5 As shown in B in the diagram. This complementary genetic evidence firmly establishes... miR396f By negatively regulating its target GRF7 To positively regulate the heat resistance of seedlings.

[0063] 5 miR396f - GRF7 Module regulation of reproductive period heat tolerance The module's thermal regulation function also holds true during the mature stage. Under normal temperatures, three independent... miR396f The seed setting rate of the overexpression lines (OE6, OE7, and OE9) was not significantly different from that of the WT lines. Figure 6 As shown in A. However, after 48 hours of heat stress at 39°C during the flowering period, all three... miR396f The overexpression lines (with a seed setting rate of 5%–16%) had significantly higher seed setting rates than the WT lines (with a seed setting rate of 8.6%). Figure 6 As shown in B. This indicates enhancement. miR396fExpression can also improve heat tolerance during the reproductive period. Based on seedling stage data, this invention concludes that... miR396f - GRF7 The module serves as a positive regulator of heat resistance in rice at different developmental stages.

[0064] 6 miR396f - GRF7 The module may regulate heat resistance by influencing glucose metabolism. In order to explore downstream pathways, this invention... grf7 Transcriptome analysis was performed on 14-day-old seedlings of the mutant and WT(ZH11) under control and heat stress conditions. Under heat stress, grf7 9425 differentially expressed genes (DEGs) were identified in the plants, of which 4736 were upregulated and 4626 were downregulated, such as Figure 7 As shown in Figure A. Further analysis revealed that 62 of these 4736 upregulated genes were associated with previously published ChIP-seq datasets. GRF7 Direct target overlap. Gene ontology GO analysis of these 62 genes showed that... GRF7 It may participate in biological processes such as oligosaccharide and disaccharide metabolism, such as Figure 7 As shown in B. Further molecular interaction and genetic function analyses are underway.

[0065] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0066] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. miR396f and / or GRF7 The application of related biological products in improving plant heat resistance is characterized by, The miR396f The base sequence is shown in SEQ ID NO.1; GRF7 The base sequence is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The biological product is any one of the following: 2) miR396f Recombinant overexpression vectors; 3) GRF7 Recombinant silent carriers; 4) Recombinant engineered bacteria.

3. The application according to claim 2, characterized in that, The miR396f The recombinant overexpression vector is the vector that expresses the above-mentioned recombinant overexpression vector. miR396f The precursor pri- miR396f Obtained by inserting into the pCAMBIA1300NU vector.

4. The application according to claim 3, characterized in that, The precursor pri- miR396f The base sequence is shown in SEQ ID NO.

3.

5. The application according to claim 2, characterized in that, The GRF7 The recombinant silencing vector is a vector that targets GRF7 The sequence design was obtained by ligating the gRNA target sequence into a CRISPR-Cas vector.

6. The application according to claim 5, characterized in that, The base sequence of the gRNA target sequence is shown in SEQ ID NO.

4.

7. The application according to claim 2, characterized in that, The recombinant Agrobacterium was obtained by introducing the recombinant overexpression vector or recombinant silencing vector into Agrobacterium.

8. The application according to claim 7, characterized in that, The Agrobacterium is EHA105 .

9. The application according to claim 2, characterized in that, Using the miR396f Recombinant overexpression vectors improve miR396f The expression level and / or the use of the GRF7 Recombinant silencing vectors were used to improve the heat resistance of plants.

10. The application according to any one of claims 1 to 9, characterized in that, The plant in question is rice.