A molecular marker related to salt tolerance of oat and application thereof

By developing KASP molecular markers related to salt tolerance in oats and using specific primer combinations to detect the G/A site at SNP sites, the problem of time-consuming, labor-intensive, and inaccurate evaluation of salt tolerance in oat breeding was solved. This enabled early selection and molecular-assisted breeding, improving breeding efficiency and accuracy.

CN122104989APending Publication Date: 2026-05-29INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610452417.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-08
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

In existing technologies, salt tolerance evaluation in oat breeding is time-consuming, labor-intensive, and inaccurate, making it difficult to efficiently screen and cultivate salt-tolerant varieties.

Method used

We developed molecular markers related to salt tolerance in oats, and designed specific primer combinations to detect G/A at SNP sites using competitive allele-specific PCR (KASP) technology. The fluorescence signal reflects allelic variation, enabling early selection and molecular-assisted breeding.

Benefits of technology

This study enabled pre-selection and molecular-assisted breeding of salt tolerance in oats, improving breeding efficiency and accuracy and accelerating the genetic improvement process of salt-tolerant oat varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104989A_ABST
    Figure CN122104989A_ABST
Patent Text Reader

Abstract

The application discloses a kind of molecular marker related to oat salt tolerance and its application, belong to molecular biology technical field.The application takes 144 forages oat as material, by whole genome resequencing and germination rate phenotype determination under salt stress, carries out whole genome association analysis, identifies one SNP site significantly related to oat salt tolerance, which is located at the 375175364 base of chromosome chr1D, and the polymorphism is G / A.According to the SNP site, the application further develops KASP primer combination.Using the molecular marker and primer combination, the salt tolerance of oat seed stage can be quickly identified: oat material with genotype GG has higher germination rate under salt stress, and shows strong salt tolerance, and material with genotype AA is contrary.The method in the application is stable, and has good repeatability, and can be used for early salt tolerance screening and molecular assisted breeding, to significantly improve breeding efficiency and accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker related to salt tolerance in oats and its application. Background Technology

[0002] Oats are an annual crop belonging to the genus *Avena* of the family Poaceae, used for both food and forage. Soil salinization is one of the important abiotic stress factors affecting oat growth and yield, especially its inhibitory effect on seed germination. Germination rate is a key indicator for evaluating crop salt tolerance, and screening and breeding salt-tolerant oat varieties is of great significance for the effective utilization of saline-alkali land and the expansion of planting area.

[0003] Currently, oat breeding in my country is still in the conventional breeding stage, and the exploration and identification of important indicators such as salt tolerance are not in-depth enough. By studying salt tolerance-related genes and their regulatory mechanisms, molecular markers closely linked to salt tolerance can be developed for marker-assisted breeding, thereby improving breeding efficiency and accuracy.

[0004] Traditional selection of salt-tolerant oat varieties relies on evaluating the germination rate of offspring under salt stress. This method is time-consuming, labor-intensive, inaccurate, and easily affected by environmental conditions. Developing specific molecular markers to assist selection based on base differences in target genes is the best way to improve selection efficiency. Kompetitive Allele-Specific PCR (KASP) molecular markers are a novel SNP genotyping method based on allele-specific amplification refractory mutation system (ARMS) and highly sensitive fluorescence detection. The principle involves designing two forward primers and one reverse primer targeting allele SNP sites. Each forward primer carries a unique adapter sequence that binds to different fluorescent groups. Through PCR amplification, allelic variations can be reflected by different fluorescence signals (He CL, et al. SNP genotyping: the KASPassay. Methods Mol Biol, 2014, 1145:75-86).

[0005] Therefore, developing KASP markers closely linked to oat salt tolerance for early selection in breeding is crucial for reducing breeding workload and accelerating oat salt tolerance breeding, while also yielding significant economic benefits. Summary of the Invention

[0006] To address the aforementioned problems in existing technologies, this invention provides a molecular marker related to salt tolerance in oats. The specific information of this molecular marker is as follows: chromosome: chr1D; location: 375175364; SNP genotype: G / A. This invention also designs a primer combination for this molecular marker, which can directly and specifically distinguish and detect the G or A bases at the SNP mutation site. The method in this invention has significant application value, enabling pre-selection and molecular-assisted breeding of salt tolerance traits in oats. It has important theoretical and practical significance for accelerating the genetic improvement of salt-tolerant oat varieties and improving selection efficiency.

[0007] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: One objective of this invention is to provide a molecular marker associated with salt tolerance in oats, which corresponds to the polymorphism of G / A at position 375175364 on chromosome chr1D of the oat genome.

[0008] Furthermore, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0009] The second objective of this invention is to provide a primer combination for amplifying the molecular marker, the nucleotide sequence of which is shown in SEQ ID No. 3 to SEQ ID No. 5.

[0010] A third objective of this invention is to provide a kit comprising the aforementioned primer combination.

[0011] The fourth objective of this invention is to provide a molecular marker chip, including the primer combination.

[0012] A fifth objective of this invention is to provide the application of the molecular marker, the primer combination, the kit, and / or the molecular marker chip in any of the following: a. Predicting the germination rate of feed oats under salt stress; b. Identification and screening of different salt-tolerant oat materials; c. Assisted molecular marker breeding to improve the efficiency of salt-tolerant variety selection; d. Develop salt-tolerant oat breeding products; Furthermore, if the classification result is GG, it is an oat material with high germination rate and strong salt tolerance under salt stress; if the classification result is AA, it is an oat material with low germination rate and weak salt tolerance under salt stress.

[0013] The sixth objective of this invention is to provide a method for identifying or screening oats with different salt tolerances, comprising the following steps: extracting genomic DNA from the oat sample to be tested, performing PCR amplification using the primer combination, detecting the amplification product to determine the genotype at locus 375175364 on chromosome chr1D, and identifying or screening the salt tolerance of oats based on the genotype: if the genotype at this locus is GG, then the oat to be tested is a material with strong salt tolerance or high germination rate; if the genotype at this locus is AA, then the oat to be tested is a material with weak salt tolerance or low germination rate.

[0014] Furthermore, the amplification program is as follows: 94℃ for 15 min; 95℃ for 20 sec, 65–56℃ for 60 sec, 10 cycles; 94℃ for 20 sec, 57℃ for 60 sec, 30 cycles.

[0015] The seventh objective of this invention is to provide a method for cultivating salt-tolerant oats, comprising the following steps: identifying oat genotypes using the method described above for identifying or screening different salt-tolerant oats, screening target individual plants based on genotypes, and propagating the screened target individual plants to obtain salt-tolerant oats.

[0016] Furthermore, the target single plant is a single plant with genotype GG at locus 375175364 on chromosome chr1D.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention identifies a locus (chr1D_375175364) near chromosome 1D at 375.18 Mb that is significantly associated with germination rate of oats under salt stress, with a LOD value of 5.05 and an explainable phenotypic contribution of 14.65%. A KASP primer set was designed for this locus. This KASP primer set can directly and specifically distinguish and detect the G or A bases at SNP mutation sites, possessing significant application value. It can enable pre-selection of oat salt tolerance and molecular-assisted breeding, which has important theoretical and practical significance for accelerating the genetic improvement of salt-tolerant oat varieties and improving selection efficiency. Attached Figure Description

[0018] Figure 1 This is a list of 144 germplasm materials for feed oats in Example 1 of the present invention.

[0019] Figure 2 The GWAS Manhattan plot in Embodiment 1 of the present invention shows that the chr1D_375175364 site is significantly associated with the germination rate.

[0020] Figure 3The allelic genotypes and relative germination rates of 33 oat materials at the chr1D_375175364 locus in Example 2 of this invention are shown.

[0021] Figure 4 This is the composition of the KASP reaction system in Example 2 of the present invention.

[0022] Figure 5 This is the KASP clustering diagram in Embodiment 2 of the present invention (red: AA type; blue: GG type).

[0023] Figure 6 This is a comparison of the relative germination rates of different genotypes of materials in Example 2 of the present invention. Detailed Implementation

[0024] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, and instruments used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventionally used methods.

[0025] The technical solution of the present invention will be further described in detail below with reference to the embodiments.

[0026] Example 1: Identification and Development of Molecular Markers A population for association analysis was formed using 144 forage oat germplasm materials, including core germplasm and representative materials from different ecological regions. Figure 1 All materials are preserved and provided by the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences.

[0027] Germination rate determination under salt stress: After disinfection with 1% NaClO, seeds were placed in a solution containing 200 mmol·L⁻¹ salt. -1 In petri dishes containing NaCl solution (salt stress treatment) or sterile distilled water (control), the germination groups were incubated for 7 days in a constant temperature incubator (24℃ / 20℃, 14 h light / 10 h dark, 60% humidity), with daily replenishment of evaporated water. Germination rate was recorded on day 7, and the relative germination rate was calculated as: (Germination rate of treatment group / Germination rate of control group) × 100%.

[0028] Genomic DNA extraction and sequencing: 100 mg of young leaves were flash-frozen in liquid nitrogen, and total DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit. After concentration and quality were detected by NanoPhotometer NP80, whole-genome resequencing was performed on the DNBSEQ platform, yielding an average of approximately 30 GB of raw data per sample.

[0029] SNP marker mining and screening: Raw sequencing data was filtered via FASTP and aligned to the "PepsiCo OT3098" reference genome. Variation detection was performed using GATK HaplotypeCaller. To ensure marker quality, the raw variant dataset underwent rigorous screening. First, VCFTools was used for preliminary SNP quality control, retaining sites with minor allele frequency (MAF) ≥ 0.05, missing locus rate ≤ 10%, sequencing quality score (Q) ≥ 30, and being dialleles. Subsequently, Plink software was used for further rigorous filtering, with screening criteria including: MAF ≥ 0.01, missing locus rate ≤ 10%, and Hardy-Weinberg equilibrium p-value > 1 × 10⁻⁶. -6 To eliminate the impact of linkage disequilibrium on association analysis, linkage disequilibrium (LD) pruning was performed on SNPs that passed quality control (parameters: window of 500 SNPs, step size 50, r). 2 ≤0.2). In the end, a total of 6,674,386 high-quality, low-redundancy SNP markers were obtained for subsequent genome-wide association analysis (GWAS).

[0030] Genome-wide association analysis (GWAS): GWAS analysis was performed using the MLM model in GEMMA software, with phenotypic data presented as relative germination rates. Model fit was evaluated using QQ plots. Manhattan plots showed a significant association locus (chr1D_375175364) near chromosome 1D at 375.18 Mb, with a LOD value of 5.05 and a phenotypic contribution of 14.65%. Figure 2 ).

[0031] Identification of associated loci: GWAS analysis identified a SNP locus (G / A) located at 375, 175, 364 bp on chromosome 1D, which was significantly associated with germination rate under salt stress. Figure 2 This site is located in the intergenic region, and the flanking sequences have been obtained from the reference genome. The sequences are as follows (lowercase letters indicate SNP sites): SEQ ID No. 1 (G allele flanking sequence, approximately 400 bp in length): CCGCCGCCTCCCCAGTCCATATCGCCACGAAACTCGGAGTCCCAGATGCCCCTCGCTGCCCGCCGGCAGGCCCAACATCGTCGTTGTGCATATCCCAACGCTGTTGATGCCTCACAGAGCCCAATGTTGTCGTTGTTGATGTCTCGTGGGTACCCGTCGGTCCCCGAACCCGACCAAGTCACGGGTCTAGTGGAGAATCG gACCCGACGACGGATATGAGGCCGGGTCATGGGTGCAGGGAGGAGGGACGGGTGCGGGTATTGGGGGCCGAACCCAGGCCCAAACCCGGCAGGTGCCATCCGGAGTTGAATATGGAGAGGAAGCTCCTCAACATTCCGTTGCATTTGTATATATTAGACTAAATAGTGCTAGGATGTTTTGGCTCAAACATTGTTCCTGAT SEQ ID No. 2 (A allele flanking sequence, approximately 400 bp in length): CCGCCGCCTCCCCAGTCCATATCGCCACGAAACTCGGAGTCCCAGATGCCCCTCGCTGCCCGCCGGCAGGCCCAACATCGTCGTTGTGCATATCCCAACGCTGTTGATGCCTCACAGAGCCCAATGTTGTCGTTGTTGATGTCTCGTGGGTACCCGTCGGTCCCCGAACCCGACCAAGTCACGGGTCTAGTGGAGAATCG aACCCGACGACGGATATGAGGCCGGGTCATGGGTGCAGGGAGGAGGGACGGGTGCGGGTATTGGGGGCCGAACCCAGGCCCAAACCCGGCAGGTGCCATCCGGAGTTGAATATGGAGAGGAAGCTCCTCAACATTCCGTTGCATTTGTATATATTAGACTAAATAGTGCTAGGATGTTTTGGCTCAAACATTGTTCCTGAT KASP marker development: Based on this SNP site and its flanking sequences, KASP primers were designed using Batchprimer 3. The primers consist of two allele-specific forward primers (connecting FAM and HEX fluorescent linkers respectively) and one universal reverse primer. The primer sequences are as follows: Specific primer 1 (SEQ ID No. 3, targeting the G allele): 5′-ggagtgagtacggtgtgc ACGGGTCTAGTGGAGAATCGg -3′ Specific primer 2 (SEQ ID No. 4, targeting the A allele): 5′-gagttggatgctggatgg ACGGGTCTAGTGGAGAATCGa -3′ Universal primer (SEQ ID No. 5): CCGGCCTCATATCCGTCGTC Note: Ununderlined parts are fluorescent adapter sequences, and underlined parts are allele-specific sequences.

[0032] Example 2: Use and Validation of Molecular Markers Take another 33 portions of separate oat ingredients ( Figure 3 KASP genotyping verification was performed. The PCR system is shown below. Figure 4 The program was as follows: 94℃ for 15 min; 95℃ for 20 sec, 65–56℃ for 60 sec (decreasing by 0.8℃ per cycle), 10 cycles; 94℃ for 20 sec, 57℃ for 60 sec, 30 cycles. The genotyping results were analyzed by scanning fluorescence signals using an Array Tape system combined with INTELLICS software.

[0033] The typing results showed that 15 of the 33 samples were of type GG and 18 were of type AA. Figure 3 The average relative germination rate of GG type material was 0.92, while that of AA type was 0.79, showing a significant difference. Figure 6 The fractal clustering plot shows that red dots represent type AA and blue dots represent type GG. Figure 5 As can be seen, the molecular markers in this invention can stably distinguish materials with different salt resistance.

[0034] Based on the fact that the molecular markers in this invention can stably distinguish different salt-tolerant materials, they can be used for: (1) predicting the germination rate of feed oats under salt stress; (2) high-throughput identification and screening of different salt-tolerant oat materials; (3) assisting molecular marker breeding to improve the efficiency of salt-tolerant variety breeding; and (4) developing salt-tolerant oat breeding products.

[0035] The genotyping criteria for molecular markers in this invention are as follows: genotype GG: high germination rate and strong salt tolerance under salt stress; genotype AA: low germination rate and weak salt tolerance under salt stress.

[0036] In summary, this invention identified the SNP site chr1D_375175364 (G / A) significantly associated with the germination rate of feed oats under salt stress using GWAS, and successfully developed the KASP molecular marker. This marker exhibits stable genotyping and good reproducibility, and can be used for early salt tolerance screening and molecular-assisted breeding, significantly improving breeding efficiency and accuracy.

[0037] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker associated with salt tolerance in oats, characterized in that, Its polymorphism corresponding to the 375175364th base on the chr1D chromosome of the oat genome is G / A.

2. The molecular marker according to claim 1, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No.

2.

3. A primer combination, characterized in that, It is used to amplify the molecular markers described in any one of claims 1 to 2, with nucleotide sequences as shown in SEQ ID No. 3 to SEQ ID No.

5.

4. A reagent kit, characterized in that, This includes the primer combination described in claim 3.

5. A molecular marker chip, characterized in that, This includes the primer combination described in claim 3.

6. The use of the molecular marker according to any one of claims 1-2, the primer combination according to claim 3, the kit according to claim 4, and / or the molecular marker chip according to claim 5 in any one of the following: a. Predicting the germination rate of feed oats under salt stress; b. Identification and screening of different salt-tolerant oat materials; c. Assisted molecular marker breeding to improve the efficiency of salt-tolerant variety selection; d. Develop salt-tolerant oat breeding products; Furthermore, if the classification result is GG, it is an oat material with high germination rate and strong salt tolerance under salt stress; if the classification result is AA, it is an oat material with low germination rate and weak salt tolerance under salt stress.

7. A method for identifying or screening oats with different salt tolerance, characterized in that, Includes the following steps: Genomic DNA was extracted from the oat samples to be tested, and PCR amplification was performed using the primer combination described in claim 2. The genotype at the 375175364 locus on chromosome chr1D was determined by detecting the amplification product. The salt tolerance of oats was identified or screened based on the genotype: if the genotype at this locus was GG, the oats to be tested were materials with strong salt tolerance or high germination rate; if the genotype at this locus was AA, the oats to be tested were materials with weak salt tolerance or low germination rate.

8. The method according to claim 7, characterized in that, The amplification program was as follows: 94℃ for 15 min; 95℃ for 20 sec, 65–56℃ for 60 sec, 10 cycles; 94℃ for 20 sec, 57℃ for 60 sec, 30 cycles.

9. A method for cultivating salt-tolerant oats, characterized in that, The process includes the following steps: identifying the oat genotype using the method described in claim 7, screening target plants based on the genotype, and propagating the screened target plants to obtain salt-tolerant oats.

10. The method according to claim 9, characterized in that, The target single plant is a single plant with genotype GG at locus 375175364 on chromosome chr1D.